ASSESSMENT OF GENETIC DIVERGENCE AND HYBRIDIZATION STUDIES IN POMEGRANATE GERMPLASM

Transcription

1 ASSESSMENT OF GENETIC DIVERGENCE AND HYBRIDIZATION STUDIES IN POMEGRANATE GERMPLASM Dissertation Submitted to the Punjab Agricultural University in partial fulfillment of the requirements for the degree of DOCTOR OF PHILOSOPHY in HORTICULTURE (POMOLOGY) (Minor Subject: Plant Breeding and Genetics) By Dimpy Raina (L-2009-A-24-D) Department of Fruit Science College of Agriculture PUNJAB AGRICULTURAL UNIVERSITY LUDHIANA

2 CERTIFICATE I This is to certify that the dissertation entitled, Assessment of genetic divergence and hybridization studies in pomegranate germplasm submitted for the degree of Ph.D., in the subject of Horticulture (Minor Subject: Plant Breeding and Genetics) of the Punjab Agricultural University, Ludhiana, is a bonafide research work carried out by Dimpy Raina (L-2009-A-24-D) under my supervision and that no part of this dissertation has been submitted for any other degree. The assistance and help received during the course of investigations have been fully acknowledged. Major Advisor (Dr. P.P.S. Gill) Horticulturist Department of Fruit Science Punjab Agricultural University Ludhiana (India) 2

3 CERTIFICATE II This is to certify that the dissertation entitled, Assessment of genetic divergence and hybridization studies in pomegranate germplasm submitted by Dimpy Raina (L-2009-A-24-D) to the Punjab Agricultural University, Ludhiana, in partial fulfillment of the requirements for the degree of Ph.D., in the subject of Horticulture (Minor Subject: Plant Breeding and Genetics) has been approved by the Student s Advisory Committee after an oral examination on the same. (Dr. P.P.S. Gill) Major Advisor External Examiner (Dr. P.S. Aulakh) Head of the Department (Dr. Gursharan Singh) Dean, Postgraduate Studies 3

4 Acknowledgement First of all, by paying obeisance, I offer foremost gratitude to Almighty for his blessings for my endeavor to f ind out few pearls out of the sea of knowledge which seems to be boundless. It s really ineffable to express my gratefulness for my venerable former advisor Dr. W.S.Dhillon (Director PHPTC, PAU) under whom I completed my 2.9 years (January 2010 to September 2012) of degree. I express my deep sense of gratitude for his sincere guidance, constant supervision and sustained encouragement. It was really fortunate f or me to work under the supervision of such an experienced teacher who inspired and instigated me to work eff iciently. It is my privilege to express my reverence to Dr. P.P.S Gill (Horticulturist, Department of Fruit Science) being my present major advisor, f or appraising my work critically and preparation of manuscript. I have been able to learn a lot and hone my knowledge skills, comfortably under his directions. He guided me from time to time and motivated me with his cooperative, supportive, constructive criticism and generous attitude for achieving my desired goal. My sincere thanks go to members of my advisory committee - Dr. M.I.S Gill (Senior Horticulturist, Dean PG N omine), Dr N.S. Bains (Senior Plant Breeder), Dr. (Mrs.) Yogesh Vikal (Moleccular Geneticist), Dr. Navprem Singh (Assistant Professor Fruit Science) and Dr. Pritpal Singh (Assistant Statistician) f or their constructive suggestions. My special hugs full of thanks for my Papa & Mamma for their benediction, who have always stood by me throughout my lif e. My love and blessings for my younger brother - Kashyap who gave me wonderful & cheerful company and tried his level best to encourage me quite of ten.. Constant, self less and sincere help offered by my dearest f riends Harsimran, Sumitinder, Smily, Sunehali, Babita, Harjinder and Abhishek is also part of my accomplishments so f ar. Last but not the least without the painstaking efforts done by Dr. Anita, Dr. Sarbjeet, Rajdeep Khungar, Richa, Rachna, Anil, Daljinder and all other members of molecular and horticulture labs. They made a friendly atmosphere where I learnt a lot about my research. I couldn t have been able to complete my research work without their ef f icient guidance. So my heart f ull thanks go to them. Place. Date. Dimpy Raina 4

5 Title of the Thesis : Assessment of genetic divergence and hybridization studies in pomegranate germplasm Name of the student and : Dimpy Raina admission no. (L-2009-A-24-D) Major Subject : Pomology Minor Subject : Plant Breeding and Genetics Name and designation of : Dr. P.P.S. Gill major advisor Horticulturist Degree to be awarded : Ph.D (Pomology) Year of award of degree : 2013 Total pages in Thesis : 107+Vita Name of the University : Punjab Agricultural University, Ludhiana, India ABSTRACT The present investigation entitled Assessment of genetic divergence and hybridization studies in pomegranate germplasm. The objectives of this study were to assess genetic diversity based on horticultural traits, characterization of pomegranate genotypes using DNA markers, effectiveness of pollen storage conditions and exploration of the possibilities of F 1 hybrid production during year A significant and wide range of variation was observed among genotypes for various quantitative characters. Higher coefficient of variation was observed for characters like number of hermophrodite flowers per tree (26.67), number of fruits per tree (20.55), yield per tree (22.73), acidity (11.62) and TSS/acid ratio (13.23). Ganesh recorded maximum yield (21.16 kg/plant), fruit weight (309.3 g), aril weight (31.62 g /100 aril weight), peel weight ( g) and TSS (13.39 %) but with minimum juice per cent (28.54 %). Mridula was observed promising for fruit length (6.75 cm), fruit breadth (7.85 cm), TSS/Acid ratio (51.18) and less in acidity (0.26 %). Highest juice per cent (67.26) and lowest TSS (11.0 %) was found in Anar Shirin. Jhodpur White had highest number of hermophrodite flowers (338.3) and fruits per tree (60.84). The yield per tree was found correlated positively with fruit weight, aril weight and peel weight and negatively with juice per cent. The clustering of genotypes into eight different clusters was based on mean values of quantitative characters. The maximum inter-cluster distance of was observed among genotypes of the cluster V and VII and minimum (23.85) between the cluster IV and III. The principal component analysis showed that more than 82 per cent of the variability observed for quantitative characters in different pomegranate genotypes. Genetic divergence among the genotypes was estimated by 47 SSR markers. Six SSR markers (Pom010, ABRII-MP28, PGCT046, PGCT088, PGCT112 and PGCT037) showed monomorphic pattern and 41 showed polymorphic patterns with amplification of alleles ranging from 2 to 4. PIC value ranged from 0 and 0.66 (PGCT093) among 41 polymorphic primers. The UPGMA clustering grouped the genotypes into three main clusters I, II and III. The cluster I comprised of one genotype followed by the cluster II which contained eight genotypes, whereas, sub-cluster IIIA contained 12 genotypes, five and four in sub-cluster IIIB and IIIC, respectively. Genetic similarity values between genotypes ranged from 0.78 to 0.95 and dissimilarity was only Maximum pollen viability was observed at C storage temperature for 9 weeks and highest viable pollens found in Ganesh (95 %) followed by Mridula (94.7 %), Jyoti (92.7 %) and Kandhari (92 %). Highest pollen germination was recorded in Ganesh (78.9 %) followed by Mridula (75.8 %), Jyoti (58.9 %) and minimum in Kandhari (51.6 %). In hybridization study of pomegranate genotypes per cent success rate in terms of fruit set after crossing was achieved. Highest fruit set observed in Mridula x Ganesh (85.54%) and lowest in Mridula x Kandhari (76.61 %). Five SSR primer pair (PGCT093, PGCT059, PGCT097, PGCT111, and ABRII-MP42) was found to produce the polymorphic alleles to confirm the hybridity of hybrids. Key Words: Pomegranate, genotypes, divergence, quantitative characters, SSR markers, hybridization, pollen storage. Signature of the Major Advisor 5 Signature of the Student

6 Koj prbmd dw isrlyk : Anwr dy dogly buitaw iv`c AnuvWiSkI ivibmnqw Aqy doglypn dy AiDAYn dw mulwkx ividawrqi dw nwm Aqy dwklw nm. : ifmpi rynw (AYl-2009-ey-24-fI) mu`k ivsw : bwgbwni inmn ivsw : plwt briifmg qy jynyitks prmu`k slwhkwr dw nwm Aqy Ahudw : fw. pi.pi.ays ig`l hwrtiklcirst imlx vwli ifgri : pi.ayc.fi. (bwgbwni) ifgri imlx dw swl : 2013 Koj prbmd dy ku`l pmny : 107+vItw XUnIvristI dw nwm : pmjwb KyqIbwVI XUnIvristI, luidawxw Swr AMS mojudw Koj Anwr iv`c bwgvwni l`cxw dy ADwr qy AnuvWiSkI ivibmnqw, fi.ayn.ey. mwrkrw di vrqon nwl Anwr diaw dogliaw nslw dw ic`qr-cirqrx, prwg num BMfwrn dy hlwqw di prbwvsilqw, smn dorwn AYP.1 hweiibrg di pydwvwr diaw smbwvnwvw dw mulwkx krn dy mksd nwl Anwr dy dogly buitaw iv`c AnuvWiSkI ivibmnqw Aqy doglygrn dy AiDAYn dw mulwkx isrlyk ADIn Aml iv`c ilawdi gei[ jinotweipw dy imkdwrk guxw iv`c ArQpUrn Aqy bhuq vdyry ivibmnqw pwei gei[ prqi podw hrmoprofwiet PùlW di smikaw (26.67), prqi podw &lw di smikaw (20.55), prqi podw JwV (22.73), AYsIiftI (11.62) Aqy ti.ays.ays:ayisf Anupwq (13.23) dw prvrqk guxwk sb qon vdyry si[ Anwr di gxys iksm iv`c JwV (21.16 iklo/butw), &lw dw Bwr (309.3 grwm) Aqy bijw dw Bwr (31.62 grwm/100 bij Bwr), iclky dw Bwr ( grwm) Aqy ti.ays.ays. (13.36%) sb qon vdyry si pr ies jus di prqisqw sb qon G`t (28.54%) pwei gei[ &l di lmbwei (6.75 sy.mi.), &l di covwei (7.85 sy.mi.), ti.ays.ays.:ayisf Anupwq (51.18 sy.mi.) Aqy G`t qyzwbi mwqrw (0.26%) dy ilhwz nwl mridulw iksm vdyry vdiaw si[ Anwr SrIn iv`c jus di imkdwr sb qon vdyry (67.26%) Aqy ti.ays.ays. di imkdwr sb qon G`t (11.00%) pwei gei[ jodpur vweit iksm iv`c sb qon vdyry hrmoprofwiet PùlW di smikaw (338.3) Aqy prqi podw &lw di smikaw (60.84) iv`c pwei gei[ &l dy Bwr, bijw dy Bwr Aqy iclky dy Bwr nwl prqi podw JwV dw sbmd Dnwqmk si Aqy jus prqisqqw nwl ieh sbmd irxwqm si[ imkdwrk guxw dy AOsq mu`lw dy ADwr qy jinotweipw num A`T smuhw iv`c vmifaw igaw[ smuh V Aqy VII dy jinotweipw drimawn AMdrUnI &wslw sb qon vdyry (72.74) Aqy smuh IV Aqy III, ivcly jinotweipw dw AMdrUnI &wslw sb qon G`t (23.85) si[ prmùk Gtk ivslysx qon pqw cìlaw ik Anwr dy v`ko-v`kry jinotweipw iv`c imkdwrk guxw dy ilhwz nwl 82 prqisq qon vdyry ivibmnqw si[ 47 AYs.AYs.Awr. pcwx icmnhw di vrqon nwl jinotweipw iv`c AnuvWiSkI ivibmnqw dw Anumwn lgwieaw igaw[ AYlIl dy ivsqwr (2 qon 4) nwl, Cy AYs.AYs.Awr. pcwx icmnhw (Pom010, ABRII-MP28, PGCT046, PGCT088, PGCT112 Aqy PGCT037) ny ie`krupi Aqy 41 pcwx icmnhw ny bhurupi smrcnw ivkwei[ 41 bhurupi prweimrw iv`c pi.si.awei. dw mùl 0 Aqy 0.66 iv`c (PGCT093) irhw[ UPGMA smuihk ivdi qihq jinotweipw num iqmn prmùk smuhw I, II Aqy III iv`c vmifaw igaw[ pihly smuh iv`c 1 jinotweip, dujy smuh iv`c 8 jinotweip sn jdonik aup-smuhw IIIA, IIIB Aqy IIIC iv`c krmvwr 12, 5 Aqy 4 jinotweip sn[ jinotweipw di AnuvWiSkI smwnqw 0.78 qon 0.95 si Aqy Asmwnqw kyvl 0.17 si[ sb qon vdyry prwk ivvhwirkqw -20 ifgri sylsias qwpmwn aupr 9 hpiqaw dy BMfwrn qy pwei gei[ gxys iv`c sb qon vdyry (95%) ivvhwirkqw vyki gei ies mgron mridulw, ijeqi Aqy kmdwri iv`c prwg ivvhwrkqw krmvwr 94.7%, 92.7% Aqy 92% si[ prwg kxw dw sb qon vdyry pumgrx gxys (78.9%) iv`c vyikaw igaw Aqy mridulw Aqy ijeqi iv`c ieh pumgrn krmvwr 75.8% Aqy 58.9% pwieaw igaw[ kmdwri iksm iv`c sb qon G`t (51.6%) pumgrn drj kiqw igaw[ Anwr dy jinotweipw dy doglykrn dy AiDAYn qon pqw cìlaw ik kroismg krn auprmq &rut syt dy ilhwz nwl splqw di prqisqqw prqisq si[ mridulw x gxys iv`c sb qon vdyry (85.54%) Aqy mridulw x kmdwri iv`c sb qon G`t (76.61%) PrUt syt di prqisqqw pwei gei vyky gey[ pmj AYs.AYs.Awr. pcwx icmnhw (PGCT093, PGCT059, PGCT097, PGCT111 Aqy ABRII-MP42) ny bhurupi AYlIl di hond idkwei ijsqon hweiibrf ijsqon doglypn di qsdik humdi hy[ Sbd kumji: Anwr, jinotweip, ivibmnqw, imkdwrk gux, SSR pcwx icmnh, dogwlkrn, smuh, prwg dw BMfwrn prmu`k slwhkwr dy hsqwkr ividawrqi dy hsqwkr 6

7 CONTENTS CHAPTER TITLE PAGE NO. I INTRODUCTION 1-4 II REVIEW OF LITERATURE 5-25 III MATERIAL AND METHODS IV RESULTS AND DISCUSSION V SUMMARY REFERENCES VITA 7

8 LIST OF TABLES Table No. Title Page No. 3.1 Pedigree of pomegranate germplasm Composition of CTAB Extraction Buffer Stock and final concentration of different components used in PCR Temperature profile used in PCR The selected microsatellite markers of pomegranate Vegetative characterization of pomegranate germplasm Leaf bud break period of pomegranate germplasm Leaf size (length and breadth) of pomegranate genotypes Flowering period of pomegranate genotypes Number of hermophrodite flowers per plant of pomegranate germplasm Number of fruits and yield of pomegranate genotypes Qualitative fruit and aril characters of pomegranate genotypes Fruit size (length and diameter) of pomegranate genotypes Fruit weight and aril weight of pomegranate genotypes Peel weight and juice per cent of pomegranate genotypes Biochemical fruit characters of pomegranate genotypes Clustering pattern obtained by Mahalanobis D 2 analysis Mahalanobis D 2 cluster distance matrix Mean performance of different clusters Eigen values and proportion of total variability for quantitative characters of pomegranate genotypes as explained by principle components 4.16 Component loading for leaf and fruit physical characters of pomegranate germplasm 4.17 Polymorphic Information Content (PIC) value and number of alleles amplified by SSR markers 4.18 Pollen viability studies of pomegranate genotypes at different storage temperature 4.19 In vitro germination of pollen of pomegranate genotypes stored at different temperature Per cent of fruit set (%) in different F 1 crosses 2011 and Hybridity confirmation by SSR polymorphic markers Genotypic and phenotypic correlation matrix 85 8

9 Figure No. LIST OF FIGURES Title Page No. a Quantitative characters variability in pomegranate germplasm 71 b Dendrogram showing similarity coefficient of 30 genotypes 77 9

10 LIST OF PLATES Plate No. Title 1 Variability in leaf shape (a), leaf apex (b) and leaf base (c) in pomegranate genotypes 2 Variability in flowering types in pomegranate 3 Variability in fruit shape, colour and sizes in pomegranate genotypes 4 Variability in aril colour in pomegranate genotypes 5 DNA amplification profile of pomegranate genotypes with different SSR primers 6 Pollen viability studies of pomegranate genotypes at C storage temperature 7 Pollen viability studies of pomegranate genotypes at room storage temperature 8 In vitro germination of pollen of pomegranate genotypes stored at different temperature 9 In vitro germination of pollen of pomegranate genotypes 10 Amplification profile of Parents and Hybrids.P1, P2, P3 and P4 are parents and H1, H2, H3 and H5 are hybrids. Primer PGCT059 amplified set A, B and C and D by ABRII-MP42 11 Amplification profile of Parents and Hybrids with primer PGCT097. P1 and P2 are parents, H1 and H4 are hybrids and 1, 2, 3, 4, 5, and 6 are F1 population. 10

11 CHAPTER I INTRODUCTION The pomegranate is one of the oldest known edible fruits. Its history dates to very ancient times as mentioned in the Bible and the Quran and is often associated to fertility. Pomegranate (Punica granatum L.) is an economically important commercial fruit plant species belonging to the family Punicaceae which has a single genus Punica and two species P. protopunica Balf. found in Socotra Island (Yemen) and the cultivated P. granatum. According to Smith (1976) P. granatum has 2n = 2x = 16, 18 chromosomes. The somatic chromosome number of cultivar Dholka, Ganesh, Kandhari, Muscat White and Patiala was found to be 2n = 16, while the cultivar Double Flower had 2n = 18 (Nath and Randhawa 1959a). The species granatum has two sub-species viz. Orocarpa and Prophyrocarpa. The former is found in Transcaucasus region, while, the latter in Central Asia (Patil and Karale 1996). The pomegranates are large shrubs or small trees. Dwarf pomegranate (P. granatum L. var. nana) is a miniature variety of the pomegranate most suitable for pot plant production (Baker 1980). Pomegranate (P. granatum) is a favourite table fruit in tropical and sub-tropical regions of the world. It is thought to be indigenous to the region of Iran where it was first cultivated in about 2000 B.C., but it spread to the Mediterranean countries at a very early date (Haye 1957). Now it is grown commercially in Egypt, Iran, Spain, Morocco, Syria, Afghanistan, Turkmenistan, Pakistan (Baluchistan) and India. It is also grown to some extent in Myanmar, China, Japan and USA (California). It has now been taken to most parts of the tropics and sub-tropics. The best quality fruits are produced in areas with cool winters and hot dry summers and it does not fruit well in very humid climates. In India, pomegranate grows well under semi-arid conditions and thrives best under hot dry summer and cold winter provided irrigation facilities are available. It can tolerate frost to a considerable extent in dormant stage, but is injured at temperature below 11 C. As a cultivated crop, pomegranate is grown to limited extent in selected locations in India. The estimated area in India during year was around 107 thousand ha with an annual production of 743 thousand metric tons (Anon 2009). Pomegranate is commercially cultivated in Maharashtra with annual production of 560 thousand metric tons from an area of 82 thousand ha (Anon 2009). Small-scale plantations are seen in Gujarat, Rajasthan, Karnataka, Tamil Nadu, Andhra Pradesh, Uttar Pradesh, Punjab and Haryana. Pomegranate is grown for its delicious and juicy pink seed arils which are eaten fresh, and can be preserved as syrup or used for making jam or fermented into high quality wine. Pomegranate aril juice provides 16 per cent of an adult s daily vitamin C requirement per 100 ml serving and is a good source of vitamin B5 (pantothenic acid), potassium and antioxidant

12 polyphenols. Juice of the pomegranate is effective in reducing heart disease risk factors and seed oil containing polyphenols inhibit estrogen synthesis effective against proliferation of breast cancer cells (Phadin 1974). Thus, nutritional and medicinal properties of fruit increase its economical importance and hence fetch much foreign exchange for the country. India exported 35.2 thousand tonnes of fruits valued at Rs 911 million (Anon 2009). Bhagwa (Kesar) variety is best suited for cultivation in the tropical areas, which is one of the best varieties suitable for export purpose and gaining popularity among consumers, but most of the pomegranates produced is consumed locally and only about 1.0 per cent is exported. To boost pomegranate production in India, both for home and export, development of improved varieties is required which bear fruits having attractive rind and bold and soft grains with dark red and sweet aril. In Punjab, only two promising cultivars Ganesh and Kandhari are recommended for cultivation. The Department of Fruit Science, PAU-Ludhiana, is maintaining germplasm of several varieties of pomegranate introduced from different countries or other parts of the country in order to broaden the genetic base. However, limited information is available about the extent of genetic diversity in the existing germplasm, which is the basis for any genetic improvement programme. The basic step for crop improvement relies on characterization and identification of cultivars. In fruit crops, traditional methods based on phenotypic traits that can be examined only at plant maturity but this approach is slow and subject to environmental influences mainly due to perennial nature and large size of the fruit trees (Kikuchi 1948, Shen 1980 and Westwood 1982) and proved useful for a limited number of cultivars in certain conditions. However, the phenotypic variability seen amongst accessions of tree fruit grown in different areas with slightly different environments and production practices demonstrates number of problems with that approach (Kresovich and Mcferson 1992, Hokanson et al 1998). Isozymes markers have been used for analysis of genetic relatedness. They tend to detect a relatively low level of polymorphism and may depend on the physiology of the plant at the time of analysis (Aruslsekar et al 1986, Chevreau et al 1997, Chung and Ko 1995, Messeguer et al 1987). However, molecular differences, using DNA and protein based markers, are more authentic and less affected by environmental factors. SSRs (simple sequence repeats, also designated as microsatellites) have become the markers of choice in animal and plant species because of their abundance, high degree of polymorphism and suitability for automation (Weber and May 1989). SSR markers have several advantages over other molecular markers, which provide a more reliable method for DNA fingerprinting because of their co-dominant inheritance, large number of alleles per locus, and abundance in genomes. In addition, since SSR analysis is based on the PCR method, the technique is simple and only a small amount of DNA is required. It has already 2

13 been reported that SSR markers have been isolated and used for the construction of genetic linkage maps and cultivar identification in species belonging to the families like Rosaceae, such as apple (Malus domestica Borkh., Guilford et al 1997, Gianfranceschi et al 1998 and Maliepaard et al 1998), Prunus spp. (Cipriani et al 1999), Punica granatum (Pirseyedi et al 2010) etc. Hence, characterization of genotypes at the genetic level supplemented with phenotypic characters could be the first step towards efficient conservation, maintenance and utilization of the existing genetic diversity for future breeding programmes. Various attempts were made to breed the new varieties based on thorough study of inheritance patterns of desirable characters and selection methods. Manohar et al (1981) have reported that economic characters like rind weight, acidity percentage, fruit weight, arils per fruit, yield per tree and number of fruits per tree exhibit high heritability and high genetic advance. Desai et al (1994) reported that desired characteristics of bigger fruits, higher aril, juice, total soluble solids and vitamin C content, coloured arils and soft seeds were favourably associated with each other. Levin (1990) has reviewed achievements of 25 years of pomegranate breeding at Turkmenistan Academy of Agricultural Sciences, Garrygala (Turkmenistan) and reported that the newly bred cv. "Sverkhrannil" is notably very early and has small seed. Amlidana a hybrid of Ganesh x Nana, produce fruits with more acidic (16.18%) anardana and higher fruit yield/tree (Jalikop 2003). Crosses between Daru and Ganesh or Ganesh and Daru yielded fruits with high acidity, pink color arils and hard seeds (Jalikop 2005). Emek released from Israel breeding projects, having low acid, sweet taste and soft seeds (Holland et al 2007). Crosses between sweet sour and sweet cultivars revealed 40 % sour progenies and 90 % sweet progenies when both parents are sweet (Ataseven Isik 2006). Hence there is always a demand of better varieties than existing ones and these new varieties can be bred through hybridization and will help in transfer of desirable characteristics from one cultivar to another which shall serve as a basis to improve the commercial pomegranate cultivars. The pomegranate cultivars flower at different times making it impossible to cross through natural pollination. Storage of pollen is necessary for controlled pollination. Pollen preservation is similar to seed preservation. As well known, pollen germination and pollen viability are necessary for fertilization, seed and fruit formation in particular for fruit species. Most plant growers use in vitro pollen viability and germination because of its fast, cheap and simplicity properties in growing programs for identifying favourable cultivars and genotypes which will be used as pollinizer in orchard establishment and breeding objectives (Sharafi 2010). Hence storage of pollen may serve the purpose besides transportation of pollen to distant places where they can be used for breeding programmes. A limited breeding of new cultivars with desirable traits has been documented till date in sub-tropical pomegranate germplasm due to lack of precise identification and 3

14 characterization of various genotypes based on morphological traits or molecular markers. Therefore, a study of these parameters on existing pomegranate germplasm will be very informative for future breeding programme. Keeping in view the importance of genetic diversity for genetic improvement of pomegranate germplasm, the present study was carried out with following objectives. Objectives i) Assessment of genetic diversity based on horticultural traits. ii) Characterization of pomegranate genotypes using DNA markers. iii) Effectiveness of pollen storage conditions. iv) Exploration of the possibilities of F 1 hybrid production. 4

15 CHAPTER II REVIEW OF LITERATURE Pomegranate (Punica granatum L., Punicaceae) is an ancient fruit plant. The name pomegranate follows the Latin name of the fruit Malum granatum, which means grainy apple. The pomegranate and its usage are deeply embedded in human history, and utilization is found in many ancient human cultures as food and as a medical remedy. Despite this fact, pomegranate culture has always been restricted and generally considered as a minor crop. The pomegranate tree requires a long, hot and dry season in order to produce good yield of highquality fruit (Levin 2006). The traditional usage of the pomegranate as a medical remedy and indicate that pomegranate tissues of the fruit, flowers, bark, and leaves contain bioactive phytochemicals that are antimicrobial, reduce blood pressure, and act against serious diseases such as diabetes and cancer (Seeram et al 2006). These findings have led to a higher awareness of the public to the benefits of the pomegranate fruit, particularly in the western world, and consequently to a prominent increase in the consumption of its fruit and juice. The development of industrial methods to separate the arils from the fruit and improvement of growing techniques resulted in an impressive enlargement of the extent of pomegranate orchards. Until recent years, pomegranates were selected according to the demands of local consumers and not for export. The most of pomegranate cultivars grown today are the result of human selections from naturally occurring varieties. Therefore, the main cultivars found today reflect the local priorities of each country or region e.g the traditional Indian and Spanish cultivars that are characterized by their soft seeds and low-acid taste. Increased world demand and economic importance of pomegranate export constantly influences pomegranate selection criteria, which will have an increasing role in pomegranate breeding. Pomegranate is having a wide germplasm pool extending from Asia, Europe, North Africa, and North America including wild and domesticated accessions Mars (2000). Singh et al (2006) expected that pomegranate germplasm from India might include highly genetically diverse pomegranate varieties that is need to be conserved and characterized. Crop improvement is based on characterization of germplasm for assessing the genetic diversity for any breeding program and further, knowledge of it and its relationships among the cultivated and wild species is important for recognizing gene pools, identifying pitfalls in germplasm collections and developing effective conservation and management strategies (Iezzoni 2008). Characterization is continues to be the first step for the description and classification of germplasm. The pomegranate cultivars have great diversity in their vegetative, flowering and fruiting behavior. The literature pertaining to the variation in plant growth, flowering, fruiting characters amongst the different pear varieties/ strains have been reported by several workers. A brief resume of work on the 5

16 performance of these varieties /strains under different agro-climatic conditions of pomegranate growing areas of the world has been reviewed and documented under the following heads and sub heads Vegetative characters Plant growth behaviour and leaf bud break 2.2. Flowering characters 2.3 Fruit yield per plant 2.3. Fruit characters Physical characters of fruit Fruit colour Fruit shape Fruit size (length and diameter) Fruit weight Aril colour and aril weight Peel weight and thickness Juice percentage Biochemical characteristics of juice Total soluble solids (TSS) Acidity TSS: Acid ratio 2.4. Hybridization studies 2.5. Molecular Characterization Isolation of pomegranate DNA Diversity studies in Pomegranate Diversity studies in related fruits 2.6 Pollen viability, germination and pollen storage studies 2.1 Vegetative characters Plant growth behaviour and leaf bud break The assessment of variability based on morphological triats has been observed by several scientists in pomegranate. Most of the pomegranate varieties are deciduous trees. However, there are several evergreen pomegranates in India. Some evergreen cultivars shed their leaves in higher elevations and colder climates (Nalawadi et al 1973). Fahan (1976) identified pomegranate leaves have an oblanceolate shape with an obtuse apex and an acuminate base. Mature leaves are green, entire, smooth, and hairless with short petioles. They usually have a special glossy appearance (particularly at the upper part of the leaf) and contain idioblasts with secretory substances. Josan et al (1979) observed 4 th week of February 6

17 as the earliest time of the leaf bud break under sub-tropical conditions of Ludhiana. Similar, studies in leaf characters were also carried out by Purohit (1982). The varietal variation in plant growth characters under arid conditions were also reported by Prasad and Banker (2000). Sharma and Dhilon (2002) evaluated 30 evergreen cultivars of pomegranate in Punjab, India. There are clearly prominent differences among pomegranate varieties with respect to leaf shed and should be regarded as conditionally deciduous. The leaves are exstipulate, opposed and pairs alternately crossing at right angles. Some varieties have 3 leaves per node arranged at 120 degrees and even 4 leaves per node on the same tree (2 opposed leaves per node) (Moreno 2005). Balamohan et al (2001) studied on biometrical characters of pomegranate germplasm and revealed that although YCD-1 was the tallest plant, Mridula performed best based on the highest number of branches per plant crop canopy coverage. Singh et al (2006) reported deciduous Indian varieties and identified 16 genotypes that behaved as evergreen in Rajasthan India. Mir et al (2010) also described that pomegranate is deciduous in winter temperature areas but in tropical and sub-tropical areas it is evergreen or partially deciduous. Meena et al (2011) reported that fifty percent of the pomegranate genotypes were found evergreen in nature. The earliest bud sprouting was noted in Siah Sirin i.e., on 13 February Speen Sakarin sprouted the last i.e., on 28 th February. The peak period for bud sprouting was the 1 st week of March Fruit yield per plant Bowler (1975) mentioned that most of the productive varieties yield 60 to 100 pounds per shrub on a mature plant. Most commercial orchards around the world look to have a total yield of 6 to 8 tons per acre but again it varies a lot by variety. There also a variance in the production from year to year based on environmental factors. Ashton (1988) evalauted some pomegranate varieties pomegranate varieties held by the National Clonal Germplasm Repository of the USDA/ARS at Davis, California and observed cultivar Sakerdze high yielding along with Kaj-acik-anor which yielded about about 110 pounds each at maturity and Bala Miursal of lowest yield 60 pounds. Idate et al (2001) observed that cv. Mridula in medium black soils under drip irrigation system, showed an increasing trend in the yield from 50 to 75% RRF (recommended rate of fertilizers). Kafyrova (2003) studied collection of 29 pomegranate accessions from Azerbaijan for viticulture and fruit growing at Derbent in Southern Dagestan. Data revealed that fruit yield ranged from 0.65 t ha-1 in cv Kaim-anar to 7.25 t ha-1 for cv Krmyzy Shirin. Accessions G15-3 (374 g) and VIR Krupnoplodnyi (370 g) produced the largest fruits. Out of 13 cultivars studied for different characters, cultivar Jalore Seedless recorded the highest yield followed by P-23, G- 137, Ganesh and Mridula. Based on best performance for desired characters Jalore seedless, P-23, G-137, Ganesh and Mridula are suitable for cultivation in arid and 7

18 semi-arid region (Singh, 2004). Sharma and Bist (2005) evalauted eight cultivars of pomegranate viz. Anar Shirin Mohammad Ali, Chawla, Ganesh, Jodhpur Red, Kandhari Hansi, Mridula, G-137 and PS-75-K-5 and found yield was significantly high in Kandhari Hansi (24.61 kg/plant) among all other cultivars. Samadia et al (2006) found differences in plant growth behavior of different pomegranate varieties and observed variation in fruit yield per tree with highest in Jalore Seedless (9.78 kg) whereas in cultivars Jhodpur Red, Ganesh and G-137 were at par with moderate fruit load of about 6.5 kg. Mir et al (2007a & c) showed significant variations on all the growth and yield parameters due to various cultivars. The highest yield was recorded in cultivar Dhokla with highest fruit number per plant and highest plant height and spread was recorded in cv. Kabuli Kandhari, whereas maximum number of suckers was recorded in cv. Jyoti. Recently, number of pomegranate cultivars have been studied in temperate region and found high range of variability for plant height and spread (Mir et al 2010). Meena et al (2011) Twenty four diverse bearing 8- to 10-year-old pomegranate genotypes, both exotic and indigenous ( Alandi, Kandhari, Jalore Seedless, Dholka, Jyoti, Jodhpur Red and G-137, as well as 14 exotic genotypes, viz., Siah Sirin, Achick Dana, Gul-e-Shah, Kazak Anar, Sur Sakkar, Speen Danedar, Speen Sakarin, Kali Sirin, Muscat, Ak Anar, Khoj, Bedana Sadana and Shirin Anar ) and stated that Speen Danedar (4.75 kg/ plant) registered the lowest yield followed by Khog (5.04 kg/ plant) as compared to overall mean (7.02 kg/ plant) of the population. Significantly higher yields were recorded for the genotypes Kandhari and Kazak Anar (11.60 and kg plant-1, respectively). The recommended pomegranate cultivars for different regions of the country proved to be superior for their respective yield in comparison to other genotypes. 2.2 Flowering characters Pomegranate is a versatile crop with a high degree of amenability for flowering and ability to produce profuse flowers. A broad knowledge on different aspects of blossom biology viz., flowering season, flower bud development, weight and number of flowers, period of anthesis and its peak time, heterostyly, fruit set due to selfing and crossing, etc., provides a pre-hand idea on the breeding mechanism. Induction of flowering and regulation of number of fruits/plant becomes important to reap lucrative returns through adequate quantity and optimum quality. Pomegranate trees are as a rule deciduous but in hot climates, many cultivars behave as evergreens. Both vegetative and flower buds open well even after warm winters (Chitaley and Deshpande 1970). Flower buds are lateral or terminal and they are mixed, containing both leaf and flower initials. They are born on normal shoots or one to two-year-old spurs developing during the summer season (Singh et al 1978). The flowering in pomegranate is several times in a year, in the hot climate of South India (Nalwadi et al 1973). Several distinct flushes of flowering on the same tree occur quite 8

19 frequently in sub-tropical climates of Northern Hemispheres (Singh et al 1978). Josan et al (1979) also showed variation of flowering duration in pomegranate genotypes where Kandhari Hansi was the earliest to attain full bloom on 10th April 2001 whereas the last to attain full bloom was Jodhpur Red on 9th May 2001 and duration of flowering varied between 39 days in PS-75-K-5 and 55 days in Jodhpur Red. Full bloom was attained in April and first fortnight of May in different cultivars. Flowering was over in all the cultivars by the end of April but in Ganesh, G-137 and Mridula flowers kept on appearing (Singh et al 1967). There are 3 main seasons of flowering viz., January-February (Amb-e- bahar), June-July (Mrig bahar) and September-October (Hast bahar). The crop is regulated to one of the bahars by suspending the vegetative growth through bahar treatment and other cultural practices. Sonawane et al (1991) reported that January-February cropping was the best in quality followed by October cropping. Prasad and Bankar (2003) also reported on the three flowering seasons of pomegranate. (Sharma et al 1996) reported three distinct flowering periods i.e., Amb-e-bahar bahar (March-May), mrig bahar (June-July) and haste bahar (October- November) in evergreen pomegranate Ganesh-I ; whereas deciduous in nature Kandhari flowers once i.e., Amb-e-bahar bahar (April-June) during the year. Meena et al (2011) evaluated 10 indigenous genotypes, viz., Alandi, Kandhari, Jalore Seedless, Dholka, Jyoti, Jodhpur Red and G-137, as well as 14 exotic genotypes, viz., Siah Sirin, Achick Dana, Gul-e-Shah, Kazak Anar, Sur Sakkar, Speen Danedar, Speen Sakarin, Kali Sirin, Muscat, Ak Anar, Khoj, Bedana Sadana and Shirin Anar and reported that Sur Sakkar had the minimum dormancy duration (56 days), whereas, Gul-e-Shah showed the maximum dormancy period (67 days). All the genotypes, which were dormant type in nature showed initiation of the dormancy during the second week of December and continued up to the fourth week of December. The initiation of flowering ranged between 10 th February and 27 th March for P-23 and Speen Danedar, respectively, whereas, completion of flowering was noted between 8 th March to 2 April in Jyoti and Speen Danedar, respectively. However, Sur Sakkar had the minimum duration of flowering (16 days) against Dholka with 39 days of flowering duration. Pomegranate flowers exhibit heterostyly which denotes the presence of 2 or more kinds of flowers with respect to pistil length, pistil is present in all the 3 kinds of flowers including staminate (male flower) but the pistil in staminate flower is rudimentary. The flowers were categorized into pin type (the length of pistil is greater than or equal to or that of stamens e.g., hermaphrodite, intermediate flower) and thrum type (the length of pistil is less than that of stamens e.g., staminate flower (Sheikh et al 2011). They reported that in Ganesh, the length of the pistil was measured to be 2.00, 1.55 and 0.65 cm in hermaphrodite, intermediate and staminate flower, respectively. The length of the pistil was comparatively higher in Ganesh than that of Bhagwa irrespective of the kind of flower. 9

20 The percentage of male flowers is, in general, very important (more than 60-70%) depending on varieties and season, male types drop and rarely set fruits leaving the hermaphrodite type to produce the majority of the crop (El Sese 1988, Chaudhari and Desai 1993). In some situations, perfect flowers are predominant at the beginning of the season, followed by the development of unfruitful flowers and almost all of the normal flowers are produced between the onset of flowering and the end of full bloom (Shulman et al 1984, Hussein et al 1994, Abou Aziz et al 1995). 2.3 Fruit characters A wide range of variability based on physical and biochemical fruit characters has been observed in pomegranate. Holland et al (2007) stated that pomegranate cultivars display a wide range of phenotypic differences such as fruit qualities and secondary metabolites content Physical characters of fruit Fruit colour The fruit colour of the Dholka variety was yellowish crimson with patches of various colours, usually dark pink and purple near the base, lighter near the apex, whereas Japanese Dwarf were greenish yellow with deep pink and purple tinge, whíle Muscat White were greenish yellow with very small green and light pink patches (Nath and Randhawa 1959). Studies conducted by Malhotra et al (1983a) showed that colour of the fruits of various cvs. of pomegranate were either pink or rose with varying intensities. The main shades recorded were Venetian pink, French rose and Claret rose. Shulman et al (1984), while working on two cvs. of pomegranate namely Mules Head and Wonderful, showed that the fruit colour developed gradually and served as criterion for picking. The stage at which 70 to 90 per cent of the skin is red usually correspond with a TSS: acid ratio suitable for commercial picking. Some cvs. such as Malas do not develop any red colour in the skin. Khodade et al (1990) observed the fruit colour of P-23 pomegranate changed from greenish purple to deep pink with reddish and yellowish patches at maturity. Sharma and Dhillon (1996) reported that colour of the fruits of Kandhari cultivar of pomegranate was creamy with red blush, while fruits of Ganesh have creamy with red tinge coloured skin. Studies conducted by Prasad et al (1 999) showed that the colour of the pomegranate fruit cv. Jalore Seedless was changed from greenish to deep pink with red and yellow patches at the maturity of the fruits. Fruit colour changed from light green to deep red in Kandhari and from light green to yellow green with light red tinge in Nabha and Ganesh at maturity (Dhillon & Kumar 2004). Fruit colour of Kandhari Hansi was observed red and rest of cultivars had greenish yellow to pinkish yellow (Sharma and Bist 2005). 10

21 Fruit shape Popenoe (1920) stated that fruits of pomegranate are globose or somewhat flattened, obscurely six sided. Nath and Randhawa (1959) reported that the fruits of pomegranate are globular, somewhat compressed in some cases obscurely ridged. Studies conducted on 21 cvs. of pomegranate at Ludhiana, Malhotra and co-workers in 1983 found that shape of the fruit in all cultivars was either round or oblate, except in Anar Alak, Anar Malas and Kandhari (Saharanpur), where it was round to oblate. Khodade et al (1990) recorded various physicochemical changes during growth and development of pomegranate and noted that the shape of fruit was elongated oval at 30 days stage and changed to round with prominent suppressions from sides and giving 5 to 6 ridges on fruit at advanced stage of maturity. Jalikop and Kumar (1998) studied 18 pomegranate genotypes and reported that the initial elongated oval shape of the immature fruit changed to round at harvest maturity. Ashton (2006) studied that pomegranate fruit are spherical somewhat flattened, also pear shaped, with a calyx (crown) that stays with the fruit. Keramat Jahromi et al 2008 described that physical dimensions of fruits, such as shape, are very mportant in sorting and sizing, and observed round fruit shape in two cultivars Hondos-e-Yalabad and Malas-e-Saveh pomegranate which determined how many fruits can be placed in shipping containers or plastic bags of a given size. Gadze et al 2012 discussed culitivar Konjski zub is more rounded based on fruit shape (L/D ratio) Fruit size Bailey (1917) broadly classified the varieties of pomegranate on the basis of size of the fruits. Commercial varieties of pomegranate of Baluchistan were also classified on the basis of size of the fruits (Caius 1940). Fruits of Kandhari variety were bigger in size than that of Muscut White (Cheema et al 1949). Nath and Randhawa (1959) showed that average length, diameter and circumference of Dholka variety was 7.0 cm, 8.5 cm, 27.7 cm, respectively, whereas in Japanese Dwarf it was 7.35 cm, 7.5 cm and 24.4 cm, respectively. According to Josan et al (1979b) cultivars Kazkai, Shirin Anar and Achikdana had the largest fruits (6.5, 6.32 & 6.26 cm, respectively). Malhotra et al (1983a) found that the fruit length in pomegranate ranged from 3.9 cm as recorded in Afghan Kandhari Seedling to 5.6 cm in Anar Shirin-e-Mohamad Ali whereas in fruit breadth, the cv. Guleshah exceeded others by producing fruits as broad as 6. 8 cm followed by Kazkai 6.1 cm. The lowest breadth (4.1 cm) recorded was in cv. Anar Post-e-Safed Shirin. Godara et al (1989) conducted studies on ten cultivars of pomegranate under Hisar conditions and revealed that maximum length was observed in cv. Achik Dana, which was closely followed by Bedana Sadana and Baskha Linski. The minimum length was in cv. Shirin Anar which was at par with Anar Shirin Mohamad Ali and Kali Shirin. The maximum fruit breadth was in cv. Bedana Sadana. The size of pomegranate fruit continuously increased from anthesis till harvest (Khodade et al 1990). They showed that the length of fruit increased 11

22 from 4.43 cm to 7.82 cm at the time of harvest. Similarly, diameter of the fruit increased from 4.20 cm to 8.33 cm. Prasad et al (1999) showed that length and diameter of fruit of Jalore Seedless pomegranate increased from 4.20 and 4.1 cm to 8.01 cm and 8.32 cm, respectively at maturity. They found linear increase in size and diameter of fruit from set till the harvest of fruit.the fruit length and diameter values were between 73.3 mm ( Konjski zub ) and 83.1 mm (Pastun), and 79.1 mm (Konjski zub) and 95.3 mm (Pastun) Kazankaya et al (2003). Some studies conducted on fruit size of pomegranate cultivars showed the ranged from 61 to 91 and 36 to 104 mm (Yilmaz et al 1992, AL-Maiman and Ahmad 2002). Celik and Erasl (2009) studied physical characteristics of pomegranate cv. Eksinar and found that fruit dimensions varied from 52.9 to 75.0 mm for length and 60.6 to 85.9 mm for width. Varasteh et al (2006) evaluated important fruit characteristics of five commercial pomegranate cultivars in Iran and reported that Malas-e-yazdi had the highest fruit length and diameter ( mm and mm, respectively) and Malase-Torsh-e-Saveh had minimum length and diameter (83.60 mm and mm, respectively) Fruit weight Nath and Randhawa (1989) reported that average mean weight of the fruit in Dholka, Japanese Dwarf and Muscat White cvs. of pomegranate was 14 ounces, 6.2 g and 14 ounces, respectively. Dastemirov and Babaev (1969) studied five pomegranate cvs. and revealed that the fruit of Shirin Anar weighed between 500 and 800 g. The weight continued to increase until the harvest. Malhotra et al (1983a) concluded that fruit weight of pomegranate ranged from the lowest of 56.8 g in cv. Afghan Kandhari Seedling to as high as g in Kazkai and the cultivars such as Baskhi Kalinski, Dholka, Chola Selection-1 and Chola Selection-II, produced fruits of medium weight. Misra et al (1983) found that fruit weight was more in cv. Anar Shirin-e- Mohamad Ali (295.0 g), followed by Shirin Anar (250 g) and Dholka (242 g) and the cultivars Anar Shirin-e-Mohamad Ali had more fruit volume and produced fruits of bigger size, followed by Dholka, whereas, the Kandharí had smaller fruits. Shulman et al (1984) studied the fruit growth and development of pomegranate and found that the fruit grows continuously from fruit set until the commercial harvest time. The pattern of fruit growth shows a single sigmoid curve for the cv. Mules Head, whereas in Wonderful, the growth was more linear. At the end of harvest the average weight of the fruit in Bet Shean Valley was 350 g for Mules Head and 400 g for Wonderful and on the coastal plain, it was 250 g and 350 g, respectively. Godara et al (1989) reported that maximum fruit weight of 224 g was obtained in cv. Bedana Sadana of pomegranate and minimum of 97 g was in Shirin Anar. Khodade et al (1990) found that fruit weight continuously increased from 48 g to g from fruit set to harvest. Sharma and Dhillon (1996) reported that average fruit weight in Kandhari and Ganesh cvs. of pomegranate was 250 and 282 g, respectively. Prasad et al (1999) found linear increase in fruit weight of cv. Jalore Seedless from fruit set till the harvest of fruit. 12

23 Vishwanath et al (1999) reported that fruit weight of pomegranate ranged from to g. Prasad and Banker (2000) reported that Jalore Seedless has maximum fruit weight (216.4 g), followed by G-137 (208.1 g) cv. of pomegranate. Sharma and Dhillon (2002) reported maximum fruit weight of 450.0g was recorded in Ganesh followed by 400.0g in PS-77 and 330.5g in Basse-in-Seedless. However, the minimum (200.0g) fruit weight was noted in Jodhpur White cultivar. Dhillon & Kumar (2004a) reported that weight of the fruit weight increased up-to 150 days after anthesis to maturity. The maximum average fruit weight among all the cultivars was recorded as g in Kandahri Hansi and minimum in case of Anar Shirin Mohammad Ali i.e g (Sharma and Bist 2005). Ten pomegranate (Punica granatum L.) cultivars namely Kabuli Kandhari, Chawla, Ganesh, Mridula, Jyoti, G-137, Dholka, Bedana, Kandhari and Local check were evaluated for fruit weight and was found significantly more in cv. Bedana compared to rest of the cultivars under study (Mir et al 2007a-c). Varasteh et al (2009) evaluated important fruit characteristics of five commercial pomegranate cultivars in Iran and reported that Malas-e-Yazdi had the highest fruit weight g and Malase-Torshe- Saveh had minimum fruit weight ( g) Aril colour and aril weight Cheema et al (1949) stated that seeds of Muscat variety were light rosy in colour. Seeds of Dholka variety were white with light pink spots, whereas Japanese Dwarf was creamy white with pinkish spots (Nath and Randhawa 1959). Malhotra et al (1983a) reported that arils had different shades like Claret rose, Dawn pink, Venetian pink. French rose, etc. while working with different pomegranate cultivars. Khodade et al (1990) showed that percentage of arils on fruit weight basis, increased with the advancement of maturity. They also reported that the colour of arils was milky initially and turned to creamy pearl white from 120 days onwards which intensified with advancement of fruit maturity. Sharma and Dhillon (1996) noted that arils develop light pink colour in Kandhari, while Ganesh cv. of pomegranate developed white aril colour with light pink tinge. Jalikop and Kumar (1998) studied 18 genotypes of pomegranate (Punica granatum L.) and found significant variations within soft types for 100 aril weight, within semi-soft varieties for 100 aril weight aril weight g of fruit. The data recorded by Prasad et al (1999) on qualitative changes during growth and development of pomegranate fruit showed that the percentage of arils and aril/rind ratio increased continuously with advancement of maturity. Percentage of arils increased rapidly from to 67.5 up to December 5 and thereafter, it was almost constant. As far as colour of aril is concerned, initially it was milky white and later turned to pinkish red to dark red with the commencement of maturity. Gozlekci and Kaynak (2000) found that aril weight increased during development of the fruit. Sharma and Bist (2005) studied red colour aril in Kandhari Hansi and PS-75-K-5 whereas in all other cultivars it was light pink to deep pink. Gazeb et al (2012) studied three 13

24 main pomegranate cultivars in the Neretva valley in south Dalmatia of Croatia in October 2009 and observed light pink aril colour in cv. Konjski zub while red in cvs. Pastun and Ciparski Peel weight and thickness Nath and Randhawa (1959) reported that rind thickness in cvs. Dholka, Japanese Dwarf and Muscat White of pomegranate were 0.7, 0.2 and 0.3 cm, respectively. Malhotra et al (1983a) while working with different pomegranate cultivars observed that the rind thickness ranged from 0.13 cm in Afghan Kandhari Seedling to 0.27 cm in Bedana. According to Misra et al (1983) in Srinagar special pomegranate cultivar exhibited more rind thickness (0.69 cm) than cv. Kandhari which had rind thickness of 0.27 cm. Godara et al (1989) recorded maximum rind thickness in cv. Russian Seedling (3.93 cm), followed by Achik Dana (3.83 cm) and Surkh Anar (3.80 cm). The cv. Baskha Linski had minimum thickness (1.20 cm) and rest of the cultivars had medium thickness. Studies conducted on fruit development of pomegranate by Khodade et al (1990) showed that percentage of rind and rind thickness decreased gradually from anthesis till the maturity of fruit. Similar results with regard to rind thickness and rind weight were found by Prasad et al (1999). Singh et al (2011) reported maximum peel weight in Kandhari (102g) and minimum in Ganesh (82 g) Juice content Siddappa (1943) reported that in one good variety of pomegranates the juice was per cent of entire fruit. While, Malhotra et al (1983b) reported that the juice percentage varied from 62.5 per cent in Surakh Anar to 80.8 per cent in Anar Shirin- e-mohamad Ali. The other cultivars with high juice content were Guleshah (78.7%), Achik dana (77. 1%), Suni Bedana (76.5%) and Ak Anar (76.4%). Shulman et al (1984) reported that initially juice content of pomegranate was less than 25 per cent of the total fruit weight. As the fruit matured, the juice content continued to increase up to harvest time. The juice content in Mules Head reaches 35 and 40 per cent and in Wonderful 40 and 45 per cent in coastal plains and Bet Shean Valley, respectively. Godara et al (1989) recorded highest juice percentage in cv. Russian Seedling (68.37), followed by Bedana Sedana, while maximum juice was obtained in cv. Surkh Anar and Kali Shirin. The juice content in pomegranate cv. P- 23 increased from to per cent with advancement of maturity of fruit (Khodade et al 1990). Fruits of two pomegranate cultivars (Jalore Seedless and Khog) were harvested from five years old trees in December and January. Jalore Seedless cv. contained more juice. The fruits harvested in January contained high juice content than those harvested in December (Singh 1994). Prasad et al (1999) noted that juice percentage in Jalore Seedless pomegranate increased from to with the advancement of fruit maturity. Similarly, Viswanath et al (1999) found juice percentage between to in pomegranate. Sharma and Bist (2005) recorded maximum juice percentage as per cent in G-137. The juice percentage 14

25 of pomegranate cultivars varied from 29.55% (Rabbab-e-Fars) to 42.57% (Faroogh) Fadavi et al (2006) Biochemical characteristics of juice Total soluble solids (TSS) Siddappa (1943) observed that in pomegranate, TSS ranged from 17.3 to 18.5 per cent, while, Nath and Randhawa (1959) obtained 9.0 per cent TSS in Dholka and Japanese Dwarf varieties of pomegranate, whereas in Muscat White, TSS observed was 10.0 per cent. The TSS increased with ripening process and reached maximum with complete maturation of berries of Anab-e-Shahi (Dhillon and Bajwa 1974). Lodh and Selvaraj (1974) also obtained similar results in Banglore Blue grapes. Mann et ai (1978) reported that TSS of fruit pulp in Patharnakh pear continued to increase from fruit set up to the final stage of harvest. In pomegranate, Malhotra et al (1983b) concluded that TSS content in the juice ranged from 9.2 per cent in cv. Afghan Kandhari Seedling to 12.9 per cent in Suni Bedana. Shulman et al (1984) reported that TSS increased gradually during fruit development. At the beginning of harvest in mid-august, the TSS of Mules Head was 11 to 14 per cent and reached 14 to 15 per cent later in September. In cv. Wonderful, the TSS reached 13 to 14 per cent in mid-august and 15 to l6 per cent by end of September. The data on chemical changes during growth and development of pomegranate fruit showed that TSS increased from to per cent with the advancement of maturity (Khodade et al 1990). Sharma and Dhillon (1996) recorded that juice of Kandhari contained 14.0 per cent, while Ganesh contained 13.8 per cent TSS. Whereas, Prasad et al (1999) reported that TSS increased with the advancement of maturity in Jalore Seedless pomegranate. Similar results were obtained by Gozlekci and Kaynak (2000) in pomegranate. Prasad and Banker (2000) reported that the TSS in juice of different cultivars ofpomegranate ranged from 16.2 Brix in Jodhpur Red to 18.8 Brix in Bassin Seedless. Sharma and Bist (2005) described that total soluble solids varied from B in PS-75-K-5 to 14.4oB in Anar Shirin Mohammad Ali. Gadze et al (2012) reported variability in TSS in different pomegranate genotypes with maximum15.2 and 15.6 in cv. Pastun followed by Ciparski as 14.8 and 15.1% and Konjski zub (13.1 and 15.0%) Acidity In general the acidity ranged from 0.81 to 1.23 per cent in pomegranate varieties for table purposes (Siddappa 1943). Hayes (1953) reported that acids in pomegranate ranged from 1.5 to 2.5 per cent. Nath and Randhawa (1959) recorded 0.4, 0.6 and 0.38 per cent acidity in Dholka, Japanese Dwarf and Muscat White varieties, respectively. Dastemirov and Babaev (1969) observed 0.64 per cent acidity in Shirin Anar and 1.34 per cent in Kyzyl- Kabuh Varieties of pomegranate. An increase in total soluble solids and corresponding decrease in acidity in mango has been found by Harding and Hatton (1967) and Teotia (1968). Lakshminaryana (1973) worked on Alphonso mangoes and found that acidity reached a peak 15

26 around the 7th week but decreased at harvest. Dhillon and Bajwa (1974) reported in Anab-e- Shahi grapes that acidity decreased as maturity advanced. Malhotra et al (1983b) reported that total organic acid content as citric acid ranged from the lowest of 0.49 per cent in Anar Shirin-e-Mohamad Ali to as high as 2.30 per cent in Kandhari cvs. of pomegranate. Shulman et al (1984) reported that acid content of juice in pomegranate decreased with maturation. Acidity in pomegranate cv. Mules Head was very low (< 0.5%) even at early stages of fruit development. In cv. Wonderful the acidity was very high in June and then decreased considerably. Godara et al (1989) found that the acidity ranged from 0.71 per cent in Ak Anar and Anar Shirin Mohamad Ali to 6.46 per cent in Russian Seedling cvs. of pomegranate. Developmental studies in pomegranate conducted by Khodade et al (1990) showed that the acidity in P-23 pornegranate decreased from per cent at initial stage to per cent at maturity. The juice of Kandhari and Ganesh cultivars of pornegranate contained 0.67 and 0.43 per cent acidity, respectively (Sharma and Dhillon 1996). Jalikop and Kumar (1998) reported that juice of Ganesh pomegranate contained 0.78 per cent acidity while that of cv. Nabha contained per cent. However, Prasad et al (1999) noted that acidity in pomegranate juice decreased from to 0.30 per cent at maturity. Melgarejo et al (2000) found that citric acid was predominant in pomegranate juice with the range of to g/l00 g. Malic acid was the second most abundant, with a range of to gi l00 g. Prasad and Bankar (2000) showed that acidity ranged from per cent in Jodhpur Red to per cent in Bassein Seedless pomegranate cultivars. Sharma and Bist (2005) reported that titratable acidity was minimum i.e per cent in G-137 and maximum in Kandhari Hansi i.e per cent. Acidity of fruit juice was significantly higher in Pastun (4.3 %) compared to cv. Ciparski (0.9 %) and Konjski zub (1.4 %) reported by (Gadze et al 2012) TSS: Acid ratio Khodade et al (1990) reported that TSS: acid ratio in pomegranate juice increased from to with advancement of maturity. The increase in TSS acid ratio was because of increase in sugar content in juice and reduction in acidity with maturity (Prasad et al 1999). Viswanath et al (1999) observed that TSS: acid ratio in pomegranate ranged from to Sharma and Bist (2005) reported TSS/ acidity ratio ranged between in Kandhari Hansi to in G-137. A significant variation in general characters of fruit in fourteen cultivars of pomegranate was assessed by Khosla and Kumar (2009). The physicochemical composition of 25 pomegranate cultivars grown in Iran has been characterized by (Barzegar et al 2004). Sarkhosh et al (2005) studied the correlation between quantitative and qualitative characteristics of pomegranate in different regions of Iran. 16

27 2.4 Hybridization studies Genetic improvement in pomegranate has, for centuries, depended on the selections from seedlings variability and their clonal propagation (Pareek and Sharma 1993). For success of hybridization in any crop sufficient knowledge on pollination behaviour is necessary. Snyman (1991) illustrated that the poor success rate of controlled hand pollination and described a practical approach for selecting new improved cultivars from open pollinated seedlings. The major disadvantage of this method is that success is only possible if a very large number of seedlings are established, with the consequent disadvantage of expensive maintaince and evaluation by skilled manpower. One of the reasons for the success of the above mentioned approach is the fact that certain imortant traits of the female parent (eg. fruit colour, fruit taste and size) are inherite by the progeny. Thus, despite the pollen donor being unknown, many important traits of female are detectable in the progeny. The pomegranate has been described as self-pollinated, cross-pollinated, highly cross-pollinated or often crosspollinated. Recent investigations demonstrated that it is capable of both open and self pollination. Trials conducted with several cultivars showed that fruit set was 79% and 43.3% for, respectively, intact open and self pollinated flowers or 26.4% and 66.2% for the same after emasculation (Karale et al 1993). The mean fruit set was found to be 48.88% with a fruit retention of 47.77% at one month after crossing Ganesh and Bhagwa and the cross pollination of pomegranate was also documented by Gammie and Patwardhan (1929). Singh et al (1980) showed that per cent age fruit set in hybridization can be substantially increased if the process of bagging the panicles after crossing is eliminated. They further stated that once the flower was carefully pollinated, there was hardly any chance of contamination from foreign pollen since the stigmatic surface was very small and the pollen deposited first had an advantage of giving as high fruit set as 3.85 per cent. Some breeding programmes have been achieved, recently, and some selections may be found as a result of these works. Keskar et al (1993) reported that breeding efforts with pomegranate in India began in 1905 to meet the consumer preferences for its attractive, juicy, sweet-acidic and refreshing arils and growing demand for good quality fruits both for fresh use and processing into juice, syrup and wine. Many more pomegranate hybrids have been developed by Levin et al (1995), Mars et al (1996) and Lui et al (1997). Nageswari et al (1999) described that Ganesh was extensively used in India for breeding and crosses with other cultivars, such as Kabul (large fruit, yellow red skin, sweet, hard seeds); Jyoti and Bedana (medium-size fruit, brownish skin, sweet, soft seeds); Nana and Kabul Yellow. Pareek (1996) developed Hybrid No , named Ruby, and has dark red and non-sticky arils, soft seeds with high sweetness and low tannins. Prasanna (1998) developed 2900 pomegranate hybrids of single, double, three way and other complex crosses including F 2 progenies and selected the promising ones which have superior fruit quality of Ganesh and 17

28 Kabul, deep red colour of Gulsha Rose Pink. Soft-seeded pomegranates were recommended by Jalikop and Kumar (1998) as parents for developing high-juice cultivars due to their significantly higher content of juice. Karale and Desai (2000) measured heterosis for fruit characters manifested by the individual hybrids over mid-parental value. They found that heterosis values were maximal for juice weight and aril weight percentage. Jailkop et al (2005) employed a cross between Daru and Ganesh to develop a tropical anardana variety and disease resistance for bacterial nodal blight. Varasteh et al 2006 considered five commercially important Iranian cultivars Malas-e-Saveh, Rabab-e-Neyriz, Malas-e- Yazdi, Sishe Kape-Ferdos, and Naderi-e-Budrood valuable and discussed their fruit characteristics and their potential for future breeding. Inheritance of fruit characteristics such as skin and aril colour, taste and seed softness was studied using several combinations of crosses between the cultivars Fellahyemez, Ernar, and Hicaznar and when the sweet-sour Hicaznar was crossed with the sweet cultivar Ernar, about 40% of the progenies were sour; when both parents were sweet, about 90% of the progenies were sweet (Ataseven Isik 2006). Holland et al 2007 reported two populations of crosses between Wonderful and evergreen cultivars from an Indian origin were established and these populations and their F2 selfed progenies would also serve to study the inheritance of important traits such as anthocyanin content in the skin and arils of the pomegranate fruit and the inheritance of the evergreen phenotype. Singh (2011) also reported that in the past, focus of research has been on development of high yielding cultivars and hybrids having resistance to biotic and abiotic stresses besides processing quality. Fruit quality attributes of peach and nectarine varieties was studied by Colin et al (2009) for the breeding programme at Ebro valley, Spain to obtain mid to late season varieties. They observed that flowering and harvesting time varied every year depending on the annual temperature and other related factors. Yadav et al studied nine mango (Magirera indica) genotypes having dwarf stature were compared to the control Alphonso for morphological and fruit characteristics, in order to identify those with potential for use in breeding programmes. Varieties Kerala Dwarf and Janardhan Pasand were the most suitable for usage as donor parents. Negi et al (1996) reported more number of hybrids was obtained when Tommy Atkins was used as male parent in mango breeding. D Cruz and Babu Rao (1962) reported that crosses made at IARI, New Delhi, between seeded diploid (Allahabad Safeda) and seedless triploids to induce seedlessness have resulted in many dsiploids, trisomics and tetrasomics. Of these, tetrasomic owing to their dwarfing habit (Aneuploid- 85) and normal fruit shape and size with few seeds have tremendous scope to be utilized as a rootstock. 18

29 2.5 Molecular Characterization A wide range of morphological and physiological characteristics show variability in the pomegranate, still have many limitations for being used as markers particularly in fruit crops because of long generation time and large size of fruit trees besides being influenced by environment. To avoid mis-identification of cultivars and to protect plant varieties, efficient tools are needed such as DNA fingerprinting. Several methods may be used to analyze the genetic diversity and to identify the varieties. The traditional methods rely on phenotypic traits that can be examined only at plant maturity. Molecular markers offer an attractive alternative or complement to identification based on phenotypic characters and can be used at any stage of maturity. The relevant literature has been reviewed under the following heads: Isolation of pomegranate DNA Diversity studies in Pomegranate Diversity studies in related fruits Isolation of pomegranate DNA Genomic DNA extraction is pre-requisite for the molecular applications. The presence of high concentrations of polysaccharides, polyphenols, proteins and other secondary metabolites in pomegranate poses problem in getting good quality DNA which is almost insolvable in water or TE buffer, and inhibits enzyme reactions (Reski 2002) and are also unstable for long term storage (Sharma et al 2002). Presence of phenolic compounds caused browning of tissue and supernatant during the extraction process, despite supplementation with PVP, as suggested by standard methods. Bokszczanin and Przybyla (2006) modified the CTAB extraction procedure of Aldrich and Cullis (1993) by including copper (II) acetate treatment, obtained high-quality DNA. Copper (II) acetate enabled fixation and removal of tannins. The DNA yield from this procedure is high (up to 1.25 micro g of DNA/mg of leaf tissue). This DNA is completely digestible with restriction endonucleases and suitable for generation of molecular markers, such as random-amplified polymorphic DNA and amplified fragment length polymorphism analysis, indicating freedom from common contaminating polyphenolic compounds. Large quantities of polysaccharides are known to interfere in many analytical applications and therefore, lead to wrong interpretations (Singh et al 2010). CTAB found to prevent the polysaccharide co-precipitations. The presence of polyphenols can reduce the yield and purity by binding covalently with the extracted DNA, the mixing of PVP along with CTAB might bind to the polyphenolic compounds by forming a complex with hydrogen bonds and help in removal of impurities to some extent. Similar residual phenols and polysaccharides were removed and DNA was precipitated selectively in the presence of high salts in some woody plants (Fang et al 1992). Tannins, terpenes and resins considered as 19

30 secondary metabolites are also difficult to separate from DNA (Mazid et al 2011). Sodium acetate treatment fixed and removed tannins and the extra secondary metabolites. The additional step of purification with Tris Saturated Phenol: Choloform (ph 8.0) followed by chloroform: isoamyl (24:1) removed excess impurities of proteins, polysaccharides and phenols. DNA isolation procedure also yields large amounts of RNA, especially 18S and 25S rrna (Joshi et al 2010). Large amounts of RNA in the sample can chelate Mg 2+ and reduce the yield of the PCR. A prolonged RNase treatment degraded RNA into small ribonucleosides that would not contaminate the DNA preparation and yielded RNA-free pure DNA. Additional precipitation steps removed large amounts of precipitates by centrifugation and modified speed and time. Several plant DNA extraction protocols have been reported in fruit crops like mango (Mangifera indica L.) citrus (Citrus spp.), litchi (Litchi chinensis S.), custard apple (Annona squasoma L.), guava (Pisidium guajava L.) and banana (Musa spp.) (Porebski et al 1997). Similarly, Xu et al (2004) gave protocol for DNA extraction in chestnut with combined use of CTAB method and potassium acetate which results in high yield of DNA ( µg/g of fresh weight of leaves). Angeles et al (2005) presented a protocol to extract high quality genomic DNA from coconut leaves by using a method modified from Dellaporta et al (1983) (as modified by Datta et al 1997) and Cheung et al (1993) (as modified by Rogers et al 1996) with the use of a higher salt concentration (2 M instead of 0.5 M) to remove polysaccharide contaminants and the addition of the water-insoluble PVPP to remove polyphenols. This method does not use organic solvents, compared with other protocols. The DNA obtained by this method can be used in molecular biology applications such as PCR and Southern blotting. Lodhi et al (1994) developed a quick, simple and reliable DNA extraction method for grapevine species, hybrids and Ampelopsis (Vitaceae) based on CTAB-based extraction procedure modified by the use of NaCl to remove polysaccharides and PVP to eliminate polyphenols during DNA purification and concluded the method also was used successfully for extraction of total DNA from other fruit species such as apple (Malus domestica), apricot (Prunus armeniaca), cherry (Prunus avium), peach (Prunus persica), plum (Prunus domestica) and raspberry (Rubus idaeus). DNA yield from this procedure was high (up to 1 mg/g of leaf tissue) and completely digestible with restriction endonucleases and amplifiable in the polymerase chain reaction (PCR), indicating freedom from common contaminating compounds. Azmat et al (2012) isolated DNA from mature and young leaf samples from ten commercial cultivars of mango with modified CTAB protocol which yielded high concentrations (950 to 1050 µg) of good quality DNA (A 260 /A ) fit for PCR application. 20

31 2.5.2 Diversity studies in pomegranate A wide range of molecular markers had been used to assess genetic diversity of pomegranate cultivars as well as wild genotypes from different parts of the world. Molecular markers could be appropriate choice to study and preserve the diversity in any germplasm (Brini et al 2008). A protein electrophoresis technique, referred to as isozymes, was the first extensively used molecular marker technique, developed in 1957 by Hunter and Markert, provided a new source of heritable traits for scientists to study (Parker et al 1998). Although this technique has the advantage of being relatively inexpensive and having co-dominant markers, it has slowly fallen out of favor due to its limitation of the relatively small number of loci it is able to detect (De Vicente et al 1998). Random amplified polymorphic DNA (RAPD) markers have provided reliable and highly polymorphic information to discriminate pomegranate cultivars based on seed hardness phenotype: soft, semi-soft, semi-hard and hard seeded (Zamani 1990). Similarly morphological, cytological and DNA markers (RAPD, AFLP, SSR and ISSR) had been used to evaluate the genetic variability of Iranian pomegranates. These studies showed the occurrence of high genetic diversity among Iranian genotypes studied at both cytogenetic (Sheidai and Noormohammadi 2005). Sarkhosh et al (2006) also used RAPD markers to determine the diversity level among 24 Iranian pomegranate genotypes. AFLPs (Amplified Fragments Length Polymorphism) are another marker which had been used to evaluate genetic diversity within and among Chinese pomegranate populations which indicated that there was plentiful genetic diversity in pomegranate cultivars at the species level than that at the population level. The order of the genetic diversity was Henan population > Xinjiang population > Shaanxi population > Anhui population > Shandong population > Yunnan population represented Henan population significantly higher than the other populations, and it had wide application foreground in pomegranate breeding in China (Yuan et al., 2007). Up to now, more than 137 microsatellite loci in pomegranate genome showing different ranges of genetic polymorphism in the genotypes studied. A few studies based on molecular markers had been performed to investigate the population dynamics of this economically important species (Durgac et al 2008 and Zamani et al 2007). A large panel of PCR based methods, such as AFLP, RAPD, ISSR and SSR, had been developed, with wide range of complexity, to examine the genetic diversity between and within fruit species. Diversity in Punica granatum had been investigated by RAPD (Sheidai et al 2008) and AFLP (Jbir et al 2008), and recently 18S-28S rdna intergenic spacer- RFLP has been used for pomegranate cultivar identification (Melgarejo et al 2009). Inter Simple Sequence Repeats (ISSR) analysis is considered as another efficient molecular marker, showing genetic variation in the wild pomegranate populations studied in western Himalaya region (Narzary et al 2010). RAPD was largely used for fingerprinting accessions and to estimate genetic relatedness in germplasm collections 21

32 (Ebrahimi et al 2009), given its simplicity, efficiency and especially the non-requirement of DNA sequences. Hasnaoui and his co workers (2010) revealed molecular polymorphism in Tunisian pomegranate by using RAPD fingerprinting. Pirseyedi et al (2010) reported the isolation and characterization of 12 polymorphic microsatellite markers and used in assessing genetic diversity of 60 genotypes of Punica granatum. A taxonomic analysis of seed storage protein in eight Tunisian pomegranate (Punica granatum) ecotypes was carried out by Elfalleh et al (2008). Development of 11 microstallite markers (SSR) for Punica granatum used for evaluation of 27 pomegranate accessions in Tunisia (Hasnaoui etal 2010). A new set of pomegranate microsatellites was selected and characterized to assess the level of genetic diversity among cultivars and wild genotypes of pomegranate (Curroo et al 2010). Soraino et al (2011) reported that the development of 117 microsatellite number of simple sequence repeat (SSR or microsatellite) markers for Punica genus from a CT/AG-enriched pomegranate genomic library and checked their utility across eleven accessions with the polymorphism information content (PIC) value across all loci ranged between 0.09 and 0.71, with an average of Norouzi et al (2012) stated efficiency of universal chloroplast microsatellite loci on 52 Iranian pomegranate genotypes with informative loci of high PIC values used to assess the UPGMA clustering analysis which grouped the genotypes into six main groups mainly based on cultivation types where AMOVA results showed significant differences among groups of genotypes according to cultivation types and geographical regions. Alamuti et al (2012) revealed extensive genetic diversity in Iranian pomegranate cultivars using a set of twelve simple sequence repeat markers in which forty-three alleles were detected with a mean of 3.59 alleles per locus. The highest levels of polymorphism were found for the locus ABRII-MP26 and the mean values of expected heterozygosity and polymorphic information content were and 0.458, respectively ensured that genetic base of the Iranian National Pomegranate Collection is broad enough to ensure future progress in breeding programmes and the SSR markers were effective tools for conducting genetic diversity studies in pomegranate and developing strategies for germplasm management Diversity studies in different fruits Diversity analysis in some others fruit crops with application of molecular techniques revealed the efficiency of molecular markers in assessing genetic diversity over morphological markers. SSRs have been developed in apple and pear. They have proved highly useful in this type of application due to their reproducibility, co-dominance and high level of polymorphism (Powell et al 1996). A series of markers like RAPD (randomamplified polymorphic DNA), AFLP (amplified fragment length polymorphism), and SSR (simple sequence repeat or microsatellite) and ISSR (inter-simple sequence repeat) have been used for fingerprinting and assessing genetic variability in pear germplasm (Yamamoto et al 22

33 2001). Sixty Asian pear accessions from six Pyrus species were genetically identified by nine SSR markers with total of 133 alleles (Kimura et al 2002). Among them, 58 varieties could be differentiated except for two pairs of synonymous or clonal varieties. Development of molecular markers linked to several fruit traits such as skin colour, amount of grit cells, hardness, core size and weight in oriental pear were assessed and genetically analyzed (Hwang et al 2005). Korbin et al (2002) assessed the genetic distance and relatedness in genotypes of strawberry (Fragaria x ananassa), apple (Malus domestica) and Ribes species (R. nigrum, R. rubrum and R. glossularia) using molecular markers generated in RAPD and ISSR-PCR. Twenty primers for RAPD (among 60 tested) and seven for ISSR (among 10 tested) were chosen as creating polymorphic DNA bands differentiating the investigated genotypes. In many cases, both RAPD- and ISSR-based genetic similarity confirmed relatedness connected with biological origin and with the place where the cultivar was developed. Laurens et al (2004) used nine SSR markers for screening of 142 French local cultivars of apple and proved that seven pairs of cultivars genetically identical. 6 SSR (Simple Sequence Repeat) primerpairs were used for screening of 46 different commercial apple cultivars from the Research and Extension Centre for Fruit Growing (Galli et al 2006). Lima et al (2003) utilized molecular markers in characterization of peach cultivars Granada, Esmeralda, Jade, Eldorado, Riograndense, Capdeboscq, Aldrighi, Precocinho, Diamante, Turmalina, Maciel, BR-1, Pepita, Coral, Chinoca, Marfim, Chiripa, Della Nona, and Planalto, and nectarine cultivars Dulce and Anita. Fifty primers were tested and eleven were used to analyse RAPD markers in leaf extracts. Fifteen microsatellite primer pairs developed in sweet cherry and peach were used to explore genetic relationships among North American plums (Prunus section Prunocerasus). In all, 186 putative alleles were detected with a mean value of 12.4 per locus (Rohrer et al 2004). Bao et al (2007) assessed genetic diversity in Pyrus cultivars in East Asia. It was shown that Chinese sand pear consisted of four groups with Chinese white pear and Japanese pear, showing large diversity. Eighteen European pear and five Asian pear genotypes have also recently been characterized using apple, peach, Japanese pear microsatellites (Ghosh et al 2006). 2.6 Pollen viability, germination and pollen storage studies Crop quality and quantity rely on pollen storage and pollen viability so as to achieve breeding programmes and to solve the cultural constraints in production. Gozlekci and Kaynak (2000) said that the pollen viability, germination and pollen tube growth investigations are valuable tools used in identification of the effects of environmental factors and genotypic differences on pollen viability, germination and tube elongation. Engin and Hepaksoy (2003) mentioned a well known, pollen germination and pollen tube growth are necessary for fertilization, seed and fruit formation in particular for fruit species. Most plant 23

34 growers use in vitro pollen viability, germination and tube growth because of its fast, cheap and simplicity properties in growing programs for identifying favorable cultivars and genotypes which will be used as pollinizer in orchard establishment and breeding objectives (Stosser et al 1996). In most fruit species, pollen germination and pollen tube growth are robust under experimentally defined conditions, rendering in vitro based studies of relevance to the in vivo situation (Taylor 1997). Fernández (1995) observed a rapid loss in pollen viability with cultivars PTO2 and PTO7 stored at 5 C and 28 C, which lost their viability after 40 and 30 days, respectively. Pollen conservation is much greater at 5 C than at 28 C in cultivars ME5, ME16 and ME17 (Melgarejo et al 1997). Josan et al (1979) reported that pollen viability varied from per cent for the Afghanistan seedling cultivar, to per cent for the Bedana cultivar. Singh et al (1980) observed cultivar Kazkai had the largest pollen grains and the highest pollen fertility (88%). The maximum pollen germination (73.5%) was observed in 12.5 per cent sucrose solution. Derin and Eti (2001) carried out research under Adana ecological conditions in 1997 to determine the pollen quality (pollen viability and germination), quantity (pollen production) in Hicaz and 33 N 26 pomegranate cultivars and showed that the highest pollen viability and germination rate were obtained from male flowers of Hicaz (75.24% viability in TTC, 82.45% viability in FDA, 61.50% germination in 1% agar + 10 % sucrose medium in agar plate method). Cryogenic storage of tolerant pollen types is fairly easy (Towill et al 2004). The pollen viability was observed more than 82 per cent in different pomegranate cultivars (Nalavadi et al 1973 and Chitaley et al 1970). Gadze et al (2011) investigated in vitro pollen viability and germination in intact pollens and pollen tube growth in germinated pollens of five common pomegranate cultivars grown in Croatia and Bosnia and Herzegovina showed variation in pollen viability from 36.73% (cv. Konjski Zub) to 51.80% (cv. Barski) in fluorescent diacetat (FDA) test. The average pollen germination percentages were found as the lowest 6.83% in cv. Konjski Zub and the highest 42.51% in cv Glavas. Among the germination media in general 0.2 agar + 10% sucrose+5 ppm H 3 BO 3 gave better results to obtain higher pollen germination for all cultivars. Melgarejo (2000) tested test different culture media and environmental conditions in an attempt to improve the knowledge of the most suitable culture media for studying the germinative capacity of pomegranate pollen and observed that the incorporation of the nutrients Ca plus2 and B plus3 (0.2 ml per 100 ml) in the medium increased the germination percentage. It was also seen that 1 per cent agar gave better results than 1.5 per cent and concluded that the optimum saccharose concentration is between 10 and 20 per cent, with levels below 10 per cent producing low levels of pollen germination. 24

35 Wetzstein et al (2011) studied pollen from bisexual and male flowers of pomegranate were of similar size, 20 mm, and exhibited similar percent germination using in vitro germination assays. Pollen germination was strongly influenced by temperature while maximal germination (greater than 74%) was obtained at 25 and 35 0 C and pollen germination was significantly lower at 15 0 C (58%) and 5 0 C (10%). Babu et al (2011) reported pollen viability, as a vital phenomenon deciding the fruit set, with acetocarmine 1.0%, the viable pollen grains adhered to stains and got deeply stained whereas the non-viable pollen grains remain unstained. The pollen viability of pomegranate cultivar Ganesh was found to range from 84.0 to 95.0% with a mean of 93.2%. Randhawa and Negi (1965) described that pollen fertility varies at different phases of blooming, being relatively higher at mid bloom and lower at the end and beginning of flowering while pollen viability at room temperature remained for 10 day at -23±5 C and 0% R.H. for more than 14 months and at liquid nitrogen, C for 4 years. Acar and Kakani, (2010) observed comparisons of nine Pistacia species and cultivars over a range of temperatures from 4 to 40 0 C, the mean temperature optimum for pollen germination was 24 0 C but was severely reduced under both higher and lower temperatures; no pollen germination was observed for any of the genotypes at 40 0 C. Similarly in mango, optimum pollen germination occurred at 15 and 25 0 C, whereas a decrease in germination occurred at 30 0 C (Sukhvibul et al 2000). In peach, germination assays conducted at 10, 20, or 30 0 C affected primarily the rate of pollen germination with final germination only slightly affected (Hedhly et al 2005). Borghezan et al (2011) evaluated the in vitro viability and shelf life of pollen grains of the cultivars Matua and Tomurin in culture medium containing agar (1 %), sucrose (0, 5, 10, 20 and 40 %) and boric acid (0.0 and 50 mg L-1 H3BO3). Pollen grains were stored in a BOD incubator (25.0 C), refrigerator (4.0 C), freezer (-18.0 C) and in liquid N2 ( C), and evaluated after 0, 40, 120, 240 and 365 days. The culture medium enriched with 12 % sucrose and 50 mg L-1 H3BO3 was the most suitable. Pollen grains can be stored for a short period in the refrigerator or freezer and cryo-preserved for at least one year. 25

36 CHAPTER III MATERIALS AND METHODS Field work was conducted on 30 pomegranate genotypes which are being maintained in the New Orchard of Department of Fruit Science, Punjab Agricultural University, Ludhiana. Descriptor format developed by the IBPGR and National Bureau of Plant Genetic Resources (NBPGR-New Delhi), were used for morphological characterization. Molecular marker analysis was carried out in Molecular Biology Laboratory of School of Agricultural Biotechnology, Punjab Agricultural University, Ludhiana. The experimental material and methods used to complete the investigation are discussed below: 3.1 Experiment -I Experimental material -I Thirty genotypes of pomegranate were evaluated in Randomized Block Design with 3 replications. Observations were recorded (during year 2011and 2012) on non-juvenile trees/plants for morphological characters, where vegetative characters were recorded in and reproductive characters in February-June. The fruit characters and chemical characters were recorded in August-September. Genotypes : 30 Replications : 3 Total number of trees : 90 Observations recorded Vegetative characters Plant growth behaviour The growth behaviour of the trees was recorded on the basis of visual observation during two successive years (2011 and 2012). The accessions were divided into prominent growing behaviour types i.e. evergreen and deciduous Leaf size In order to record the data of leaf size (length and breadth), 30 leaves per replication were selected at random leaving terminal immature leaves. Then the length and breadth of leaf blade or lamina were measured with the scale. 26

37 Table 3.1: Pedigree of pomegranate germplasm S.No Genotypes Location (Geographicalcoordinates)/Source Type(introduction, selection, hybrid, strain etc) / Parentage 1 Ganesh India (Rahuri) Clonal selection (Alandi) 2 Mridula India (Rahuri) Hybridization (Ganesh x Gul-E- Shah Red 3 Jyoti Darward (Karnatka) Selection (Bassein seedless x Dholka) 4 Kandhari Afghanistan Introduction 5 Moga Local India Clonal selection 6 Assam Local India Clonal selection 7 Mallas Iran Introduction 8 Russian Seedling Russia Introduction 9 G-137 India (Rahuri) Clonal selection (Ganesh) 10 P-26 India Clonal selection 11 Khog India Clonal selection 12 Jhodpur White India Clonal selection 13 Co1 Coimbatore (TNAU) Clonal selection 14 Panipat Selection India Clonal selection 15 Shirin Anar India Clonal selection 16 Kali Shirin India Clonal selection 17 Anar Shirin India Clonal selection 18 PS 75 k 5 India Clonal selection 19 Kandhari Kabuli India Clonal selection 20 Anar Shrin Mohamad Ali India Clonal selection (unknown Iranian variety) 21 Chawla I India Clonal selection 22 Chawla-2 India Clonal selection 23 Botta-I India Clonal selection 24 Botta-II India Clonal selection 25 Botta-III India Clonal selection 26 Anardana Selection-I India Clonal selection 27 Anardana Selection-II India Clonal selection 28 Amalidana IIHR (Banglore) Hybridization (Ganesh xnana) 29 Kandhari Ganga Nagri India Clonal selection 30 Anar Mohereb Shirin India Clonal selection 27

38 Leaf shape Leaf shape of mature leaf was observed whether it is ovate-oblong, orbicular-ovate, elliptical, round or lanceolate round (Challice and Westwood 1973) Leaf apex Leaf apex of mature leaf was observed whether it is round, obtuse, acute and apiculate. (Challice and Westwood 1973) Leaf base Leaf base of mature leaf was observed whether it is attenuate or cunate. (Challice and Westwood 1973) Date of leaf bud break (dd/mm/yr) Date of start of leaf bud break was observed when about 5 to 10 per cent leaf buds had opened Reproductive characters Flowering behaviour (Pin head, Thrum, Hermaphrodite) The flowering behaviour of the trees was recorded on the basis of visual observation during two successive years (2011 and 2012). The accessions were divided into prominent flowering behaviour types i.e. male (pin, thrum) and hermaphrodite Start of flowering (dd/mm/yy) Date of start of flowering was recorded when about 5 to 10 per cent flower buds had opened End of flowering (dd/mm/yy) Date of end of flowering was recorded when about 5 to 10 per cent flowers were still open Number of hermaphrodite flower (per tree) Visual observation for number of hermaphrodite was recorded as average flowers/ plant Number of fruits per plant Total numbers of fruits on each tree of each genotype were counted at full maturity stage before harvest and the mean worked out Fruit yield (kg/plant) It was calculated from the average weight of fruits multiplied by number of fruits of each cultivar at full maturity and expressed in kg per tree Fruit characters Fruit length (cm) The average fruit length of 10 fruits was measured with the help of Veriner s Calliper s. 28

39 Fruit diameter (cm) The mean fruit diameter was measured with the help of Veriner s Calliper s and an average fruit diameter was calculated as fruit diameter equatorial (cm): D Fruit weight (g) Average weight of the fruit was calculated on the basis of a sample of ten fruits with the help of electronic balance and expressed in grams Fruit shape Fruit shape was determined as by visual observations Fruit colour Visual observation of fruit colour was recorded and genotypes were classified into following classes. 1 Greenish yellow with pink blush 2 Yellowish green with pink blush 3 Red green 4 Deep red 6 Rose blushed creamy Aril colour Visual observation of aril colour was recorded and genotypes were classified into following classes 1 Creamy white 2 Pink 3 Red 4 Light pink 5 Dark red Aril taste The fruits were rated by panel of three judges for development of taste. The scoring of fruit was done on the basis of taste. A panel of judges was used for evaluation which is given below. 1 = sweet 2 = sweet-sour 3 = sour Weight of 100 arils (g) A sample of 100 arils after separating the rind from fruit in each replication was taken and weighed on electronic balance and expressed in g Juice percentage Random fruits were taken and peel was removed and kept aside for weighing. The arils were taken out and squeezed to extract all the juice. The squeezing was done through as 29

40 possible in order to extract all juice. The extracted juice was then filtered through muslin cloth. Juice percentage was calculated by dividing juice weight with fruit weight and multiplied by 100 in each replication. Juice percentage = Peel weight (g) Total weight of juice (in g) Total weight of fruit (in g) x100 Peel of ten fruits were taken and weighed with the help of electronic balance, after separating the grains. Average weight of peel was taken in grams Biochemical characters Total soluble solids (TSS) Juice was extracted from fruits and TSS was measured with a hand refractometer in terms of degree Brix (%). The readings recorded were then corrected to 20ºC with the help of temperature correction chart (AOAC 1990) Titratable acidity (%) The juice acidity was determined by titrating 5 ml of juice against 0.1N NaOH solution, using phenolphthalein as an indicator. The end point was noted at the appearance of light pink colour and the results were expressed in terms of maleic acid. The per cent acidity was calculated by following formula: 0.1 N NaOH used Juice acidity (%) = x x 100 Juice taken (1 ml of 0.1N NaOH = g maleic acid) TSS/acid ratio The ratio was calculated by dividing the value of TSS with that of the corresponding titratable juice acidity Statistical analysis The data recorded for various parameters were subjected to analysis of variance to determine significant differences (P<0.05) among the genotypes mean in response to quantitative traits. The variability was analyzed with SAS version 9.3 (SAS Inst. Inc., Cary, N.C., U.S.A) compared with each other through Fishers LSD test. Analysis of variance Source Df SS MSS F ratio Replications (r) r-1 Sr Mr=Sr/(r-1) Mr/Me Genotypes (g) g-1 Sg Mg=Sg/(g-1) Mg/Me Error (e) (r-1)(g-1) Se Me=se/(r-1)(g-1) Total (rg-1) 30

41 Where, df=degree of freedom SS= sum of squares MSS=mean sum of squares Sr=Sum of squares due to replications Sg=Sum of squares due to genotypes Mg= mean sum of squares due to genotypes Mr= mean sum of squares due to replications Me= mean sum of squares due to error r= number of replications g= number of genotypes Analysis of variance (pooled) Source Df SS MSS F ratio Genotypes (g) g-1 Sg Mg=Sg/(g-1) Mg/Me Year (y) y-1 Sy My=Sy/(y-1) My/Me Replications (r) r-1 Sr Mr=Sr/(r-1) Mr/Me Genotype x year (g-1) (y-1) Si Mi=Si/(g-1)(y-1) Mi/Me Pooled error (e) (r-1)(g-1) Se Me=Se/(r-1)(gy-01) Where, df = degree of freedom Y= year R=replication Si= sum of squares due to interaction of genotypes and years All the characters showed significant differences among genotypes and were further subjected to the analysis for the following parameters. I. Variability (phenotypic) II. Correlation studies III. Genetic divergence Correlation coefficient The genotypic and phenotypic coefficients were calculated by implying the techniques of statistical analysis in variance-covariance matrix in which total variability had been split into replications, genotypes and errors. All the components of variance were estimated from analysis of variance table and those of covariance from the analysis of covariance table given below: 31

42 Analysis of variance and covariance Source of variation Replications Df Mean sum of squares Mean sum of products (r-1) Genotypes (g-1) Mgx Mgy Mg x y Error (r-1) (g-1) Mex Mey Me x y Genotypic estimates ( 2 g) = (Mg Me)/r Phenotypic estimates ( 2 p) = 2 g + Me The phenotypic and genotypic coefficients of correlation were computed by the method proposed by Al-Jibouri et al (1958). Phenotypic coefficients of correlation: rp = p x p p xy x y Where, 2 p xy = Phenotypic covariance between x and y 2 p x = Phenotypic covariance of x 2 p y = Phenotypic covariance of y Genotypic coefficients of correlation: rg = p x g g xy x y Where, 2 g xy = Genotypic covariance between x and y 2 g x = Genotypic covariance of x 2 g y = Phenotypic covariance of y The test of significance of calculated correlations coefficients (R) were compared with tabulated 'r' values, as given by Fisher and Yates (1938) at (n-2) degrees of freedom. If the calculated R-value was greater than tabulated value of 'r' then the correlation was considered to be significant Genetic diversity Two methods were used to estimate genetic diversity based on morphometric traits Mahalanobis D 2 statistics Mahalanobis D 2 statistics as detailed by Rao (1952), between two populations estimated on the basis of the 'p' characters is: Dp 2 = p 1 p 1 1 W ij (X i1 X i2 ) (X j1 X j2 ) 32

43 Where, W ij = Variance-covariance matrix W ij is the reciprocal of (W ij ), (i, j=1, 2...p) X i1 = Sample mean for i th characer for first sample X ij = Sample mean for i th character for sample. In the present study characters (P- 1-10) were used to perform the above analysis. For conducting the D 2 analysis, the computer programme, WINDOSTAT 8.0 cluster analysis was used Variability study The variability study of the different genotypes was done by Principal Component Analysis (PCA) using SAS 9.3 (SAS Inst. Inc., Cary, N.C., U. S.A) computer software. PCA is a method of data reduction that transforms the original variables into a limited number of uncorrelated new variables. The technique is thus a useful device for representing a set of variables by a much smaller set of composite variables that account for much of the variance among the set of original variables. It allows visualization of the differences among the individuals, identification of possible groups and relationships among individuals and variables (Martinez-Calvo et al, 2008). The numerical data were analyzed by PCA using the computer software SAS to get an overview of the similarity in the genotypes studied. This statistical procedure was applied to create a correlation matrix from which standardized principal component (PC) scores were extracted. Scatter plots of the first 2 PC scores were created. To determine which of the PC scores accounted for the greatest amount of variation for each trait, the Eigen values of the 4 PC scores were compared for each trait. 3.2 Experiment -II Experiment-II: To assess genetic variability and characterize pomegranate cultivars through DNA markers Collection of leaf material Young, fresh, disease and insect free leaves from different pomegranate genotypes were used for DNA extraction. Leaf samples were collected in butter papers and placed in ice containers while transferring from field to laboratory. These were stored in deep freezer at -80 C for DNA isolation and SSR marker studies Buffers and solutions The procedure of preparation of solutions and buffers used in the present investigation are detailed in Table 3.2. Protocols detailed in Molecular Cloning by Sambrook and Russel et al (2000) were followed. 33

44 Table 3.2: Composition of CTAB Extraction Buffer Components Final Concentration CTAB 1.5% Tris HCl (ph 8.0) ` 100 mm NaCl 1.4 M EDTA (ph 8.0) 20 mm β-mercaptoethanol 2% Polyvinylpyrolidone (PVP) 2% The other chemicals were chloroform:isoamylalcohol (24:1) v/v/v), iso-propanol, Tris saturated phenol, phenol: chloroform: isoamyl alcohol (25:24:1),Sodium acetate (3M) solution (ph 8.0),70% ethanol, RNase (10mg/ml of RNase in buffer, 10 mm Tris HCl, 15 mm NaCl ph 7.5) and TE buffer (Tris HCl, 10 Mm ph 8.0, 1mM EDTA ph 8.0) Genomic DNA isolation DNA extraction procedure as proposed by Saghai-Maroof et al (1984) with some minor modifications like treatment with sodium acetate and other modifications so as to remove the polypbenols thereby preventing their interaction with DNA and yielding high quality DNA. The different steps that were followed are as under: Step 1: Two gram of leaves was crushed using pre chilled mortar and pestle in the presence of liquid nitrogen. Thorough crushing of leaves was done before adding extraction buffer but not ground into a very fine powder as it results in shearing of DNA. 20 mg of PVP (Polyvinyl pyrollidene) was added to each sample during the grinding step. Step 2: The powder was transferred to a 50 ml polypropylene tube and 15 ml of pre warmed (65 C) CTAB buffer was added. The contents were mixed well by vigorous shaking and tubes were incubated at 65 C for one hour in a water bath. Occasional mixing was performed during this period. Step 3: 15m1 of chloroform: isoamyl alcohol (24:1) (v/v) was added and contents were mixed by inverting the tubes for 5 min. Alternatively mechanical shaking was performed for further mixing for a period of 30 minutes. Step 4: Samples were centrifuged for 15 minutes at 10,000 rpm at room temperature so as to separate the phases. Step 5: Supernatant (aqueous phase) was carefully pipette out without disturbing the interface to another fresh 50 ml Falcon tube. Step 6: 30 l of sodium acetate (3 M) was added and contents were mixed thoroughly and centrifuged at rpm for about 3 minutes. 34

45 Step 7: Chilled isopropanol (10 ml) was added to precipitate the DNA and kept in refrigerator for 15 minutes so as to precipitate the DNA. Step 8: DNA was spooled out with a glass hook (the supernatant was discarded) and transferred to an Eppendorf tube. Step 9: The Eppendorf tube containing DNA pellet was centrifuged at 10,000 rpm for 7 minutes at 4 C so as to precipitate the DNA at the bottom. Step 10: The pellet was washed twice with 70 % ethanol. Step 11: The DNA pellet was centrifuged again at 3000 rpm for 3 minutes and speed was increased to 5000 rpm for an additional three minutes at room temperature. This differential spinning step helped to keep DNA at the bottom of the centrifuge tube. Step 12: Supernatant was discarded and pellet was washed with cold (0 to 4 C) 70 % ethanol. The tubes were kept uncovered at 37 C for 20 to 30 minutes so as to completely remove ethanol and dry the DNA pellet. Step 13: The pellet was dissolved in 200 to 300 l of TE buffer (ph 8.0). Step 14: 5 l RNase (10mg/ml of RNase in buffer) was added to each tube and incubated at 37 C in water bath for 1 hour. Chloroform: isoamyl alcohol extraction and centrifugation step was repeated after RNase treatment, if required Purification of DNA The procedure followed was as under Step 1: DNA samples were thawed to room temperature and an equal volume of Trissaturated phenol: chloroform (1:1) was added. The mixture was then mixed thoroughly and centrifuged for about 5 minutes at rpm. Step 2: Aqueous phase was pippeted out in a fresh tube and two chloroform: isoamyl alcohol extractions were performed as before and centrifuged at 10,000 rpm for 10 minutes at 4 C, both the times. Step 3: Aqueous phase was again pippeted out and 0.1 volume of 3M sodium acetate (ph 4.8) double volume of chilled ethanol were added to precipitate the DNA. Step 4: The contents were mixed gently and the precipitated DNA was spooled out. The extra salts were removed by two washings with 70 per cent ethanol at 10,000 rpm for 5 minutes and the pellet was dried at room temperature. Step 5: Pellet was dissolved in appropriate ( l) volume of IX TE. The DNA samples were dissolved at room temperature and stored at -20 C until used. 35

46 3.2.5 DNA Quantification The concentration and purity of DNA was checked by Agarose gel electrophoresis. Different steps followed were as: Step l: 0.8 g of agarose was dissolved in 100 ml of 0.5X TBE electrophoresis buffer (Tris base - 45 mm, Boric acid- 45 mm and EDTA-1 mm). Step 2: The mixture was heated till the agarose dissolved completely i.e. when solution became transparent and clear. It was cooled down to 60 C with constant stirring. Ethidium bromide was added to a final concentration of 0.5 g/ ml of buffer. Step 3: Step 4: Step 5: Step 6: Step 7: Step 8 Agarose solution was then poured into an already prepared gel mould with combs and left for min for solidification. DNA samples for loading were prepared by adding 2 l loading dye (6X) (0.25 % w/v bromophenol blue, 50 per cent glycerol in sterile water) to 8 l DNA. Sterile water was added to make the volume 100 ml to the DNA such that the final concentration of loading dye was 1X. DNA samples were loaded into wells with the help of micropipette. Along with the DNA samples, marker of known concentration (uncut lamda DNA of 100 ng/ l, 200 ng/ l concentration) was also loaded in different series of concentration Gel was run for about 1-2 hours at voltage of 5 V/cm and visualized under UV transilluminator. DNA samples were photographed using photo gel documentation system. The intensity of fluorescence of each sample was compared with that of a standard marker and then DNA concentration of each sample was ascertained. Quality of DNA samples was judged based on whether DNA formed a single high molecular weight band (good quality) or a smear (degraded/ poor quality). The DNA was then diluted to a final concentration of 20ng/ l Selection of SSR primers A set of 47 SSR molecular markers ((Hasnaoui et al 2010 and Pirseyedi et al 2010) was used for PCR amplification (Table 3.5) PCR standardization A mixture 20 l of various PCR reagents, based on the stock and final concentration of different components (Table 3.3) was prepared as under: 36

47 Table 3.3: Stock and final concentration of different components used in PCR Component Stock Conc. Volume ( l) Final Conc. Water PCR buffer 10X* 2.0 1X MgCl 2 25mM mM dntps 1mM M Primer Forward 5 M M Primer Reverse 5 M M Taq Polymerase 5U/ l 0.2 1Unit DNA template 20ng/ l 2 40ng Total 20 *10X PCR buffer: 10mM Tris HCl, ph 8.3, 50mM KCl, 1.5mM MgCl 2, 0.01% Gelatin. The reagents were mixed thoroughly in a 500 l Eppendorf tube and vortexed for a few seconds. 18 l of the above mixture was distributed to each PCR reaction tube and then 2.0 l of DNA (concentration 20 ng/ l) was added to each tube. In vitro amplification using polymerase chain reaction (PCR) was performed in a 96 well microtiter plate in an M J Research PTC200 or Eppendorf Master Cycler. The polymerase chain reaction (PCR) programmed was as follows: pre-denaturation for 4 min at 94 C, then 35 cycles each consisting of a denaturation step for 1 min, an annealing step for 1 min at annealing temperature (Table 3.4), and an extension step for 7 min at 72 C. The details are given in Table 3.4 as under: Table 3.4: Temperature profile used in PCR Step Temperature Time (minutes) No. of cycles ( C) 1. Initial denaturation Denaturation Elongation (Extension) Final Extension Final Extension Hold Electrophoresis of amplified DNA To 20 l of the amplified product, 3.0 l of 6X loading dye was added so as to make the final concentration of the loading buffer in the reaction samples to 1X. The PCR products 37

48 were resolved on 2.5 per cent superfine resolution agarose (Amresco Solon Ind. PKWY, Solon, Ohio 44139) gel. The gel was prepared in 0.5X TBE buffer. Ethidium bromide was added at concentration of 0.5 g/ l. Ten l of sample was loaded onto each well and gel was run at 5V/ cm, visualized under UV light and photographed using UVP gel documentation system (Model GDS 7600). 100 Kb DNA ladder was used as a standard marker for ascertaining the size of amplified fragments Scoring of SSR allele profile The total number of alleles was recorded for each microsatellite marker in all the genotypes under study by giving the number to amplified alleles as 1, 2, 3 etc. Data matrices were prepared in which the presence of a band was coded as 1 (band present) and 0 (band absent) in a binary matrix. The lines that did not show any amplification were scored as null alleles since the amplification was repeated 2-3 times. If the band appeared in the negative control the whole PCR reaction experiment was repeated Statistical analysis Polymorphic information content (PIC) that provides an estimate of the discriminatory power of a locus or loci, by taking into account, not only the number of alleles that are expressed, but also relative frequencies of those alleles, was estimated using the following equation of Anderson et al (1993). PIC= 1 n 2 P ij i 1 Where P ij is the frequency 0fjt allele in i primer and summation extends over n patterns. Genetic diversity among the parental lines was assessed based on SSR markers using NTSYS-PC version 2.02e and DARwin 5 softwares Statistical analysis using NTSYS-PC version 2.02e Numerical Taxonomic and Multivariate Analysis System (NTSYS-pc) version 2.02e (Rohlf 1998) software programme was used to analyze molecular data. Data from 47 primers were used to estimate the similarity based on the number of shared amplified bands. Similarity was estimated using SIMQUAL function of NTSYS, which computes a variety of similarity coefficient for qualitative data (nominal data). Dendrogram was constructed using UPGMA (Unweighted Pair Group Method using Arithmetic Averages) by available in NTSYS Statistical analysis using DARwin 5 software package Dissimilarity coefficients were estimated for allelic data generated by 47 SSR primer pairs by using DARwin 5 software as follows: 38

49 1 D ij = 1 Where, d ij : dissimilarity between ur its i and j L: Number of loci : Polyploidy m 1 : number of matching alleles for locus 1 L m 1 L i 1 Tree was constructed using neighbour joining on the basis of UPGMA (Unweighted Pair Group Method using Arithmetic Averages). 3.3 Experiment -III Exper1ment-III: Pollen viability and Germination studies Pollen storage and viability studies Flowers from male parents were collected at popcorn or balloon stage and were allowed to shed the pollen in shade for 3-4 hours under 100 Watt lamp. The pollen were collected in vials and subjected to different storage conditions as follows 1. Room temperature (in anhydrous calcium chloride) 2. 4 C C 4. Cryogenic storage in liquid nitrogen (-196 C) Observations recorded Pollen colour It was visually observed, both at the time of pollen collection and after the storage period whether the pollen grains are yellow, light brown, brown or black Pollen viability Pollen viability was tested in 2 per cent acetocarmine solution, which was prepared by dissolving 2 grams of carmine powder in 45 ml of glacial acetic acid and final volume was made to 100 ml by adding distilled water. Solution was boiled for 5 minutes and filtered through Whatman No. 1 filter paper. The pollen grains were dusted on a glass slide and one to two drops of acetocarrnine were put on these grains. After placing a cover slip over the stain it was left for five minutes for proper staining of pollen grains. Slides were observed under microscope. Deeply stained and normal looking pollen grains were considered to be viable whereas, shriveled, slightly stained or colourless pollen grains were counted as non viable. Three microscopic fields were observed and numbers of viable and non viable pollen grains were counted in each field In vitro Pollen germination Pollen grains were germinated in 15 per cent sucrose solution at weekly intervals. For this 1-2 drops of sucrose solution were placed on a cavity slide and pollen grains were dusted 39

50 over it by camel brush. The slides were covered with cover slip and edges were smeared by molten wax and slide was inverted instantly so as to form a hanging drop on the cover slip. The cavity slides were then placed in petri-dishes containing moist filter paper to ensure uniform and high relative humidity. Pollen tube growth was assessed for each genotype under microscope after 48h of incubation at 22±2 C. The pollen grains having pollen tube at least two times longer than pollen diameter were considered to be germinated Statistical analysis: The data were analyzed statistically. 3.4 Experiment-IV Experiment-IV: Breeding for production of F1 hybrids Place of work: New Orchard, Department of Fruit Science, Punjab Agricultural University, Ludhiana Treatments: Crosses were made as follows S.No. Female parent Male parent 1 Ganesh x Mridula 2 Kandhari x Mridula 3 Jyoti x Mridula 4 Mridula x Ganesh 5 Mridula x Kandhari 6 Mridula x Jyoti Methodology Emasculation Branches were selected and all the opened flowers and undeveloped buds were removed. Unopened blossoms, nearly ready to open were emasculated by removing sepals, petals and stamens to prevent self-pollination. The emasculated flower clusters were covered with muslin cloth bags and properly tied and labelled Pollination Pollination of the emasculated buds was done on the flowering or next day either with fresh pollen (in case of cultivars were flowering period coincided) or with stored pollen ( in case of cultivars were flowering periods did not coincided). The pollen were applied to stigmas with camel hair brush and again bagged. Each twig was again labelled to avoid any contamination. The bags were removed after fruit setting was observed Observations recorded Per cent fruit set in pollinated flowers It was calculated as the ratio of number of buds which set into fruits to that of the pollinated buds and per cent fruit set was calculated as under Number of buds which set into fruit Fruit set per cent= 100 Number of buds pollinated 40

51 DNA fingerprinting of F1 seedlings The fruits were harvested after fruit setting at full mature stage from each six cross combinations. Seeds were taken out separately from each fruits. Collected seeds were stratified in moist, finely ground peat moss in polybags. Stratified seeds were planted in individual pots/ polybags to raise F 1 hybrids. Seeds were found germinated into seedlings of 3-4 cm after 20 days of sowings. Young and fresh leaves were collected from F 1 seedlings after one month of germination and were used for DNA extraction. Leaf samples were collected in butter papers and placed in ice containers while transferring from field to laboratory. These were stored in deep freezer at -80 C for DNA isolation. Polymorphic SSRs were used to confirm the hybrid nature of F1 seedlings. Five SSR primer pairs with genomic DNA from both parents and their respective hybrids were run on 3% agarose gel to observe the polymorphic alleles in F1 progenies to know their hybrid nature Statistical analysis: The data were analyzed statistically according to RBD design. 41

52 Table 3.5: The selected microsatellite markers of pomegranate S.No Primer Forward Reverse 1. Pom006 TACTAGGTGGAACCGAACTT CCTTGACAACCTCATCTCAT 2. Pom010 CCTCATTGCTGATGAATCTT ACTCGAGAAGCTCTGTGAAG 3. Pom021 GACTGGAAGAAGCAGAGACT GAAAAGGAAGTAGCAGAGCA 4. Pom024 GGAGATTTGAATTGGGAAGT GTGGACTAACTCAAGCAAGG 5. ABRII-MP04 CAGGTGATTGACTACTTGG CAGATCTACAATAACATCAC 6. ABRII-MP42 GAGCAGAGCAATTCAATCTC AACAATTTCCCATGTTTGAC 7. ABRII-MP46 AGTTGATCTGATGGACAAGG CAGTACGGTGCTCAATACAA 8. ABRII-MP07 GATTAACAGCAAAGCCTAGAGG AGTAGCTGCAACAAGATAAGG 9. ABRII-MP26 TTTCTCGAAGAATTGGGTAA CTGAGTAAGCTGAGGCTGAT 10. ABRII-MP28 ATCCTCTGTCTTTGTGTTCG TGAGTAATTCCGGTCAGAAG 11. ABRII-MP30 CCCAGTTTGTAGCAAGGTA AAGCTGACATTCTTTGAAGC 12. POM_AAC1 GGGTCTTCCTAATTCTCTGG TACAACTTCGGACTCACTTGC 13. POM_AAC14 CGAGAACCGTTAGTCATGC AGTGACGGCAGGACAAGAAC 14. POM_AGC5 TTCGATATTGTTTATTGTGTCG CAACGAACTAGACGACACAC 15. POM_AGC11 CGTCATCCCTTATGTTCTTC CTGGGGAAGTCGACGAAG 16. PGCT001 AGCTCCGATTGAGAGCAGAT TTGGAGCAATTGGAGAGAGA 17. PGCT005 TCCGTGTGTGAAGAAGACCA GGTTTGGATTTCTTGGGTTTT 18. PGCT015 GACGCCTTTAGTTTGCTCCA CTCGGGACAGGACTTGGAAT 19. PGCT016 ACATTCGCCATAGCTGTTTT GGAATCAGGAAGATCGAGTAGAGA 20. PGCT017 CCCCTAGTAAAGTCCCACCT AGAGGTATTCGCAGGTTTTG 21. PGCT021 GATGGCGAAGTGTGTCCTCT TTGGGACTGTGTTGACTGCT 22. PGCT022 GCGCGTTATTTCGATAATTC GGCTCGAACATCATTACATC 23. PGCT023 ATCTCTCATCTCTGCTTCCC GCACACTTTCCTCCCTATGT 24. PGCT025 AGTAGCCCGTTTAAGATGCT GCAGAGGAAAGAGAAAGAGG 25. PGCT028 AAAAGCTGGCACTCAAACTC GGCATTACTTCCAGGACAAC 26. PGCT030 CCTCATGTCAGATTGTTTGG GTTATGAGAGGGAGGCAGGA 27. PGCT031A AGTTTGATCGACTGAGGAATG CACTCGAGAAGCTCTGTGAA 28. PGCT032 TCTGAAGCCGATCTCGAAGT GTCAAGCCAAGCATTCACAG 29. PGCT046 ACATCCCTTCTCTCTCTTTC GCATTCCTCCTCGTCTTC 30. PGCT037A GTTTCGATTGGCCGCTTTA TGTCTTGCCTTCAAGCACCT 31. PGCT057 ACCCATAGTCTCACCCATTC GCGATCCCTAGAGAGAGAAA 32. PGCT059 ATACCTGCTCGCTAATCTGG GTGGACAAACAGAGGGAGAG 33. PGCT061 GAATAAGGCGTCCCTCTCTC CTCCTCCTCGTAATCCCAAC 34. PGCT062 CATTTTCTGTTACCCCTTGG TCTCGACATGCTTAGTCTCG 35. PGCT070 TAACAACCATGCCCCTTAAT CCAATTAAAACGCCTCATCT 36. PGCT080 TGAGTGGAAGGGAAATAGGA TCACCCTCTCCAAAATCAAA 37. PGCT083 TTCGGTTGCATTGATTTCCT AGCTCAGTGGAGAGGACTGG 38. PGCT087 TCTCTCTCTACCCCGACACC CCCTATCATCCTTCCCATTC 39. PGCT088 TCCTCCGACCCTTTCTTATC TAGCGTCAAGATTGTGAAAAGG 40. PGCT093B GCCTTTTCCTGCTTTCCTTT CATACAGCGGACCACAACAC 41. PGCT093 GTAGCCACTTTAGGGCGAGA CGTCTAAAAGCGACAGCAAG 42. PGCT097 TCCCATAAACATAGCAGGAA GGCATCTCAGGGGTAATAAA 43. PGCT104 CGCCCAAAACAGGAAATAGA GCTGGGATCTGGAAGAAATG 44. PGCT109 CCACTTCCCTCCTACCTTCC ACGTCTGCTTGCACCTCTTT 45. PGCT110 GAGCCATTGTAGAGACAAGA GACTGCTGACAACTTTCTTT 46. PGCT111 TATCTGTCGCAGGAAGGATG GAAGCCAATTCCTCAAAGATG 47. PGCT112 CAGCCAATTACGGCAACTAA GTCCCTCGCAAACACCTAAA 42

53 CHAPTER IV RESULTS AND DISCUSSION The present investigations entitled Assessment of genetic divergence and hybridization studies in pomegranate germplasm were carried out in four separate experiments during the year First experiment (Experiment I) comprised of evaluation of different pomegranate genotypes for assessment of genetic variability and multivariate analysis of the genotypes for selected growth and yield attributes. In the second experiment (Experiment II), molecular diversity was analyzed using SSR markers. Pollen storage and viability was studied in the third experiment (Experiment III) while breeding for production of F1 seedlings was studied in the fourth experiment (Experiment IV). The results of the above four experiments are presented in this chapter under various heads and sub heads. Variability studies based on morphological characters The variability studies in different pomegranate genotypes were conducted during at New Orchard of Punjab Agricultural University, Ludhiana. The observations on vegetative, flowering, fruit and biochemical characters were recorded and results are discussed in light of the work done by earlier researchers. 4.1 Vegetative characters a) Plant growth behaviour Plant growth behaviour of different genotypes is shown in Table 4.1. Variation in plant growth behaviour was seen among the genotypes with evergreen behaviour in Mridula, Jyoti, Moga Local, Mallas and Jhodpur White. However, the genotypes like Anar Shirin, Ps-75-K3, Kandhari-Ganga-Nagari, Anar-Shirin-Mohamad-Ali, Chawla- I, Anar-Mohereb-Shirin, Bhota-I, Bhota-II, Anardana-Selection-I, Anardana- Selection-II, Assam Local, Kandhari, G-137, Khog, Co-1, Russian Seedling, Panipat Selection, Shirin Anar, Achikdana, Chawla-II and Kali Shirin. This variability was ascribed to the differences in genetic make of different pomegranate genotypes. The results were in concord with the findings of Samadia and Pareek (2006). Singh et al (2011) reported Ganesh-I as evergreen pomegranate; whereas Kandhari deciduous in nature. b) Date of leaf bud break (dd/mm/yy) The data of different pomegranate genotypes related to initiation of leaf bud break showed significant variation for two years ( ). It is clear from the data given in Table 4.2 that during the year 2011 bud break commenced from 22 nd - 28 th Jan and continued till 5 th -10 th March. The earliest was seen in Jhodpur White (22 nd - 28 th Jan) followed by Kali Shirin (24 th - 26 th Jan), G-137 and P-26 (24 th - 28 th Jan) each and Kandhari (25 th - 30 th Jan) whereas bud break was recorded late in Anardana-Selection-I and Anardana-Selection- 43

54 Table 4.1: Vegetative characterization of pomegranate germplasm Genotypes Plant growth behaviour Leaf Shape Leaf Apex Leaf Base Anar Shirin Deciduous Lanceolate Apiculate Attenuate Ps-75-K3 Deciduous Round-shaped lanceolate Apiculate Cuneate Kandhari-Ganga-Nagari Deciduous Lanceolate Acute Attenuate Anar-Shirin-Mohamad-Ali Deciduous Lanceolate Acute Attenuate Chawla-I Deciduous Lanceolate Acute Attenuate Mridula Evergreen Lanceolate Acute Cuneate Jyoti Evergreen Lanceolate Acute Cuneate Anar-Mohereb-Shirin Deciduous Lanceolate Acute Attenuate Amlidana Evergreen Lanceolate Acute Cuneate Bhota-I Deciduous Lanceolate Apiculate Cuneate Bhota-II Deciduous Lanceolate Apiculate Cuneate Bhota-III Deciduous Lanceolate Apiculate Cuneate Anardana-Selection-I Deciduous Round-shaped lanceolate Apiculate Cuneate Anardana-Selection-II Deciduous Round-shaped lanceolate Apiculate Cuneate Assam Local Deciduous Lanceolate Acute Cuneate Ganesh Evergreen Lanceolate Acute Attenuate Kandhari Deciduous Round-shaped lanceolate Apiculate Attenuate Moga Local Evergreen Round-shaped lanceolate Apiculate Attenuate Mallas Evergreen Lanceolate Acute Attenuate G-137 Deciduous Lanceolate Acute Attenuate P-26 Evergreen Round-shaped lanceolate Apiculate Attenuate Khog Deciduous Lanceolate Acute Attenuate Jhodpur White Evergreen Lanceolate Apiculate Attenuate Co-1 Deciduous Round-shaped lanceolate Apiculate Cuneate Russian Seedling Deciduous Lanceolate Acute Attenuate Panipat Selection Deciduous Lanceolate Acute Attenuate Shirin Anar Deciduous Lanceolate Acute Attenuate Achikdana Deciduous Lanceolate Apiculate Cuneate Chawla-II Deciduous Round-shaped lanceolate Apiculate Attenuate Kali Shirin Deciduous Lanceolate Apiculate Attenuate 44

55 II (5 th -10 th March). On the other hand, leaf bud break occurred at the same time (24 th -29 th Feb) in Bhota-I, II and III lines. The results showed that the leaf bud burst in all the genotypes, in general had occurred during February and March. During 2012, bud break started earlier (1 st -5 th Feb) in G-137, P-26 and Jhodpur White followed by Kandhari Ganga Nagari (4 th - 10 th Feb), Ganesh (5 th -8 th Feb), Jyoti (5 th -14 th Feb) and Achikdana (7 th -23 rd Feb). The latter (18 th - 25 th March) emergence of bud was seen in Anar Shirin Mohamad Ali and Anar Moherab Shirin. Some of the genotypes were found to break leaf bud at the same time like Kali Shirin and Anar Shirin (10 th -13 th Feb), Ps-75-K3 and Panipat Selection (16 th -20 th Feb), Bhota-I, II and III (2 nd - 10 th March), Moga Local and Mallas (7 th -12 th March), Co-1 and Russian Seedling (3 rd -7 th March) and the rest of the genotypes showed uniquely different period for leaf bud break. In concordance with the present results, similar studies were done by Bist and Sharma (2005) which reported that leaf bud break occurred in all the pomegranate genotypes during February and March. Similar observation was recorded by Singh et al (1977). Josan et al (1979) observed 4th week of February as the earliest time of leaf bud break under Ludhiana conditions. Hence, the variability in leaf bud break in various genotypes under the present study may be attributed to the differences in prevailing favourable temperature and interaction of genotypes with environment during that period and also might be due to the difference in phenology and genetic makeup of different genotypes. c) Leaf shape Leaf shape of different genotypes is shown in Table 4.1. The data of leaf shape revealed that pomegranate genotypes varied between lanceolate to round shaped lanceolate types (Plate 1). Genotypes like Bhota-II, Anardana-Selection-I, Anardana-Selection-II, Kandhari, Moga Local, Co-1, Chawla-II and Chawla-II possessed round shaped lanceolate whereas Anar Shirin, Ps-75-K3, Kandhari-Ganga-Nagari Anar-Shirin-Mohamad-Ali, Mridula, Jyoti, Anar-Mohereb-Shirin, Amlidana, Assam Local, Ganesh, Mallas, G-137, P-26, Khog, Jhodpur White, Russian Seedling, Panipat Selection, Shirin Anar, Achikdana and Kali Shirin had lanceolate leaf shape. This difference may be attributed to inherent differences existed among different pomegranate genotypes. Levin (1999) described that leaves of pomegranate are elongated, elongated lance-shaped, or lance-shaped, or inversely egg-shaped, elongated inversely egg-shaped, or elliptic. The different leaf shape types were also discussed in some pomegranate genotypes by Butterfield (1963). d) Leaf apex Leaf apex was categorized as apiculate to acute in different genotypes shown in Table 4.1. Genotypes like Bhota-II, Anardana-Selection-I, Anardana-Selection-II, P-26, Jhodpur White, Co-1, Chawla-I, Chawla-II, Achikdana, Kali Shirin, Anar Shirin, Ps-75-K3, Kandhari and Moga Local had apiculate leaf apex (Plate 1). Likewise, acute leaf apex was seen in Kandhari-Ganga-Nagari, Anar-Shirin-Mohamad-Ali, Mridula, Jyoti, Anar-Mohereb-Shirin, 45

56 Table 4.2: Leaf bud break period of pomegranate germplasm Genotypes Leaf bud break Anar Shirin 4 th -11 th Feb 10 th -13 th Feb Ps-75-K3 6 th -10 th Feb 16 th -20 th Feb Kandhari-Ganga-Nagari 29 th Jan-7 th Feb 4 th -10 th Feb Anar-Shirin-Mohamad-Ali 3 rd -5 th March 18 th -25 th March Chawla-I 2 nd -7 th Feb 13 nd -17 th Feb Mridula 21 st -23 th Feb 28 th Feb-6 th March Jyoti 30 th Jan-5 th Feb 5 th -14 th Feb Anar-Mohereb-Shirin 3 rd -5 th March 18 th -25 th March Amlidana 3 rd -10 th March 13 rd -20 th March Bhota-I 24 th -29 th Feb 2 nd -10 th March Bhota-II 24 th -29 th Feb 2 nd -10 th March Bhota-III 24 th -29 th Feb 2 nd -10 th March Anardana-Selection-I 5 th -10 th March 15 th -22 th March Anardana-Selection-II 5 th -10 th March 17 th -26 th March Assam Local 13 rd -28 th Feb 13 rd -28 th Feb Ganesh 25 th -30 th Jan 5 th -8 th Feb Kandhari 29 th Jan-7 th Feb 4 th -10 th Feb Moga Local 28 th Feb -1 st March 7 th -12 th March Mallas 2 nd -10 th Feb 7 th -12 th March G th -30 th Jan 1 st -5 th Feb P th -30 th Jan 1 st -5 th Feb Khog 20 th - 25 th Feb 2 nd -14 th March Jhodpur White 22 nd - 28 th Jan 1 st -5 th Feb Co-1 15 th -27 th Feb 3 rd -7 th March Russian Seedling 16 th -23 rd Feb 3 rd -7 th March Panipat Selection 1 st -5 th Feb 16 th -20 th Feb Shirin Anar 17 th -21 th Feb 17 th -21 th Feb Achikdana 27 th 31 st Jan 7 th 23 rd Feb Chawla-II 12 th -15 th Feb 28 th Feb-6 th March Kali Shirin 24 th -26 th Jan 10 th -13 th Feb 46

57 (a) (b) (c) Plate 1: Variability in leaf shape (a), leaf apex (b) and leaf base (c) in pomegranate genotypes Plate 2: Variability in flowering types in pomegranate

58 Amlidhana, Assam Local, Ganesh, Mallas, G-137, Khog, Russian Seedling, Panipat Selection and Shirin Anar. This difference was attributed to inherent differences existed among different pomegranate genotypes. The different leaf shape types were also discussed in some pomegranate genotypes by Mortan (1987). e) Leaf base It is evident from Table 4.1 that genotypes like Anar Shirin, Kandhari-Ganga-Nagari, Anar-Shirin-Mohamad-Ali, Chawla-I, Chawlaa-II, Anar-Mohereb-Shirin, Ganesh, Kandhari, Moga Local, Mallas, G-137, P-26 Khog Jhodpur White, Russian Seedling, Panipat Selection, Chawla-II and Kali Shirin had attenuate leaf base whereas cunate was observed in Ps-75-K3, Mridula, Jyoti, Amlidhana, Bhota-I Bhota-II, Bhota-III, Anardana-Selection-I, Anardana- Selection-II, Assam Local, Co-1, Shirin Anar and Achikdana (Plate 1). Similarly, Popenoe (1974) described concave leaf base in some pomegranate genotypes. f) Leaf length A significant variation in leaf length was observed among different genotypes of pomegranate (Table 4.3). The data revealed that leaf length range from 5.54 cm to 8.82 cm for the year 2011 with maximum value in Moga Local (8.82 cm) which was statistically highly significant from other genotypes like Co-1 (8.63 cm), Bhota III (8.34 cm), Ps-75-K3 (8.17 cm) and Ganesh (8.07 cm). Minimum value of leaf length was observed in Russian Seedling (5.54 cm). During 2012, same trend was observed with an average value ranging from 5.54 cm to 8.82 cm in similar genotypes. The pooled data of both the years ( ) depicted Moga Local with higher leaf length and lower in Russian Seedling. In accordance with these results, Ashton (2006) also described pomegranate leaf length from inches. However, the variation in leaf length was significant within genotypes than the interactive years. The pomegranate genotypes showed great variability with respect to leaf length. The variation in leaf length might be attributed to genetic makeup of different genotypes of pomegranate and their interaction with the environment. g) Leaf breadth The data presented in Table 4.3 showed a significant variation in leaf breadth among different genotypes of pomegranate. In 2011, highest leaf breadth found in Bhota-III (2.65 cm) followed by Chawla-I (2.54 cm), Moga Local (2.51 cm) and Co-1 (2.45 cm), however, lowest values observed in Russian Seedling (1.38 cm). During 2012, maximum value of leaf breadth seen in Bhota-III (2.70 cm) followed by Amlidana (2.58 cm), Mallas (2.51cm) and Moga Local (2.49 cm) which were statistically significant from other genotypes. Russian Seedling was observed again with minimum mean value (1.39 cm) for leaf breadth in The collective data for the year 2011and 2012 showed the range of leaf breadth from 1.38 cm (Russian Seedling) to 2.68 cm (Bhota-III). The analytic pooled data represented greater difference among genotypes than LSD (0.05) value (0.07) which depicted a significant 47

59 Table 4.3: Leaf size (length and breadth) of pomegranate genotypes Genotypes Leaf length (cm) Leaf breadth (cm) Pooled Pooled Anar Shirin 8.68 b 8.69 b 8.68 b 2.43 cde 2.39 d 2.41 cd Ps-75-K d 8.19 d 8.18 e 2.02 jk 2.03 ij 2.03 j Kandhari-Ganga-Nagari 7.94 f 7.95 f 7.95 g 2.12 ij 2.12 fgh 2.12 L Anar-Shirin-Mohamad-Ali 7.14 L 7.08 k 7.11 m 1.72 mn 1.70 m 1.71 mn Chawla-I 7.56 h 7.57 g 7.57 i 2.12 ijk 2.08 ghi 2.10 gh Mridula 6.45 q 6.44 o 6.45 r 2.04 jk 2.06 hi 2.05 hij Jyoti 6.63 p 6.63 n 6.63 p 2.16 ghi 2.19 ef 2.18 ef Anar-Mohereb-Shirin 6.48 q 6.52 o 6.50 q 1.65 n 1.71 Lm 1.68 n Amlidana 7.57 gh 7.55 g 7.56i 2.39 de 2.58 b 2.49 b Bhota-I 6.66 p 6.7 mn 6.68 p 2.06 ijk 2.04 ij 2.05 hij Bhota-II 7.05 m 7.14 k 7.09 m 2.02 k 2.05 hi 2.03 ij Bhota-III 8.34 c 8.38 c 8.36 d 2.65 a 2.70 a 2.68 a Anardana-Selection-I 6.92 n 6.92 L 6.92 n 2.16 ghi 2.17 ef 2.17 f Anardana-Selection-II 6.48 q 6.47 o 6.48 qr 2.13 hij 2.06 hi 2.10 ghi Assam Local 5.84 r 5.85 p 5.85 s 1.54 o 1.57 n 1.56 o Ganesh 8.07 e 8.05 e 8.06 f 2.03 jk 1.96 j 2.00 j Kandhari 7.44 i 7.42 h 7.43 j 2.12 ijk 2.08 ghi 2.10 gh Moga Local 8.82 a 8.81 a 8.81 a 2.51 bc 2.49 c 2.50 b Mallas 7.23 k 7.37 hi 7.3 kl 2.42 cde 2.51 bc 2.47 bc G j 7.32 ij 7.34 k 2.24 fg 2.24 e 2.24 e P k 7.29 j 7.27 L 2.16 ghi 2.14 fg 2.15 fg Khog 7.62 g 7.61 g 7.62 h 2.33 ef 2.36 d 2.34 d Jhodpur White 6.75 o 6.72 m 6.74 o 1.77 Lm 1.78 kl 1.78 Lm Co b 8.62 b 8.63 c 2.45 bcd 2.55 bc 2.50 b Russian Seedling 5.54 t 5.54 r 5.54 u 1.38 p 1.39 p 1.38 q Panipat Selection 6.46 q 6.45 o 6.46 qr 1.82 Lm 1.78 kl 1.80 kl Shirin Anar 7.05 m 7.08 k 7.07 m 1.86 L 1.84 k 1.85 k Achikdana 8.05 e 8.08 e 8.07 f 2.23 fgh 2.23 e 2.23 e Chawla-II 7.26 k 7.25 j 7.25 L 2.54 b 2.52 bc 2.53 b Kali Shirin 5.64 s 5.63 q 5.63 t 1.49 o 1.48 o 1.49 p Mean Minimum Maximum CV SD LSD (0.05)

60 performance of one genotype over the other in aspect of leaf breadth. The variation in leaf breadth might be due to genetic makeup of different genotypes of pomegranate and their interaction with the environment. Similar results were also reported by Ashton (2006) in pomegranate varieties. 4.2 Flowering characters a) Start of flowering (dd/mm/yy) During 2011, time of start of flowering (Table 4.4) was observed earliest in genotype G-137(4 th -10 th Feb), followed by P-26 and Jyoti (7 th -15 th Feb.). The genotypes like Ganesh (10 th - 15 th Feb), Jhodpur White (19 th -22 nd Feb), Kali Shirin (20 th -24 th Feb), Kandhari Ganga Nagari (20 th -27 th Feb), and Ps-75-K3 (26 th -30 th Feb) were found mid to late in flowering during Feburary. The genotypes Mridula (1 st -10 th March), Russian Seedling (1 st -6 th March), Chawla-I and II (2 nd -10 th March), Moga Local (2 nd -15 th March), Anardana Selection I and II (2 nd -7 th April) and Anar Shirin Mohamad Ali (5 th -9 th April) flowered late during the present studies. In year 2012 flowering started from 2 nd -10 th March in G-137 and continued upto 24 th - 29 th April in Anar Mohereb Shirin, whereas the rest of genotypes followed the same pattern of flowering as in In present study, it was observed that flowering started early during year 2011 and late in 2012 and also significant difference among genotypes for flowering periods. Hence, the variability in flowering in various genotypes may be attributed to the differences in prevailing favourable temperature and interaction of genotypes with environment and also might be due to the difference in phenology and genetic makeup of different genotypes. This is in line with the earlier reports by Prasad and Bankar (2003) who observed three flowering seasons in pomegranate. Similar results were reported by Singh et al (2011) in Ganesh and Kandhari. In cultivar Bhagwa flowering starts in January-February (Babu et al 2011). b) End of flowering (dd/mm/yy) The data pertaining to end of flowering varies significantly among different pomegranate genotypes (Table 4.4). During 2011, end of flowering commenced early in genotype P-26 (10 th -13 th March), followed by Jyoti (10 th - 23 rd March) and Ganesh (12 th -20 th March). The genotypes G-137 (14 th -21 st March), Jhodpur White (17 th -25 th March), Kandhari Ganga Nagari (22 nd -25 th March) were found stop flowering from mid to late in March The genotypes Mridula (1 st -10 th March), Russian Seedling (1 st -6 th March), Chawla-I and II (2 nd - 10 th March), Moga Local (2 nd -15 th March), Anardana Selection I and II (2 nd -7 th April) and Anar Shirin Mohamad Ali (5 th -9 th April) flowered late during the present studies. In year 2012, end of flowering started from 20 th -23 th March in Jyoti followed Achikdana (13 th -19 th April), G-137 (14 th - 22 nd April) and Ganesh (15 th -20 th April) and end of flowering continued upto 24 th -29 th May in Anar Mohereb Shirin and Anar Shirin Mohamad Ali. Bhota-I, Bhota-II and Bhota-III showed same time in flower end (22nd- 27 th May). In present study, it was observed that end of flowering started early during year 2011 and late in 2012 and also significant difference among genotypes for flowering periods. Hence, the 49

61 Table 4.4: Flowering period of pomegranate genotypes Genotypes Start of flowering End of flowering Start of flowering End of flowering Anar Shirin 7 th -11 th March 24 th -29 th March 26 th -30 th March 24 th -29 th April Ps-75-K3 26 th 30 th Feb 27 th -31 st March 24 th -30 st March 25 th -29 st April Kandhari-Ganga-Nagari 20 th -27 th Feb 22 nd -25 th March 12 th -15 th March 17 th -25 th April Anar-Shirin-Mohamad-Ali 5 th -9 th April 24 th -29 th May 24 th -29 th April 24 th -29 th May Chawla-I 2 nd -10 th March 24 th -30 th April 14 th -20 th March 27 th -30 th April Mridula 1 st -10 th March 15 th -26 th April 15 th -26 th March 23 th -28 th April Jyoti 7 th -15 th Feb 10 th -23 rd March 15 th -23 rd Feb 20 th -23 rd March Anar-Mohereb-Shirin 5 th -9 th April 24 th -29 th May 24 th -29 th April 24 th -29 th May Amlidana 23 rd -30 th March 26 th -30 th April 29 th -30 th March 26 th April- 2 nd May Bhota-I 24 th -29 th March 22 nd -27 th April 27 th -30 th March 22 nd -27 th May Bhota-II 24 th -29 th March 22 nd -27 th April 12 nd -17 th April 22 nd -27 th May Bhota-III 24 th -29 th March 22 nd -27 th April 12 nd -17 th April 22 nd -27 th May Anardana-Selection-I 2 nd -7 th April 3 th -7 th May 13 th -17 th April 18 th -20 th May Anardana-Selection-II 2 nd -7 th April 3 th -7 th May 13 th -17 th April 18 th -20 th May Assam Local 23 rd -30 th March 26 th -30 th April 2 nd -13 th April 30 th April-15 th May Ganesh 10 th -15 th Feb 12 th -20 th March 2 nd -10 th March 15 th -20 th April Kandhari 20 th -27 th Feb 22 nd -25 th March 12 th -15 th March 17 th -25 th April Moga Local 2 nd -15 th March 15 th -26 th April 15 th -20 th March 24 th -26 th April Mallas 23 rd -30 th March 26 th -30 th April 26 th -30 th March 30 th April- 4 th May G th -10 th Feb 14 th -21 st March 24 th Feb-10 th March 14 th -22 st April P-26 7 th -15 th Feb 10 th -13 th March 1 st -10 th March 16 th -23 th April Khog 1 st -6 th March 27 th -30 th March 17 th -23 rd March 27 th -30 th April Jhodpur White 19 th -22 nd Feb 17 th -25 th March 7 th -12 th March 27 th -25 th April Co-1 12 th -17 th March 20 th -25 th April 22 th -25 th March 20 th -30 th April Russian Seedling 1 st -6 th March 27 th -30 th March 15 th -26 th March 23 th -28 th April Panipat Selection 15 th -21 st March 19 th -23 rd April 23 rd -31 st March 29 th April- 3 rd May Shirin Anar 7 th -11 th March 24 th -29 th March 26 th -30 th March 24 th -29 th April Achikdana 17 th 22 nd Feb 23 rd -27 th March 3 rd -7 th March 13 rd -19 th April Chawla-II 2 nd -10 th March 24 th -30 th April 14 th -20 th March 27 th -30 th April Kali Shirin 20 th -24 th Feb 22 nd -24 th March 2 nd -14 th March 21 st -24 th April 50

62 variability in flowering in various genotypes may be attributed to the differences in prevailing favourable temperature and interaction of genotypes with environment and also might be due to the difference in phenology and genetic makeup of different genotypes. Meena et al (2011) reported the completion of flowering between 8 March to 2 April in Jyoti and Speen Danedar, respectively. Josan et al. (1979) also showed variation of flowering duration in pomegranate genotypes. c) Number of hermophrodite flowers The number of hermophrodite flowers (per plant) showed variation among the different pomegranate genotype (Table 4.5). The mean hermophrodite flower number was recorded maximum (505.00) in genotype P-26 which was statistically at par with the genotypes Ps-75-K3 (489.67), Amlidana (486.67), Moga Local (476.67) and Anar Shirin (467.34) whereas mean flower number was recorded minimum ( numbers) in genotype Jhodpur White and it was lower than all the genotypes. In 2011, the flower number ranged from to 440 with highest number in P-26 and lowest in Jhodpur White. Similar trend was observed in year 2012 again with maximum flower in P-26 (570) and least in Jhodpur White (410). However, the mean value of both the years illustrated that flowering in 2012 (500.2 number) was significantly higher than the 2011(336.56) flowering for all genotypes. This difference might be due to the difference in availing temperature in both the years and the genetic makeup of each genotype and their interaction with environment. The critical analysis of overall data showed least difference among the genotypes in aspect of number of hermophrodite flowers but considerable difference was observed year wise. Similar studies were done on the percentage of hermophrodite flowers and bearing capacity by (Chaudhari and Desai 1993 and El Sese 1988). Morton (1987) also gave the description of hermophrodite flowers in pomegranate. The mean hermophrodite flower number of 114 was recorded in Ganesh (Babu et al 2011). d) Flowering behaviour The flowering behaviour in all genotypes of pomegranate was observed hermophrodite, pin and thrum (Plate 2). There was not significant difference found in flowering types of pomegranate germplasm. Similar study on flowering behaviour was done by El Sese (1988) and Aziz et al Fruit characters a) Number of fruits per plant The number of fruits per tree showed variation among the different pomegranate genotype (Table 4.6). The mean fruit number was recorded maximum (91.50) in genotype P- 26 which was statistically at par with the genotypes Ps-75-K3 (88.84), Amlidana (87.84), Moga Local (85.84) and Anar Shirin (84.17) whereas mean fruit number was recorded minimum (60.84) in genotype Jhodpur White and it was lower than all the genotypes. 51

63 Table 4.5: Number of hermophrodite flowers per plant of pomegranate germplasm Genotypes Number of hermophrodite flowers per plant Pooled Anar Shirin abcd ab abcd Ps-75-K ab abc ab Kandhari-Ganga-Nagari abcd abcd abcde Anar-Shirin-Mohamad-Ali cd abc abcde Chawla-I abcd abc abcde Mridula abcd abcdef abcde Jyoti abcd abcdef abcde Anar-Mohereb-Shirin abcd abcde abcde Amlidana abc a abc Bhota-I abcd bcdefg abcde Bhota-II bcd abcdef abcde Bhota-III cd efg de Anardana-Selection-I cd defg cde Anardana-Selection-II cd 496 abcdefg abcde Assam Local abcd abcdef abcde Ganesh abcd defg abcde Kandhari bcd fg bcde Moga Local abcd abcd Mallas abcd abcdefg abcde G abcd abc abcde P a a a Khog abcd cdefg abcde Jhodpur White d g e Co abcd abc abcde Russian Seedling cd abcdefg abcde Panipat Selection d bcdefg bcde Shirin Anar abcd abcdef abcde Achikdana abcd g bcde Chawla-II abcd abcdefg abcde Kali Shirin abcd 528 abcd abcde Mean Minimum Maximum CV SD LSD (0.05)

64 In 2011, the number of fruits per tree ranged from to with highest number in P-26 and lowest in Jhodpur white. Similar trend was observed in year 2012 again with maximum flower in P-26 (95) and least in Jhodpur White (68.34). However, the mean value of both the years illustrated that fruits per tree in year 2012 (83.37) was significantly higher than the year 2011 (67.32) fruiting for all genotypes. This difference might be due to the difference in prevailing cultural practices and favorable environmental conditions in both the years and also attributed to the genetic makeup of each genotype and their individual interaction with environment. The critical analysis of overall data showed least difference among the genotypes in aspect of number of fruit and but considerable difference in observations taken year wise. The highest fruits per tree were recorded maximum in Mridula (47.24) and lowest in Dholka (11.6) (Samadia and Pareek (2006). Total number of fruits per tree was reported highest (114.6) in Kandhari and Ganesh (46) by Singh et al (2011). Similar studies were done by Feng et al (2003) while evaluating 32 genotypes of pomegranate in China. b) Fruit yield per plant The fruit yield per tree showed significant variation among the different pomegranate genotype (Table 4.6). The mean yield was recorded maximum (21.16 kg/plant) in genotype Ganesh which was statistically at par with the genotypes Ps-75-K3 (21.04 kg), Mridula (17.51 kg) and Jyoti (16.80 kg) whereas mean yield was recorded minimum (8.27 kg/plant) in genotype Anardana Selection-I and it was lower than all the genotypes. In 2011, the yield per tree range from to 6.39 kg with highest number in Ganesh and lowest in Anar Shirin Mohamad Ali. However, in 2012 the yield varies from kg in Ps-75-K3 to 8.99 kg in Anardana Selection-II. The mean value of both the years illustrated that yield per tree in 2012 (14.39 kg) was significantly higher than in 2011(11.8 kg/plant). This difference might be due to the difference in prevailing cultural practices and favorable environmental conditions in both the years and also attributed to the genetic makeup of each genotype and their individual interaction with environment. The critical analysis of overall data showed least difference among the genotypes in aspect of yield and but considerable difference in observations taken year wise. c) Fruit shape The genotypes in the present study were observed to have either elongated oval or round fruit shape (Table 4.7 and Plate 3). The fruit shape of elongated oval had been observed in Anar Shirin, Ps-75-K3, Anar-Shirin-Mohamad-Ali, Chawla-I, Mridula, Jyoti, Anar- Mohereb-Shirin, Amlidhana, P-26, Khog Jhodpur White, Co-1, Russian Seedling, Panipat Selection and Shirin Anar whereas predominantly round shaped fruit was seen in Kandhari- Ganga-Nagari, Bhota-I Bhota-II, Bhota-III, Anardana-Selection-I, Anardana-Selection-II, Assam Local, Ganesh, Kandhari, Moga Local, Mallas, G-137, Achik dana, Chawla-II and 53

65 Kali Shirin. This difference in the fruit shape types among different genotypes were attributed to their inherit characters. Malhotra et al (1983) found that fruits of pomegranate were either round or oblate at the time of maturity. Elongated oval and round fruit shape were also reported in Kandhari, Ganesh and Nabha (Kumar 2000). d) Fruit colour The pomegranate genotypes in the present study were observed to have significant variation in fruit colour (Table 4.7 and Plate 3). Fruit colour was categorized as deep red, red green, green yellow with pink blush, yellow green with pinkish blush, green yellow and rose blused creamy. Anar Shirin, Chawla-I, Chawla-II, Mridula, Jyoti, Kandhari, Co-1and Russian seeding were observed with deep red colour fruit whereas red green fruits were seen in genotypes Ps-75-K3, Khog and Kali Shirin. Mallas and Achikdana were only genotypes found with rose blused creamy coloured fruits. Some genotypes like Kandhari-Ganga-Nagari, Anardana-Selection-I, Anardana-Selection-II, Assam Local, G-137, P-26, Jhodpur White, Bhota-I, Bhota-II, Bhota-III and Shirin Anar possessed green yellow with pink blush fruits. Yellow green with pinkish blush fruit colour was found in genotypes Anar-Shirin-Mohamad- Ali, Anar-Mohereb-Shirin, Amlidhana, Ganesh, Moga Local and Panipat Selection. Kumar (2000) also reported fruit colour variation in Kandhari and Ganesh. Fruit colour changed from light green to deep red in Kandhari and from light green to yellow green with light red tinge in Nabha and Ganesh at maturity (Dhillon & Kumar, 2004a). e) Fruit length A significant variation in fruit length was observed among different genotypes of pomegranate (Table 4.8). The data revealed that fruit length range from 5.24 cm to 6.60 cm for the year 2011 with maximum value in Mridula (6.60 cm) which was statistically at par with genotypes like Bhota III (6.37 cm), P-26 (6.24 cm) and Anar Shirin (6.27 cm). Minimum value was observed in Kandhari Ganga Nagari (5.24 cm). During 2012, an average value of fruit length ranged from 5.10 cm to 6.90 cm in Mridula and Kali Shirin, respectively. The pooled data of both the years ( ) depicted Mridula consistently with higher fruit length (6.75 cm) and lower values (5.2 cm) in Kali Shirin and Amlidana. However, the variation in fruit length was significant among genotypes than the interactive years. The pomegranate genotypes showed great variability with respect to fruit length and was attributed due to difference in genetic makeup of different genotypes of pomegranate and their interaction with the environment. These results are in line with those obtained by Kumar (2000) which described fruit length in Kandhari (6.76 cm), Ganesh (7.08 cm) and Nabha (7.19 cm). A range of fruit length was recorded from 4.8 to 9.8 cm in pomegranate genotypes under semi arid condtions of Rajasthan (Samadia and Pareek 2006). Prasanna (1986) also studied the variation on fruit size (fruit length and diameter) in various varieties of pomegranate. Fruit dimensions varied from 52.9 to mm for length in pomegranate cv. Eksinar (Celik and Erasl 2009). 54

66 Table 4.6: Number of fruits and yield of pomegranate genotypes Genotypes Number of fruits per tree Yield per tree (kg) Pooled Pooled Anar Shirin abcd ab abcde 8.54 fghi hijklm ijkl Ps-75-K ab abc ab ab a a Kandhari-Ganga-Nagari abcd abcd abcdefgh cdefghi jklmn fghijkl Anar-Shirin-Mohamad-Ali cd abc abcdefghi i Lmn kl Chawla-I abcd abc abcdefghi efghi ghijkl ghijkl Mridula abcd abcdef bcdefghi abcd ab b Jyoti abcd abcdef abcedf abc bcd bc Anar-Mohereb-Shirin abcd abcde abcdefghi bcde bcde bcd Amlidana abc a abc 7.76 ghi mn kl Bhota-I abcd bcdefg bcdefghi bcdef def bcdef Bhota-II bcd abcdef bcdefghi cdefgh defg bcdefg Bhota-III cd efg hi cdefghi efg defghi Anardana-Selection-I cd cdefg ghi cdefgh fghijk defghij Anardana-Selection-II cd abcdefg cdefghi 7.56 hi n L Assam Local abcd abcdef abcedfghi bcdef bcde bcd Ganesh abcd defg defghi a a a Kandhari bcd fg fghi cdeg efgh cdefgh Moga Local abcd a abcd cdefghi mn hijkl Mallas abcd abcdefg abcdefgh bcde fghi bcdefg G abcd abc abcdef cdefghi jklmn fghijkl P a a a 9.36 defghi jklmn ijkl Khog abcd cdefg bcdefghi 9.99 cdefghi ijklm ghijkl Jhodpur White d g i cdefgh klmn efghij Co abcd abc abcdefg cdef cdef bcde Russian Seedling cd abcdefg defghi cdefghi bc bcd Panipat Selection d bcdefg fghi 9.30 defghi fghij efghij Shirin Anar abcd abcdef abcdefghi cdefghi n jkl Achikdana abcd g efghi cdefghi Lmn hijkl Chawla-II abcd abcdefg abcdefghi 9.00 efghi Lmn jkl Kali Shirin abcd abcd abcdefg bcde fghij cdefgh Mean Minimum Maximum CV SD LSD (0.05)

67 f) Fruit diameter As detailed in Table 4.8 the data revealed that fruit diameter varied significantly among different pomegranate genotypes. The fruit diameter varied from 7.60 to 5.10 cm for the year 2011 with maximum value in Mridula (7.60 cm) which was significantly higher than Bhota-III (6.6 cm) followed by genotypes G-137 (6.47 cm), Anardana Selection-II (6.4 cm) and P-26 (6.4 cm). Minimum value was obtained in Assam Local (5.1 cm) and found significantly smaller in diameter than other genotypes. A set of observations taken for fruit diameter during 2012 depicted higher values of fruit diameter in Mridula (8.10 cm) and lower values in Assam Local (5.34 cm). The mean fruit diameter (6.45 cm) of 2 nd year i.e 2012 was significantly found higher than the first year 2011 mean fruit diameter (5.95 cm). Thus, overall analysis of both the years illustrated that Mridula (7.85 cm) had highest fruit diameter and lowest in Assam Local (5.22 cm). The results were in line with those obtained by Kumar (2000) which described fruit length in Kandhari (7.55 cm), Ganesh (7.68 cm) and Nabha (7.65 cm). Samadia and Pareek (2006) gave the range of fruit diameter ( cm) in pomegranate genotypes. Josan et al (1979b) reported that the cvs Kazkai, Shirin Anar and Achikdana had the largest fruits (6.5, 6.32 & 6.26 cm in diameter, respectively. Khodade et al (1990) and Pal and Selvaraj ( ) also studied the fruit size and development in various varieties of pomegranate. g) Fruit weight A significant variation in fruit weight was recorded among different pomegranate genotypes (Table 4.9). In 2011, genotype Ganesh (305.00g) had the maximum fruit weight and it was followed by Jhodpur white, Mridula, Jyoti and Assam Local which recorded , , and g, respectively, and lowest fruit weight (95.34g) was noticed in Amlidana. A similar result for fruit weight was observed in 2012 with minimum (101g) in Amlidana and maximum (313.67g) in Ganesh. The mean data of both the years significantly differentiated the genotype Ganesh ( g) with highest fruit weight and Amlidana with lowest (98.17 g) among the rest of the genotypes. However, that overall average of fruit weight was obtained higher (177.31g) in year 2011 than in 2012 ( g). Physiologically, increased fruit weight is attributed to an increase in cell size and accumulation of food substances in the intercellular spaces in fruit pulp (Bollard 1970). The variation might be due to difference in varied fruit size (length and breadth) and difference in crop load. The difference among the genotypes in aspect of fruit weight might be due to the genetic constitution of genotypes and their interaction with environment. Similar studies were done by Sharma and Dhillon (2002) where the maximum fruit weight of 450.0g was recorded in Ganesh followed by 400.0g in PS-77 and 330.5g in Bassein-Seedless and the minimum (200.0g) fruit weight was noted in Jodhpur White. Celik and Erasl (2009) studied physical characteristics of pomegranate cv. Eksinar and found that fruit weight between to g. 56

68 Table 4.7: Qualitative fruit and aril characters of pomegranate genotypes Genotypes Fruit Shape Fruit colour Aril taste Aril colour Anar Shirin Elongated oval Deep Red Sour Pink Ps-75-K3 Elongated oval Red Green Sour Red Kandhari-Ganga-Nagari Round Green Yellow with pinkish blush Sweet Light pink Anar-Shirin-Mohamad-Ali Elongated oval Yellow Green with pinkish blush Sour Creamy white Chawla-I Elongated oval Deep red Sweet Pink Mridula Elongated oval Deep red Sweet Dark red Jyoti Elongated oval Deep red Sweet Light pink Anar-Mohereb-Shirin Elongated oval Yellow Green with pinkish blush Sour Creamy white Amlidana Elongated oval Yellow Green with pinkish blush Sour Creamy white Bhota-I Round Greenish yellow with pinkish blush Sour Creamy white Bhota-II Round Greenish yellow with pinkish blush Sour Creamy white Bhota-III Round Greenish yellow with pinkish blush Sour Creamy white Anardana-Selection-I Round Green Yellow with pinkish blush Sweet Creamy white Anardana-Selection-II Round Green Yellow with pinkish blush Sweet Creamy white Assam Local Round Green Yellow with pinkish blush Sour Creamy white Ganesh Round Yellow Green with pinkish blush Sweet Light pink Kandhari Round Deep Red Sweet Creamy white Moga Local Round Yellow Green with pinkish blush Sour Light pink Mallas Round Rose blushed creamy Sour Light pink G-137 Round Green Yellow with pinkish blush Sweet Light pink P-26 Elongated oval Green Yellow with pinkish blush Sweet Light pink Khog Elongated oval Red Green Sour Pink Jhodpur White Elongated oval Green Yellow with pinkish blush Sweet Pink Co-1 Elongated oval Deep Red Sour Light pink Russian Seedling Elongated oval Deep Red Sour Creamy white Panipat Selection Elongated oval Yellow Green with pinkish blush Sour Creamy white Shirin Anar Elongated oval Green Yellow with pinkish blush Sour Red Achikdana Round Rose blushed creamy Sour Red Chawla-II Round Deep red Sweet Pink Kali Shirin Round Red Green Sour Creamy white 57

69 Plate 3: Variability in fruit shape, colour and sizes in pomegranate genotypes

70 g) Aril weight of 100 arils It is evident from the data that great variability occurs among the different pomegranate genotypes (Table 4.9). The range of aril weight of 100 arils mean varied from 9.55 g to g with highest aril weight of 100 arils in Ganesh (31.62 g) which was at par with P-26 (24.54 g), Mallas (22.86 g) and Co-1 (21.77 g) whereas genotype Shirin Anar had least value (9.55 g). In 2011, aril weight varied from g to 8.96 g with maximum in Ganesh (31.09 g) and minimum in Anar Moherab Shirin (8.96 g). In 2012 also, highest aril weight was observed in Ganesh (32.14 g) but lowest values for Shirin Anar (9.86 g). It was observed that overall average of aril weight of 100 arils was obtained higher (17.01 g) in year 2012 than in 2011 (16.25 g). The variation might be due to difference in varied fruit size (length and breadth), fruit weight and difference in crop load. The difference among the genotypes in aspect of aril weight might be due to the difference in genetic constitution of genotypes and their interaction with environment. Sharma and Dhillon (2002) reported the highest aril weight (120.0g) in Ganesh followed by 115.0g in Moga-Local and 112.5g in Panipat Selection and lowest (92.0g) in PS-77. i) Peel weight A significant variation in peel weight was recorded among different pomegranate genotypes (Table 4.10). The genotype Ganesh had the maximum peel weight (103.42g) and it was followed by Ps-75-K3, Mridula and Kandhari which recorded 79.31, and 76.94g, respectively. The lowest peel weight (32.91g) was noticed in Amlidana. The peel weight was observed minimum (33.87g) in Amlidana and maximum (105.16g) in Ganesh during A similar trend observed in 2011 where Ganesh was having highest peel weight (101.67g) and lowest in Amlidana (31.96 g). Thus critical analysis of data clearly illustrated that the genotypes Ganesh and Amlidana consistently had higher and lower peel weight, respectively, for both the years ( ) and significantly differentiated from the other genotypes. However, overall average of peel weight was obtained higher (59.89 g) in year 2011 than in 2012 (58.55 g). The variation might be due to difference in varied fruit size (length and breadth) and difference in crop load. The difference among the genotypes in aspect of fruit weight might be due to the genetic constitution of genotypes and their interaction with environment. Similar studies were reported where the maximum peel weight of 185.5g was observed in Panipat Selection and minimum 98.5g in P-16 (Sharma and Dhillon 2002). 58

71 Table 4.8: Fruit size (length and diameter) of pomegranate genotypes Genotypes Fruit Length(cm) Fruit diameter(cm) Pooled Pooled Anar Shirin 6.27 abc 6.07 bcdefg 6.17 bcde 5.87 defghi 6.40 defg 6.14 defgh Ps-75-K bcdefgh 5.7 efghij 5.79 fghij 6.20 bcde 6.24 fgh 6.22 defgh Kandhari-Ganga-Nagari 5.24 k 5.6 fghijk 5.42 klmn 5.64 efghij 6.40 defg 6.02 efghij Anar-Shirin-Mohamad-Ali 5.47 ijk 5.44 ijk 5.45 jklmn 5.64 efghij 5.84 ijk 5.74 hijk Chawla-I 5.50 hijk 5.6 fghijk 5.55 ijklmn 6.04 bcdef 6.40 defg 6.22 defgh Mridula 6.60 a 6.90 a 6.75 a 7.60 a 8.10 a 7.85 a Jyoti 6.00 bcefgh 5.90 cdefghi 5.95 cdefgh 6.17 bcde 6.00 hij 6.09 defgh Anar-Mohereb-Shirin 5.27 jk 5.47 hijk 5.37 lmn 5.40 hij 6.20 fgh 5.80 ghij Amlidana 5.27 jk 5.14 k 5.2 n 5.17 j 5.34 L 5.25 kl Bhota-I 6.17 abcde 6.17 bcde 6.17 bcde 5.50 fghij 6.17 ghi 5.84 fghij Bhota-II 5.70 defghijk 5.54 ghijk 5.62 hijklm 6.00 bcdefg 5.80 jk 5.90 fghij Bhota-III 6.10 abcdef 6.27 bcd 6.19 bcd 6.37 bcd 7.30 kl 6.84 bc Anardana-Selection-I 6.37 ab 6.30 bcd 6.34 b 6.60 b 6.54 cdef 6.57 bcd Anardana-Selection-II 6.00 bcdefgh 6.54 ab 6.27 bc 6.40 bcd 7.40 b 6.90 b Assam Local 5.44 ijk 5.24 jk 5.34 mn 5.10 j 5.34 L 5.22 L Ganesh 5.67 efghijk 6.04 bcdefg 5.85 defghi 6.50 bc 7.20 b 6.85 bc Kandhari 6.07 bcdefg 6.27 bcd 6.17 bcde 6.37 bcd 6.77 c 6.57 bcd Moga Local 5.57 ghijk 5.64 efghijk 5.6 hijklm 5.64 efghij 6.00 hij 5.82 fghij Mallas 6.14 abcdef 6.14 bcdef 6.14 bcdef 5.64 efghij 6.84 c 6.24 edfg G abcd 6.40 abc 6.3 bc 6.47 bc 7.40 b 6.94 b P abc 6.30 bcd 6.27 bc 6.40 bcd 7.20 b 6.80 bc Khog 6.00 bcdefgh 6.17 bcde 6.09 bcdefg 6.20 bcde 6.60 cde 6.40 cde Jhodpur White 5.37 ijk 5.54 ghijk 5.45 jklmn 5.77 efghi 6.37 defg 6.07 efghi Co efghijk 6.04 bcdefg 5.85 defghi 5.97 cdefgh 6.64 cd 6.30 def Russian Seedling 5.64 fghijk 6.00 bcdefgh 5.82 efghi 5.44 ghij 6.34 defgh 5.89 fghij Panipat Selection 5.67 efghijk 5.80 defghi 5.74 ghijk 5.64 efghij 6.27 efgh 5.95 efghij Shirin Anar 5.64 fghijk 5.77 defghij 5.7 hijkl 5.77 efghi 6.54 cdef 6.15 defgh Achikdana 5.67 efghijk 5.84 defghi 5.75 ghijk 5.84 defghi 6.37 defg 6.10 defgh Chawla-II 5.77 cdefghij 5.40 ijk 5.59 ijklm 5.57 fghij 5.60 kl 5.59 ijkl Kali Shirin 5.30 jk 5.10 k 5.2 n 5.34 ij 5.80 jk 5.57 jkl Mean Minimum Maximum SD CV LSD (0.05)

72 j) Aril taste Aril taste of different genotypes is shown in Table 4.7. The data revealed that aril taste of pomegranate genotypes varied between sweet to sour types. Genotypes like Kandhari- Ganga-Nagari, Mridula, Jyoti, Ganesh, Anardana-Selection-I, Anardana-Selection-II, Chawla- II, Chawla-I, Kandhari, G-137, P-26 and Jhodpur White had sweet arils whereas sour taste was observed in Bhota-II, Moga Local, Co-1, Anar Shirin, Ps-75-K3, Anar-Shirin-Mohamad- Ali, Anar-Mohereb-Shirin, Amlidana, Assam Local, Mallas, Khog, Russian Seedling, Panipat Selection, Shirin Anar, Achikdana and Kali Shirin. This difference was attributed to inherent differences existed among different pomegranate genotypes. The present findings also are in agreement with the observations noticed by Samadia and Pareek (2006). k) Aril colour The genotypes in the present study were observed to have significant variation in aril colour (Table 4.7 and Plate 3). Aril colour was categorized as pink, red, light pink, creamy white and dark red. Pink coloured arils were seen in Anar Shirin, Chawla-I, Chawla-II, Khog and Jhodpur White while red in Mridula. Genotypes like Anar-Shirin-Mohamad-Ali, Amlidhana Bhota-I Bhota-II Bhota-III, Anardana-Selection-I, Anardana-Selection-II, Assam Local, Kandhari, Russian Seedling and Panipat Selection were observed with creamy White coloured arils whereas light pink arils were seen in genotypes Kandhari-Ganga-Nagari, Jyoti, Ganesh, Moga Local, Mallas, G-137 and Co-1. Ps-75-K3, Kali Shirin and Achikdana were only genotypes found with red colour arils. Kumar (2000) also reported aril colour variation in Kandhari and Ganesh. Similarly, Malhotra et al (1983) and Khodade et al (1990) discussed varied aril colour in pomegranate genotypes. l) Juice per cent It is evident from the data that great variability in juice per cent occurs among the different pomegranate genotypes (Table 4.10). The mean range varied from to per cent with highest juice per cent in Anar Shirin ( 67.26%) which was at par with Chawla- II (67.03%), Anar Shirin Mohamad Ali (65.61%)and Anardana Selection-II (65.01%), whereas genotype Ganesh had least value (28.54%). In 2011, juice per cent range varied from 66.93% to % with maximum (66.93%) in Chawla-II and minimum (27.72 %) in Ganesh. In 2012 also, similar trend was observed with lowest values for Ganesh (29.36%) but higher for Anar Shirin (69.05 %). The overall average of juice per cent was obtained maximum (53.03 %) in year 2012 than in 2011 (49.02%). The variation in juice per cent among pomegranate genotypes might be due to different agro-ecological and nutritional factors prevailed during year ( ). Godara et al (1989) recorded highest juice percentage in cv. Russian Seedling (68.37), followed by Bedana Sedana, while maximum juice was obtained in cv. Surkh Anar and Kali Shirin. 60

73 Plate 4: Variability in aril colour in pomegranate genotypes

74 Table 4.9: Fruit weight and aril weight of pomegranate genotypes Genotypes Fruit weight (g) 100 Aril weight (g) Pooled Pooled Anar Shirin k j mno k klmn l Ps-75-K c b bc 15.5 h ghij hi Kandhari-Ganga-Nagari fg 134 j ijk ef cde ef Anar-Shirin-Mohamad-Ali kl kl op k klmno lm Chawla-I hi i jkl f def f Mridula b c b de bcd de Jyoti b d bcd e defg ef Anar-Mohereb-Shirin c de def 8.96 m no 9.55 n Amlidana l 101 m p k mno lm Bhota-I c e def f efgh fg Bhota-II c 193 f ef j jklm k Bhota-III 206 c d de hi ijk 15.1 ijk Anardana-Selection-I c fg ef ij ijkl jk Anardana-Selection-II ij klm mno gh ghij hi Assam Local c 212 de def 10.3 kl no mn Ganesh 305 a a a a a a Kandhari 213 c 216 de de gh fghij h Moga Local 146 gh lm lmn h ijkl ijk Mallas e fg h c bc c G gh j 140 jkl g efghi gh P k 119 k nop b b b Khog 150 fg h ij kl lmno lm Jhodpur White b h 196 fg 11.2 k mno lm Co e fg gh cd bcd cd Russian Seedling 205 c c cd gh ghij hi Panipat Selection e g h f efgh fg Shirin Anar fg lm klm 9.24 lm 9.86 o 9.55 n Achikdana f h 160 i h 16 hij hij Chawla-II j 130 j lmn ef cdef 19.7 f Kali Shirin 193 d 160 h h gh ghij hi Mean Minimum Maximum CV SD LSD (0.05)

75 Table 4.10: Peel weight and juice per cent of pomegranate genotypes Genotypes Peel weight (g) Juice% Pooled Pooled Anar Shirin m j jkl a a a Ps-75-K d b b hij hijk ijk Kandhari-Ganga-Nagari i j gh de abc cde Anar-Shirin-Mohamad-Ali m kl x a 66.4 ab ab Chawla-I jk i ghi b 63.0 bcde bcd Mridula bc c b j m l Jyoti c d bc ij klm kl Anar-Mohereb-Shirin de e cd gh ijk ijk Amlidana n m m cde ef e Bhota-I de e cd gh 44.3 ijk ijk Bhota-II def f d gh hij hij Bhota-III de d cd gh klm jkl Anardana-Selection-I ef fg d gh hi ghij Anardana-Selection-II kl lm kl a abcd ab Assam Local de de cd gh ijkl ijk Ganesh a a a k n m Kandhari b de b hi jklm jkl Moga Local j lm ijkl bc abc bcd Mallas h fg ef f gh fg G j j ghij c bcde cde P mn k lm a de abc Khog j h g cd ef de Jhodpur White bc h de j ef fghi Co hi fg f f gh fgh Russian Seedling def c bc gh lm jkl Panipat Selection i g f f gh f Shirin Anar hi lm hijk cde de de Achikdana g h f e cde e Chawla-II l j ijkl a ab a Kali Shirin fg h f 43.8 g fg fgh Mean Minimum Maximum CV SD LSD (0.05)

76 Prasad et al (1999) noted that juice percentage in Jalore Seedless pomegranate increased from to with the advancement of fruit maturity. Similarly, Viswanath et al (1999) found juice percentage between to in pomegranate. m) Total solid soluble contents (TSS) Data on total solid soluble contents showed significant variation among the pomegranate genotypes (Table 4.11). The mean data revealed that TSS were maximum (13.39 Brix) in genotype Ganesh and it was statistically at par with genotype Kandhari Ganga Nagari (13.10 Brix), Anar Shirin Mohamad Ali (13.04 Brix), Bhota-I (13.00 Brix) and Mallas (12.95 Brix) whereas minimum (11.00 Brix) was in genotype Anar Shirin. In 2011, TSS contents were maximum (13.14 Brix) in genotype Ganesh and minimum was recorded again in genotype Anar Shirin (10.84 Brix). In 2012, TSS was highest in (13.64 Brix) in genotype Ganesh and lowest (10.87 Brix) was recorded in Anardana Selection-I. In present study, a significant variation was observation among different genotypes as compared to their overall performance in each year ( ). This variation might be due to difference in interaction of genotypes with the varied soil and climatic conditions prevailed during 2011 and 2012 and also attributed to their genetic constitution. The total soluble solids content in different varieties varied between 12.0 to 14.0 per cent with highest (14.0%) in Moga-Local followed by 13.8 per cent in PS-77 and G-137 and 13.4 per cent in P-16 and the lowest (12.0%) in Panipat Selection and Co-1 (Sharma and Dhillon (2002). Similar results were obtained by Gozlekci and Kaynak (2000) in pomegranate. Prasad and Banker (2000) reported that the TSS in juice of different cultivars of pomegranate ranged from 16.2 Brix in Jodhpur Red to 18.8 Brix in Bassein Seedless. n) Juice acidity It is evident from the data that great variability occurs among the different pomegranate genotypes (Table 4.11). The mean range varied from 0.26 to 3.68 per cent with highest acid content in Anardana Selection-I (3.68%) which was at par with Amlidana (3.63%), Anar Mohereb Shirin (3.32%) and Anardana Selection-II (2.82%),whereas genotype Mridula had least value (0.26%). In 2011, acid content range varied from 3.83% to 0.24 % with maximum (3.83%) in Anardana Selection-I and minimum (0.24 %) in Mridula. In 2012 also, similar trend was observed with lowest values for Mridula (0.28%) and higher for Anardana Selection-I (3.52%). The overall average of acid content was obtained lower (1.26%) in year 2011 than in 2012 (1.37%). Sharma and Dhillon (2002) reported that acid content range from to per cent in different cultivars which being highest in Panipat Selection and lowest in G-137 and Bassein Seedless. Melgarejo et al (2000) found that citric acid was predominant in pomegranate juice with the range of to g. The variation in acid per cent among pomegranate genotypes might be due to different agro-ecological and nutritional factors prevailed during year ( ). 63

77 Table 4.11: Biochemical fruit characters of pomegranate genotypes Genotypes TSS (%) Acidity (%) TSS/Acid Pooled Pooled Pooled Anar Shirin l lm j 0.47 l 0.53 lmn 0.50 hi ef ij 22.2 fgh Ps-75-K abc bcdefgh abc 0.46 l 0.54 lm 0.50 hi cd efg de Kandhari-Ganga-Nagari abc ab ab 2.52 f 2.45 e 2.49 de 5.14 gh 5.43 lm 5.29 ijk Anar-Shirin-Mohamad-Ali ab abcdef ab 0.46 l 0.58 ijkl 0.52 hi cd fghi de Chawla-I abcde xabcdefg abc 0.55 k 0.56 jkl 0.56 hi ef efgh efg Mridula abcd abc ab 0.24 n 0.28 p 0.26 j a a a Jyoti defghijk fghijk efghi 0.45 l 0.37 o 0.41 ij cd b c Anar-Mohereb-Shirin hijk ghijk fghi 3.18 c 3.46 a 3.32 b 3.74 hij 3.53 n 3.64 k Amlidana hijk ijk fghi 3.72 b 3.53 a 3.63 a 3.18 ij 3.42 n 3.30 k Bhota-I abcd abcd ab 2.55 f 2.36 f 2.46 e 5.05 hij 5.58 lm 5.32 ijk Bhota-II defghijk efghijk efghi 2.27 g 2.75 d 2.51 de 5.32 ghij 4.47 mn 4.90 ijk Bhota-III hijk klm hi 1.86 i 1.76 g 1.81 f 6.39 gh 6.59 l 6.49 ij Anardana-Selection-I kl m j 3.83 a 3.52 a 3.68 a 2.95 j 3.09 n 3.02 k Anardana-Selection-II abcdef hijk cdef 2.76 d 2.88 c 2.82 c 4.62 hij 4.21 mn 4.41 jk Assam Local bcdefghij ijk efghi 0.44 l 0.56 jkl 0.50 hi cd i def Ganesh a a a 0.36 m 0.45 no 0.41 h b c b Kandhari defghij bcdefghij defg 0.47 l 0.55 l 0.51 hi de efghi 24.4 defg Moga Local fghijk efghij efghi 0.58 k 0.64 hij 0.61 h f k h Mallas abcdef abcd ab 2.11 h 3.16 b 2.64 d 6.06 ghi 4.19 mn 5.13 ijk G fghijk cdefghij efgh 0.35 m 0.46 mn 0.41 ij b d c P abcdefg abcde abcd 0.47 l 0.54 lm 0.51 hi cd e de Khog abcdefghi bcdefgh bcde 0.44 l 0.55 kl 0.50 hi cd efgh de Jhodpur White hijk fghijk fghi 0.55 k 0.56 jkl 0.56 hi f hi gh Co abcdefghij efghijk efg 0.45 l 0.55 kl 0.50 hi cd ghi def Russian Seedling abcdefgh bcdefghi bcde 0.44 l 0.53 lmn 0.49 hi c ef d Panipat Selection efghijk defghij efghi 0.58 k 0.63 hijk 0.61 h f jk h Shirin Anar ghijk jkl ghi 2.61 e 3.23 b 2.92 c 4.57 hij 3.65 n 4.11 jk Achikdana jkl jkl i 1.42 j 1.68 g 1.55 g 8.17 g 7.06 l 7.61 i Chawla-II fghijk jkl fghi 0.54 k 0.66 h 0.6 h f k h Kali Shirin ijk 12.24f ghijk fghi 0.57 k 0.65 hi 0.61 h f k h Mean Minimum Maximum CV SD LSD (0.05)

78 Thus critical analysis of data clearly illustrated that the genotypes Mridula and Anardana selction-i consistently had lower and higher acidic fruits, respectively, for both the years ( ) and significantly differentiated from the other genotypes. o) TSS/Acid ratio (TAR) Data on TAR showed significant variation among the pomegranate genotypes (Table 4.11). The mean data revealed that TAR was maximum (51.18) in genotype Mridula and it was statistically at par with genotype Ganesh (33.90), G-137 (30.80) and Co-1(26.57) whereas minimum (3.02) was in genotype Anardana Selection-I. In 2011, TAR was maximum (54.58) in genotype Mridula and minimum was recorded again in genotype Anardana Selection-I (2.95). A similar trend observed in 2012 with highest TAR (47.77) in genotype Mridula and lowest (3.09) was recorded in Anardana Selection-I. Thus critical analysis of data clearly illustrated that the genotypes Mridula and Anardana Selection-I consistently had higher and lower TAR, respectively, for both the years ( ) and significantly differentiated from the other genotypes. The overall average of TAR was obtained lower (17.29) in year 2012 than in 2011 (19.51). This variation might be due to difference in interaction of genotypes with the varied soil and climatic conditions prevailed during 2011 and 2012 and also attributed to their genetic constitution. Viswanath et al (1999) observed that TSS: acid ratio in pomegranate range from to Genetic variability studies Diversity analysis of the genotypes based on the set of quantitative traits The data on 14 quantitative traits subjected to analysis of genotypic and phenotypic coefficient variation, heritability, genetic advance and clustering using D 2 statistics is presented under following heads: Cluster analysis based on D2 analysis and distribution of genotypes to different clusters On the basis of D 2 values, 30 genotypes were classified into eight clusters (Table 4.12). Cluster I was the largest with ten genotypes followed by cluster II (5 genotypes) and cluster III (5 genotypes). Cluster IV, V and VI included 4, 2 and 2 genotypes respectively, whereas, cluster VII and VIII were having one genotype each. Cluster I contained genotypes Anar-Shirin-Mohamad-Ali, Chawla-I, Mridula, G-137, P-26, Khog, Jhodpur White, Co-1, Russian Seedling and Panipat Selection whereas cluster II grouped Ps-75-K3, Shirin Anar, Moga Local and Kandhari-Ganga Nagari, Achikdana together. Anar-Mohereb-Shirin, Amlidana, Bhota-I, Bhota-II and Mallas found in cluster III; likewise cluster IV contained Jyoti, Assam Local, Chawla-II and Kali Shirin. Ganesh and Kandhari, Bhota-II and Anardana Selection-I fall in cluster V and VI respectively. Cluster VII and VIII contained Anardana Selection-II and Anar Shirin, respectively. Thus formation of cluster with different genotypes indicates diversity among genotypes. The grouping of genotypes into different constellations 65

79 Table 4.12: Clustering pattern obtained by Mahalanobis D 2 analysis S.No Cluster number Number of genotypes Genotypes 1. I 10 Anar-Shirin-Mohamad-Ali,Chawla-I, Mridula,G-137, P-26, Khog, Jhodpur white, Co-1,Russian Seedling and Panipat Selection 2. II 5 Ps-75-K3,Shirin Anar, Moga Local and Kandhari- Ganga-Nagari, Achakdana 3. III 5 Anar-Mohereb-Shirin, Amlidana, Bhota-I, Bhota-II and Mallas 4. IV 4 Jyoti, Assam Local, Chawla-II and Kali Shirin 5. V 2 Ganesh and Kandhari 6. VI 2 Bhota-III and Anardana Selection-I 7. VII 1 Anardana Selection-II 8. VIII 1 Anar Shirin Table 4.13: Mahalanobis D 2 cluster distance matrix Cluster I II III IV V VI VII VIII I II III IV V VI VII VIII

80 did not follow any specific pattern was found independent of their geographic region. There was no correlation between geographical diversity and genetic diversity. The diverse grouping of genotypes in same cluster with different origins might be due to unidirectional selection pressure practiced by the breeders in couture the promising genotypes. As far, such kinds of results were reported by Rahman and Munsur (2009) in lime and Manchekar et al (2011) in Alphonso mango. The range of intra-cluster distance was from minimum of 0.00 in seventh and eighth cluster to maximum of in the fifth cluster (Table 4.13). This apparently indicates that cluster V have genotypes that are relatively distant from each other than the other clusters which have lower D 2 distances except cluster VI and VII which had only one genotype. The maximum inter-cluster distance of was observed among the fifth and seventh cluster indicating large genetic differences among genotypes of these two clusters. Minimum intercluster distance of was observed between the fourth and third cluster, cluster II and VIII indicating significantly lesser genetic differences among the genotypes of these four clusters. The inter cluster distances were larger than the intra cluster distances indicating a wider genetic diversity between genotypes of cluster with respect to trait considered. Maximum inter cluster distance is indicative that genotypes falling in these clusters had wide diversity and can be used for hybridization programme to get better recombinants in the segregating generations. Low level of intra cluster distances was indicative of narrow genetic variation within the cluster. Genotypes of same cluster would not yield desirable recombinants. Different intra- and inter-cluster distances were recorded previously for various fruit crops like walnut, almond, and pecan cultivars (Sharma and Sharma 2001 and Pandey and Tripathi 2007) and various genotypes were suggested for hybridization. The character means were also worked out for the genotypes falling in these eight clusters (Table 4.14). Cluster VIII was found to be the cluster consisting of genotypes of high leaf length (8.68cm), number of hermaphrodite flowers (467.34), number of fruits per tree (84.17), juice per cent (67.26%) and low acidity (0.5%). Similarly, cluster V with the highest yielding (17.63 kg/tree) genotypes with fruit weight (261.92g), aril weight (24.17 g) and TSS (12.86 %). Cluster VII was characterised with maximum fruit length (6.27 cm), fruit breadth (6.9 cm) and minimum peel weight (39.96 g). Maximum leaf breadth (2.42 cm), acidity (2.91%) and TSS/Acid ratio (27.62) were found in clusters VI, III and I, respectively. The least mean value for aril weight (12.22 g) and TSS (11%) was represented in cluster VIII whereas cluster IV was found to be the cluster consisting of genotypes of minimum leaf length (6.34 cm), leaf breadth (1.94 cm), fruit length (5.52 cm) and fruit breadth (5.62 cm). Minimum mean number of hermaphrodite flowers (371) and juice per cent (34.84) was observed in cluster V. Similarly, cluster VI with the genotypes of lower mean values for number of fruits per tree (63.75). The analytic observations concluded that cluster V appeared to be the most promising cluster to get 67

81 Table 4.14: Mean performance of different clusters S. No Characters Clusters I II III IV V VI VII VIII 1 Leaf length Leaf breadth Number of hermophrodite flowers Number of fruits per tree Yield Fruit length Fruit breadth Fruit weight Aril weight Peel weight Juice% TSS Acidity TAR the high yielding genotypes with maximum quality traits (aril weight and TSS). Also, the genotypes of cluster VIII were considered for better performance in quantitative (number of hermaphrodite flowers and number of fruits per tree) and quality traits (juice per cent and low acidity). Such character mean based clustering have been reported by Sharma et al (2010) in Persian walnut. Cluster based mean estimations are very useful in targeting the genotypes for breeding programme, as they prevent the tedious efforts of screening the inferior germplasm lines. So, genotypes from desirable clusters could be directly used for final field evaluation in advanced breeding experiments. 4.5 Variability analysis Variability analysis among the different pomegranate genotypes was worked out by Principal Component Analysis mentioned in material and methods (PCA) using JMP 9 software (SAS Institute, Inc). Principal components analysis (PCA) is a way of Principal Components Analysis is a method that reduces data dimensionality by performing a covariance analysis between factors. As such, it is suitable for data sets in multiple dimensions identifying the patterns in the data and expressing the data in such a way so as to highlight their similarities and differences (Winterova et al 2008). It has been used to establish the relationships among genotypes, (cultivars) and to study the correlations between morphological, fruit physical and chemical traits within sets of genotypes (Badenes et al 1998, Gurrieri et al 2001, Azodanlou et al 2003, Ruiz and Egea 2008). 68

82 4.5.1 Variability in pomegranate genotypes based on morphological characters The result pertaining to variability studies based on the leaf and flower characters are presented in Tables 4.15 and The principal component analysis showed that more than 82% of the variability observed for quantitative characters in different pomegranate genotypes was explained by the first four components i.e. PC1, PC2, PC3 and PC4 (Table 4.15) which accounted for 33.27%, 20.45%, 16.92% and 11.75% of the total variability, respectively. The first six PCs explained more than 90% of the variability (Table 4.15) but due to the high percentage of the total variance explained by the first four PCs (82%), the results and discussion would concentrate on them. The first component PC1 correspond to the genotypes with high yield, fruit weight and peel weight (Fig.4.1), includes the genotypes; Ganesh, Ps-75-K3 and Mridula with maximum values for these characters. Likewise PC2 values were also characterised by higher number of fruits per tree, number of hermophrodite flowers, aril weight, TSS and TSS acid ratio and genotypes corresponding to three characters with higher values were found in genotypes such as Mridula, P-26, Ps-75- K3 and Mallas (Table 4.16 and Fig.4.1). The component PC3 showed characters with higher values were leaf length, fruit length and fruit breadth and grouped the genotypes like Bhota-III, Amlidana, Anardana Selection-I and II corresponding to these characters. The characters leaf length and breadth with maximum values found in PC4 and genotypes characterised within this group were Moga Local, Assam Local and Anar Shirin.The highest negative values for PC1 indicate the genotypes with minimum juice per cent, lower number of fruits per tree and number of hermophrodite flowers and the genotypes included were Mridula, Ganesh, Jhodpur white, Anardana Selection-I, Anardana Selection-II, Bhota-I and II. The genotypes Mridula, Ganesh and Ps-75-k3 which had the lowest PC2 value stands out especially due to the low values for acidity (Figure 1). The highest negative value of PC3 was obtained for character yield and the genotypes clubbed with the least value for yield were Shirin Anar, Amlidana and Anardana Selection-II. Likewise, TSS was found to have maximum negative value for component PC4 with the genotypes Amalidana, Anardana Selection-II and I. Thus, PCA analysis found to reduce the data of 14 qualitative characters in four most significant variables or components which showed maximum and stable variability among all other characters under the study. The four most significant variables observed were yield, TSS acid ratio, fruit length and leaf length. The genotypes corresponding to these variables with maximum values would be taken into consideration for selection of diverse genotypes for future breeding programmes and also it is sufficient to take one or more genotypes from each these groups for used in future breeding programmes. The most promising among them are Ganesh, Mridula, Amlidana, P-26 and that were characterized by maximum yield, fruit length, leaf length and TSS acid ratio. 69

83 Table.4.15 Eigen values and proportion of total variability for quantitative characters of pomegranate genotypes as explained by principle components. PC Eigen values Per cent variability Cumulative variability Table.4.16 Component loading for leaf and fruit physical characters of pomegranate germplasm Characters PC1 (33.27%) PC2 (20.45%) PC3 (16.92%) PC4 (11.75%) Leaf length Leaf breadth Number of Hermophrodite flowers per tree Number of fruits per tree Yield Fruit length Fruit breadth Fruit weight Aril weight Peel weight Juice% TSS Acidity% TAR

84 Figure. a. Quantitative characters variability in pomegranate germplasm. LL: Leaf Length, LB: Length Breadth, NHF: Number of hermophrodite flowers per tree, NFN: Number of fruits per tree, Yd: Yield, FL: Fruit Length, FB: Fruit Breadth, FW: Fruit Weight, AW: Aril Weight, PW:Peel Weight and TAR: total souble solids and acid ratio. 1 Anar Shirin 2 Ps-75-K3 3 Kandhari-Ganga- Nagari 4 Anar-Shirin- Mohamad-Ali 5 Chawla-I 6 Mridula 7 Jyoti 8 Anar-Mohereb- Shirin 9 Amlidana 10 Bhota-I 11 Bhota-II 12 Bhota-III 13 Anardana- Selection-I 14 Anardana- Selection-II 15 Assam Local 16 Ganesh 17 Kandhari 18 Moga Local 19 Mallas 20 G P Khog 23 Jhodpur White 24 Co1 25 Russian seedling 26 Panipat Selection 27 Shirin Anar 28 Achikdana 29 Chawla-II 30 Kali Shirin Principal Components Analysis is a covariance analysis between different factors where as covariance is always measured between two factors. PCA is a method of data reduction that transforms the original variables into a limited number of uncorrelated new variables. PCA will find Eigenvectors and eigenvalues relevant to the data using a covariance matrix. The technique is a useful device for representing a set of variables by a much smaller set of composite variables that account for much of the variance among the set of original variables. It allows visualization of the differences among the individuals, identification of possible groups and relationships among individuals and variables. PCA had been used to evaluate germplasm of different species viz; olive (Cantini et al 1999), pomegranate (Mars and Marrakchi 1999), and loquat (Badenes et al 2000, Martı nez-calvo et al 2008). The results obtained in the present studies are in accordance to those of Noormohammadi et al (2012) who revealed that PCA ordination based on two first components (factors) confirmed cluster analysis using combined data when eigen value for first and second components were 20.88% and 9.45% respectively in Iranian pomegranate 71

85 germplasm. Yilmaz et al (2012) revealed that eigenvalues of the first 3 components were able to represent per cent of total variance in PCA and further, eigenvalue of pomological PCA analysis was able to represent 73 per cent of total variance. Rakonjac et al (2010) while working on morphological characterization of sour cherry reported that genotypes with high PC1 scores could be good genitors for large fruit size and yield potential. On the other hand, if genotypes with higher PC2 scores are used as genitors, a later flowering time could be achieved. PC analysis helped to select a set of genotypes with better fruit quality performances (Mratinic et al 2011). 4.6 Genetic diversity analysis using SSR markers In the present study, a set of 47 SSR primer pairs were employed to assess the genetic diversity among the 30 genotypes. Punica granatum accessions selected from the total plant material were representing all the 8 clusters obtained by Mahalanobis s D 2 analysis. The selection of such a small but diverse subset of evaluated germplasm for SSR diversity analysis ensured the informative allelic data. The markers were selected from ( and the published literature. Table 4.17 depicts summarized data of 47 SSR markers used for identification and evaluation of genetic diversity in 30 genotypes in pomegranate germplasm. PCR amplification results by some selected primers are presented in Plate 5. A total of 101 alleles were detected by 47 primers in the 30 genotypes with an average of 2.15 alleles per primer. However, Jian (2011) detected 18 markers resulted in amplification in 42 pomegranate accessions, with an average of 2 5 alleles (mean = 2.80) per locus. The 9 SSR loci provided 22 alleles, with the allele numbers per locus ranging from 1 to 5 among 34 accessions of Punica granatum (Curroo et al 2010). 47 SSR primers revealed clear and consistent amplification profile. Among these 47 markers, 41 SSR markers amplified 101 alleles across the 30 genotypes. Only 6 markers (Pom010, ABRII-MP28, PGCT046, PGCT088, PGCT112 and PGCT037) showed monomorphic pattern on agarose gel revealing single alleles across all the 30 genotypes. Out of 41 polymorphic SSR loci, 24 (Pom02, Pom024, ABRII-MP04, ABRII-MP46, ABRII-MP07, ABRII-MP30, POM_AAC14, POM_AAC1, POM_AGC5, POM_AGC11, PGCT001, PGCT005, PGCT017, PGCT021, PGCT023, PGCT025, PGCT030, PGCT031A, PGCT062, PGCT070, PGCT080,PGCT083,PGCT109,PGCT110) showed two alleles each, primers (Pom006,ABRII-MP42,ABRII-MP46, PPGCT015, PGCT016, PGCT022, PGCT028, PGCT032, PGCT057, PGCT061, PGCT087, PGCT093B, PGCT093 and PGCT111) amplified three alleles each and for remaining three markers amplified four alleles for pomegranate genotypes (Table 4.17). The variation in the number of alleles produced by SSR markers demonstrates heterozygosity in different alleles at a given locus in which the heterozygosity could reflect greatly the state of genetic variability (Elfalleh et al 2008). 72

86 4.6.1 Polymorphic Information Content (PIC) values Summarized data for the polymorphic information content (PIC) values and the number of alleles detected for each of the 47 SSR markers are presented in Table The PIC values provide an estimate of the discriminating power of a marker by taking into account not only the number of alleles at a locus but also relative frequencies of those alleles in the genotypes. The PIC values ranges from 0 (momomorphic) to 1 (highly discriminative with many alleles in equal frequencies). In present study PIC value range from 0 (monomorphic) to 0.66 with an average value of 0.43 across 30 pomegranate genotypes. Six out of 47 SSR markers (Pom010, ABRII-MP28, PGCT046, PGCT088, PGCT112 and PGCT037) revealed PIC value of 0 and PGCT093 had highest 0.66 PIC value among 41 polymorphic primers. The primers Pom02, Pom024, ABRII- MP04, ABRII-MP46, ABRII-MP07, ABRII-MP30, POM_AAC1, POM_AAC14, POM_AGC5, POM_AGC11, PGCT001, PGCT005, PGCT017, PGCT021, PGCT023, PGCT025, PGCT030, PGCT031A, PGCT062, PGCT070, PGCT080, PGCT083, PGCT109, PGCT110 had PIC values of 0.5, 0.48, 0.4, 0.47, 0.49, 0.47, 0.31, 0.23, 0.38, 0.49, 0.4, 0.43, 0.5, 0.47, 0.41, 0.46, 0.5, 0.44, 0.49, 0.48, 0.5, 0.47, 0.49 and 0.57 respectively. Thus, these primers amplified two alleles and had a PIC value range from 0.23 to 0.57 whereas primer Pom006, ABRII-MP42, ABRII-MP46, PPGCT015, PGCT016, PGCT022, PGCT028, PGCT032, PGCT057, PGCT061, PGCT087, PGCT093B, PGCT093, and PGCT111 amplified three alleles and had PIC values range from 0.38 to However four alleles were amplified with PIC value the primers PGCT059 (0.5), PGCT097 (0.51) and PGCT104 (0.65). Hence, the data depicted that the highest PIC value was shown by primer which amplified three alleles as compared to those which amplified four alleles. Soriano et al (2011) reported the polymorphism information content (PIC) value across all loci range between 0.09 and 0.71, with an average of Thus, the higher number of alleles amplified cannot be considered for higher PIC values (Zamani et al 2007).The PIC values of a primer vary with the crop and the set of the genotypes used. Lower PIC value may be the result of closely related genotypes and higher PIC values may be the result of diverse genotypes. Marker loci with an average number of alleles running at equal frequencies will have the highest PIC values (Senior et al 1998). Smith et al (1997) had found that the slightly higher average PIC value (0.62) probably resulted from their use of acrylamide gels for allele detection. Hence the other reason could be due to differences in medium for resolving the amplified products i.e. agarose gels vs. polyacrylamide gels. In the present study, the probable reason for lower PIC value may be the closely related genotypes. 73

87 4.6.2 Similarity coefficient Similarity coefficient based on DNA amplification using SSR primer was estimated using Nei and Lei (1979) coefficient of similarity. The similarity coefficient of 47 genotypes is depicted from dendrogram. Genetic similarity values between genotypes ranged from 0.78 to Using SSR markers Jian et al (2012) reported similarity coefficient values ranged from to with a mean of Similarly, Durgac et al (2008) described genetic similarity ranged from 0.83 to 1.0 among six pomegranate cultivar Cluster analysis based on molecular data Cluster analysis was used to group the clones and to construct a dendogram using NTSYS version 2.1 software (Rohlf 2000). The similarity coefficient based on DNA amplification of 30 pomegranate genotypes using SSR primers was estimated by dice similarity coefficient. A cluster plot of the 30 genotypes of pomegranate genotypes was constructed using SAHN and Tree Plot procedures of the NTSYS version 2.1software. The dendrogram generated based on Unweighted Pair Group Method with Arithmetic Average (UPGMA) is depicted in Figure 4.2. The UPGMA clustering algorithm grouped the pomegranate genotypes into three main clusters I, II, and III as shown in Figure b. The cluster III was further subdivided into IIIA, IIIB and IIIC. The cluster I comprised of one genotypes of pomegranate. The cluster II contained eight genotypes. The subcluster IIIA contained 12 genotypes, five and four in subcluster IIIB and IIIC, respectively. Cluster I consisted of Russian Seedling genotype which stands alone and far from the other genotypes. Second cluster II contained genotypes predominantly from Punjab (India) which are selections except two introductions from Afghanistan (Kandhari and Kabul Kandhari). Moga Local (ML) found with highest similarity coefficient (0.939) sharing with P-26 and both shared 0.89 and 0.87 percent similarity coefficient with Khog and Ps-75-K3 in the same sub group. The second highest (0.934) similarity coefficient was seen with Kabul Kandhari and Kandhari Ganga Nagari whereas both shared 90 % with Kandhari in Cluster II. Twenty one genotypes clubbed in cluster III found to be subdivided into three different sub-clusters IIIA, IIIB and IIIC. Sub-cluster IIIA contained mostly selections except two introductions Mallas from Iran and Achikdana from Turkmenistan. Among selections genotype Chawla-I and Chawla-II showed maximum similarity (0.95) followed by Kali Shirin and Anar Shirin (0.948) and Shirin Anar and Anar Shirin Mohamad Ali (0.943). Anar Moherab Shirin was seen sharing similarity of 94 % with Kali Shirin and Anar Shirin and Mallas with Shirin Anar and Anar Shirin Mohamad Ali at 0.92 similarity coefficient. 74

88 Table 4.17: Polymorphic Information Content (PIC) value and number of alleles amplified by SSR markers S.No. Primers Number of alleles PIC values amplified (NOA) 1 Pom Pom Pom Pom ABRII-MP ABRII-MP ABRII-MP ABRII-MP ABRII-MP ABRII-MP ABRII-MP POM_AAC POM_AAC POM_AGC POM_AGC PGCT PGCT PGCT PGCT PGCT PGCT PGCT PGCT PGCT PGCT PGCT PGCT031A PGCT PGCT PGCT037A PGCT PGCT PGCT PGCT PGCT PGCT PGCT PGCT PGCT PGCT093B PGCT PGCT PGCT PGCT PGCT PGCT PGCT

89 In cluster IIIA, Jhodpur White (JhW) clustered with Panipat Selection collected from two different provinces i.e Rajasthan and Panipat, respectively and sharing (0.92) similarity coefficient whereas Achik dana found farthest from all other genotypes in Cluster IIIA, followed by Jyoti and Mallas. Such distant affinity of these genotypes with other genotypes of pomegranate indicates that they might be independent clones or may be due to the differences in their pedigree and environmental influences. Predominantly, five genotypes grouped in cluster IIIB were collected from same province Hamirdpur (H.P, India) among which Bhota-I and II found clubbed together at proximity of 92 % similarity and 0.90 similarity coefficient shared by Anardana Selection I and II. The sub cluster IIIC comprised of four genotypes among which Ganesh and G-137 were closely related with 91% similarity and both sharing proximity with Mridula and Amlidana at 0.89 and 0.88 coefficient. Thus the UPGMA dendrogram generated showed that some genotypes from same province clustered in one group like in cluster IIIA genotypes (Kali Shirin, Anar Shirin, Shirin Anar, Anar Shirin Mohamad Ali Anar Moherab Shirin and Panipat Selection) collected from Hissar (India). Similarly, Moga Local, P-26, Khog, Ps-75-K3 and Kandhari Ganga Nagari grouped in Cluster II were collected from Punjab (India). Thus the grouping of genotypes in different clusters showed considerable variation in pomegranate germplasm and proved that SSR markers as an excellent genetic marker system for pedigree analysis. The grouping seen in cluster IIIC contained genotypes clubbed together on the basis of parentage and pedigree i.e having Ganesh as one parent in common in their origin. G-137 is true clone of Ganesh related at maximum proximity whereas Mridula is hybrid of Ganesh and Gul-E- Shah-Rose confirmed its closeness with Ganesh and same reason for grouping of Amilidana in subcluster IIIC where male parent is Nana and female parent is Ganesh. Hence, SSR markers provide accurate genetic information for allelic profile of genotypes in pomegranate germplasm. Diverse genotypes placed in clusters irrespective of their origin with others genotypes showed that geographical diversity of the genotypes are not corroborating with the genetic diversity and pomegranate plants are independent of their geographical affiliations. The lack of correlation or correspondence between geographical origin of the genotypes and their genetic characters seems to be a feature for some genotypes in pomegranate germplasms Narzary et al (2009). A significant present result showed that the different pomegranates genotypes collected do not show high similarities amongst provinces, because these may not be related to each other by descent. Within species genetic exchange rather than past relationships has been emphasized as the determinant of genetic diversity or genetic structure. The present study found in concord with Mars and Marrakchi (1999) revealed that the geographical origin of the cultivars did not determine their clustering on the basis of morphological characters. Similarly, in the observations in Tunisian genotypes based on AFLP profiles (Jbir et al 2008) reported the clustering of the genotypes independent of their 76

90 Plate 5: DNA amplification profile of pomegranate genotypes with different SSR primers

91 Coefficient Dice Coefficient Figure: b. Dendrogram showing similarity coefficient of 30 genotypes. RussianS KK KGN K ML P-26 Khog PS-75-k3 AL Chawla-II Chawla-I Achikdana JhW PS SA ASMA Mallas AMS KS AS Jyoti Bh-III Bh-I Bh-II ADS-I ADS-II G G-137 Mridula Amalidana I II III A III B III C III AS Anar Shirin Ps-75-K3 Ps-75-K3 KGN Kandhari- Ganga-Nagari ASMA Anar-Shirin- Mohamad-Ali Chawla-I Chawla-I Mridula Mridula Jyoti Jyoti AMS Anar-Mohereb- Shirin Amlidana Amlidana Bh-I Bhota-I Bh-II Bhota-II Bh-III Bhota-III ADS-I Anardana- Selection-I ADS-II Anardana- Selection-II AL Assam Local G Ganesh K Kandhari ML Moga Local Mallas Mallas G-137 G-137 P-26 P-26 Khog Khog JhW Jhodpur White KK Kandhari kabuli RussianS Russian Seedling PS Panipat Selection SA Shirin Anar Achikdana Achikdana Chawla-II Chawla-II KS Kali Shirin 77

92 geographical origins and had further assumed a continuous distribution of diversity in the region. Moslemi et al also did not found significant differences between Iranian pomegranate genotypes from Markazi, Yazd and Kerman provinces by using AFLP markers. Similar results were reported by Yuan et al (2007) using SSR markers on Chinese pomegranate cultivars. The high level of genetic diversity within groups (populations) and low level of that among them may be explained by the clone propagation of pomegranate and the extensive gene flow between different Localities in Iran due to material exchanges. 4.7 Pollen viability and germination studies Pollen colour Pollen colour was observed yellow in all genotypes of pomegranate before storage and no significant colour change was found during the in vitro storage of pollen grains of pomegranate genotypes at different storage temperatures (room temperature, C, 4 0 C and C) for about 9 weeks storage period Pollen viability study in four genotypes of pomegranate In vitro pollen viability rates in Punica granatum is given in the Table Pollen viability as tested by acetocarmine showed the viable pollen grains stained red colour where as non-viable pollen grains remained colourless. Pollen viability was observed maximum in Ganesh (95%), Mridula (94.7%), Jyoti (92.7 %) and Kandhari (92.0%). The data recorded on pollen viability at different storage conditions (room temperature, C, 4 0 C and C) for about 9 weeks storage period. Ganesh: The C was observed effective storage condition for pollen storage in Ganesh. Maximum pollen viability was observed at C (82.0%) followed by C (69.5), 4 0 C (56.1%) and minimum at room temperature (22.8%). Maximum decease of pollens was observed at room temperature after 6 weeks. The gradual decrease of pollen viability was recorded from 95% to 44.6% during the 9 weeks of storage. Mridula: The data showed highest viability at C (80.6%) followed by C (68.8%), 4 0 C (54.4%) and lowest at room temperature (21.8%). During 9 weeks of storage, maximum loss of viability was observed at room temperature (94.8% to 0.0%) and minimum was at C (94.5% to 70.8%) where as at 4 0 C viability percentage ranges from (84.2% to 40.0%) and 73.7% to 68.8% at C. The mean loss of pollen viability ranged from 94.8% to 43.4%. Jyoti: Among different storage conditions viability of pollens were recorded maximum at C (79.4%) followed by 66.8% at C, 54.3% at 4 0 C and minimum at room temperature (21.8%). The decreasing trend of viability percentage was observed as 90.5% to 72.4% at C, 83.2% to 54.3% at 4 0 C and 70.3 % to 61.8% at C. At room temperature maximum pollens were observed deceased within 9 weeks of storage with zero percent viability and viable pollens range from 92.7 % to 1.0% up to 6 weeks only. The percentage of average loss of viable pollens in Jyoti range 92.7% to 43.6%. 78

93 Kandhari: During the 9 week of storage period, highest percent of viable pollens were found at C (75.6%), 62.8% at C, 53.3% at 4 0 C and lowest at room temperature (21.7%). Zero percent viability was reached after 7 weeks at room temperature. In Kandhari, overall loss of viability range from 92.0% to 40.0%. Maximum loss of viability was observed at room temperature (92.0% to 0.0%) and minimum was at C (90.0 to 69.1%) where as at 4 0 C viability percentage ranges from 80.6% to 40.0% and 69.6% to 51.0 % at C Pollen germination study in four genotypes of pomegranate The data regarding germination percentage variability among four pomegranate genotypes is presented in Table In vitro pollen germination tested on 10 % sucrose for pollens incubated at four different temperatures (room temperature, 4 0 C, C and C) for nine week gave significant differences. Initial germination potential after 48 hours of sucrose treatment revealed maximum in Ganesh (78.9%) followed by Mridula (75.8%), Jyoti (58.9%) and minimum in Kandhari (51.6%). Ganesh: The data showed highest germination of pollens stored at C (54.3%) followed by C (36.8%), 4 0 C (24.9%) and lowest at room temperature (9.3%). During 9 weeks of storage, maximum loss of germination capacity was observed at room temperature (78.9% to 0.0%) and minimum was at C (77.9% to 22.0%) where as at 4 0 C germination percentage ranges from 70.8% to 1.3% and 63.0% to 4.7% at C. The mean loss of pollen germination ranged from 78.9 % to 7%. Mridula: The C was observed effective storage condition for pollen storage with highest germination percentage (50.2%) followed by C (32.0%), 4 0 C (22.5%) and minimum at room temperature (8.9%). The overall loss of pollen germination was recorded from 75.8% to 5.4% during the 9 weeks of storage. Maximum death of pollens was observed at room temperature after 6 weeks where germination percentage range from 75.8% to 0.0%, 70.1 % to 1.0%, 61.6% to 0.0% at C and minimum loss (75.7% to 20.7%) at C temperature. Jyoti: A significant observation on data on pollen germination revealed that with increase in temperature and duration of storage the loss of germination percentage also increased. The average value at different storage temperature varied between 5.7 % at room temperature to 43.8% at C. The germination percentage loss varied from 58.9% to 0.0% at room temperature whereas 56.1% to 0 at 4 0 C, 57.7% to 27.9% at C and 51.9% to 0 at C. Among different intervals of storage the germination percentage lost from 58.9 % to 6.9%. Kandhari: The mean value of pollen germination at different storage temperatures varied from 5.4% (room temperature) to 36.9% (-20 0 C). A gradual decrease in germination percentage was observed from first day of storage till 9 weeks at all temperatures. Minimum decrease was observed at C (51.3% to 14.9%) was at par with 4 0 C (51.0 to 0%). Maximum loss in germination percentage was observed at room temperature (51.6 to 0.0%). The average value range between 51.6% at I st day storage to 3.4% after 9 weeks of storage with a mean of 19.9%. 79

94 Table 4.18 Pollen viability studies of pomegranate genotypes at different storage temperatures. Duration Ganesh Mridula Jyoti Kandhari (days/ Weeks) Room temp. 4 0 C C C Mean Room temp. 4 0 C C C Mean Room temp. 4 0 C C C Mean Room temp. 4 0 C C C Mean 1st day st week Mean

95 Plate 6: Pollen viability studies of pomegranate genotypes at C storage temperature Plate 7: Pollen viability studies of pomegranate genotypes at room temperature

96 Table 4.19 In vitro germination of pollen of pomegranate genotypes stored at different temperature. Duration Ganesh Mridula Jyoti Kandhari (days/ Weeks) Room temp. 4 0 C C C Mean Room temp. 4 0 C C C Mean Room temp. 4 0 C C C Mean Room temp. 4 0 C C C Mean After 48 hours st week Mean

97 In present study a significant variation regarding pollen viability and germination was observed at four different storage temperatures for nine weeks. It was concluded that C recorded as an effective temperature for pollen storage with highest viability and germination percentage in pomegranate genotypes (Plate 6, 7, 8 and 9). The viability and germination of pollen grains was generally low when stored in deep freezer conditions ( C) compared to storage at C and refrigerator conditions may be attributed to the frequent freezing and thawing of pollen grains led to intracellular ice formation and cell death. The significant variation among different cultivars may be due to genotypic and environmental interactions. The results were found in concord with in vitro studies in different fruit species that showed the genotypes varied in response to different storage temperate for high pollen germination percentage and maximum viable pollens (Beyhan and Serdar 2009 and Sharafi et al 2010). Similarly, Derin and Eti (2001) showed that the highest pollen viability and germination rate were obtained from male flowers of Hicaz (75.24% viability in TTC, 61.50% germination in 10 % sucrose medium in agar plate method). Cultivar Kazkai had the largest pollen grains and the highest pollen fertility (88%) and the maximum pollen germination (73.5%) was observed in 12.5 per cent sucrose solution (Singh et al 1980). 4.8 Hybridization studies in pomegranate germplasm Percent fruit set in pollinated flowers It was calculated as the ratio of number of buds which set into fruits to that of the pollinated buds and per cent fruit set was calculated as under Number of buds which set into fruit Fruit set (%) = x 100 Number of buds pollinated Table 4.20: Per cent of fruit set (%) in different F 1 crosses 2011 and 2012 Parentage 1 st year 2 nd year Mean Ganesh x Mridula Jyoti x Mridula Kandhari x Mridula Mridula x Ganesh Mridula x Jyoti Mridula x Kandhari Mean

98 Plate 8: In vitro germination of pollen of pomegranate genotypes stored at different temperature Plate 9: In vitro germination of pollen of pomegranate genotypes

99 The highest fruit set in cross of Mridula x Ganesh that is 82.68% which was at par with Ganesh X Mridula (80.34%) followed by Mridula X Jyoti (79.66%), Jyoti x Mridula (78.98%), Kandhari x Mridula (75.56%) and lowest set in Mridula x Kandhari (74.23%)in Ist year crossing combinations. In IInd year, increased fruit set was achieved when Ganesh was used as male parent for Mridula (88.41%) comparatively than when used as female parent i.e Ganesh x Mridula (85.68%). Similar results were obtained in rest of crossing combinations where Mridula x Jyoti set more fruits (82.74%) than Jyoti x Mridula (81.26%) followed by Mridula x Kandhari (79.00%) and least in Kandhari x Mridula (78.32%). The data depicted that average fruit set of two years was recorded highest in Mridula x Ganesh (85.54%) which was at par with its reciprocal cross combination i.e Ganesh x Mridula (82.52%). The fruit set in other combinations were observed where Mridula x Jyoti (81.27%) was nearly equal to Jyoti x Mridula (80.12%). The mean of fruit set percentage was lower when Mridula used as both male and female parent for Kandhari (76.94% and 76.61% respectively). It depicted that fruit set was higher when Mridula used as female parent as compared to male parent. Babu et al (2011) also studied the crossing pattern in pomegranate where fruit set was documented 48% in Ganesh with Bhagwa. Manivannan and Rengasamy (1999) made eight crosses of 6 varieties and evaluated for plant height, number of branches, plant spread and production of hermaphrodite flowers and found five hybrids with superior fruit yield. Josan et al. (1979b) reported that after open pollination in 21 pomegranate cvs, fruit set was highest in the cv. Dholka (63.81%), Bedana (63.03%) and Kali Shirin (62.74%).The differences in fruit set percentage could be due to varied degree of compatibility between different genotype, behaviour of pollen with respect to viability and germination percentage, and might be also due to differences in temperature during bloom period, differences in growth rate of pollen tube. Furthermore, the genetic factors which determine the extent of fruit set; the environmental factors also exercise a strong influence. 4.9 Confirmation of F 1 seedling using SSR markers Molecular markers are very useful tools to help plant breeders in identification of hybrid progenies produced from different crosses. Molecular markers also allow for parental verification of breeding progeny. The nuclear DNA derived markers could be employed to identify the pollen parent in poly-crosses and open crosses and to estimate the level of outcrossing Gaiotto et al (1997). Codominant and multiallelic markers such as simple sequence repeat (SSR), sequence tagged site (STS) and expressed sequence tag (EST) markers are efficient in parental and hybrid analysis. 83

100 In present experiment only those SSR primers pair was used which were found polymorphic in earlier experiment which efficiently discriminated among the ancestry and detected polymorphism amplicon. Only five SSR primer pair (PGCT093, PGCT059, PGCT097, PGCT111, and ABRII-MP42) found to produce the polymorphic alleles and these are used to test the hybridity of F 1 seedling produced in previous experiment through crossing parents by artificial pollination (Table 4.21 and Plate 10 and 4.11). Table 4.21: Hybridity confirmation by SSR polymorphic markers Parentage Hybrid numbers Marker(s) Ganesh (P1) x Mridula (P2) H1,H2,H3,H4 and H5 PGCT059, PGCT097 Jyoti (P3) x Mridula (P2) H6,H7,H8,H9 and H10 PGCT059, PGCT093 Kandhari (P4) x Mridula (P2) H11,H12,H13,H14 and H15 PGCT093, PGCT059 Mridula (P2) x Ganesh (P1) H16,H17,H18,H19 and H20 PGCT097 Mridula (P2) x Jyoti (P3) H21,H22,H23,H24 and H25 PGCT111, ABRII-MP42 Mridula (P2) x Kandhari (P4) H26,H27,H28,H29 and H30 ABRII-MP42 The polymorphic SSR primer pairs used for testing the hybridity of the hybrids produced from different crosses. SSR polymorphic molecular markers produced unique banding and confirmed the true hybrid having two amplicon whereas hybrids with one amplicon were considered as negative hybrids (Plates 9 and 10). This confirms the authenticity of the pomegranate crosses made and their further use for future breeding planning. However, in order to confirm the precise hybrid nature of progenies further investigations are required. Many workers used different types of molecular markers to confirm or test the hybrid lines like Randomly amplified polymorphic DNA (RAPD) analysis has been used for distinguishing nucellar from zygotic seedlings (Rodriguez et al, 2005) whereas, Ruiz et al (2000) described the use of simple sequence repeat (SSRs) markers as an alternative method to distinguish sexual from nucellar citrus seedlings. Several others workers used different molecular markers for identification of hybrids and parental lines in different crops (Liu et al 2007, Hao et al 2008 and Xuan et al 2008). 84

101 Plate 10: Amplification profile of Parents and Hybrids.P1, P2, P3 and P4 are parents and H1, H2, H6, H7,H11, H12, H21 and H22 are true hybrids Plate 11: Amplification profile of Parents and Hybrids. P1 and P2 are parents and H2, H3, H4, H5, H16, H17, H18, H19 and H22 are hybrids