Barley Research at Aberdeen. Gongshe Hu USDA-ARS Aberdeen, Idaho

Size: px

Start display at page:

Download "Barley Research at Aberdeen. Gongshe Hu USDA-ARS Aberdeen, Idaho"

Aron Jenkins
6 years ago
Views:

1 Barley Research at Aberdeen Gongshe Hu USDA-ARS Aberdeen, Idaho

2 USDA-ARS Research Facilities at Aberdeen

3 Overview of Malting Barley Research at Aberdeen The genetic program: beta-glucan and malting quality. The breeding program: 1. Scale: plots/year. 2. Malting barley vs. food barley: 80% to 20% 3. 2-row vs. 6-row: 80% to 20% 4. Spring vs. winter: 60% to 40%

4 Barley Breeding Nurseries Ashton- 1598m Tetonia-1764m Idaho Falls-1380m Aberdeen- 1338m Soda Springs-1764m Filer-1064m grangeville-973m Grangeville Ashton Idaho Falls Tetonia Aberdeen Soda Springs Filer

5 Objectives of Barley Research at Aberdeen Genetic Research: To Identify genetic materials and DNA markers with for better qualities of barley improvements. Breeding program: To develop the best cultivars of winter and spring barley: Good quality high yield.

mutagenized Harrington cultivar A Genotype BG (%)

6 Identification and characterization of Barley Low BG mutant Mutant of M351 derived from chemical mutagenized Harrington cultivar A Genotype BG (%) M % Harrington 5.1 Wild-type M351 B Wild-type M351

7 Table 1. Grain chemical compositions of M351 mutant and the corresponding wildtype plants Components Wild-type M351 P value Moisture % Protein % Starch % Oil % MLG % <0.001** Amylose % Crude Fiber % <0.001** Soluble Glucose % Fructans % <0.001** Ash %

8 Table 2. Physical characteristics of M351 and the wild-type grains from Material 100 Kernel hardness index (HI) 100 Kernel weight(g) Grain broken rate in threshing Wild-type % 0.6% M351 mutant % 2.6%

9 Pilot scale malting test (Malteurop North America, Inc) Crop Year 2011 Variety 2011 METCALF 2011 MERIT M351 Test weight On On On Thru FG dry CG dry Wort ph Viscosity DP Alpha-amylase Total protein db Soluble protein S / T Beta-glucan FAN

10 M351 and Its Near isogenic wildtype lines in malting and fermentation Genotype Grain beta-glucan Beta-glucan in Wort(ppm) M % 69 Wildtype 5.1% 251 Conclusions from the Bio-ethanol fermentation Experiment (National Corn-to-Ethanol Research Center) : The mash of the wild type barley had a much higher viscosity than the mutant. After liquefaction, the wild-type was the thickest and visually different than the mutant.

11 DNA markers available to track the mutant gene in M351 7H Bmag564 M351/CslF6 Bmag369 DArT marker bpb-8051 bpb-1039 bpb-8117 bpb-1050 bpb-2920 bpb-5599 bpb-4692 bpb-4623 bpb-9753 bpb-8956 bpb-2097 bpb-1770 bpb-2379 bpb-7437 bpb-7603 bpb-2188 bpb-1476 cdna AA cdna AA ATC GGA TCC GCC GTG GCC TTC I G S A V A F ATC GGA TCC ACC GTG GCC TTC I G S T V A F Wildtype M N C Cellulose Synthase domain A-T in M351

12 Using a SNP functional marker of M351 to track the allele M351F1 G/A M351F1 M351R1 CTTCGCCAAGGTTCTCGAC AGGGGTAGAGGTGGAAGAGC M351R1

13 QTL mapping for the malting quality traits Population of 01Ab8219 x Stellar: 6-row. F5:7 families: 175 Years: 2009, 2010 Locations: Tetonia, Aberdeen Kernel on Barley Malt Wort Wort Barley Wort S/T DP Alphaamylasglucan (ppm) Beta FAN Weight 6/64 Color Extract Color Clarity Protein Protein (%) ( ASBC) (mg) (%) (Agtron) (%) (%) (%) (20 DU) (ppm) Yellow colored values=01ab8219; White colored values = Stellar

QTLs FOR Malting Quality Traits 0.0 4.9 5.3 3H B_2018 B_4022-3H B_4472-3H B_3179-3H B_5555-3H Protein, Wort Protein, and FAM AB 0.0 6.8 8.3 11.0 11.7 28.0 31.0 60.3 65.3 79.4 81.3 85.5 86.2 87.4 90.

14 QTLs FOR Malting Quality Traits H B_2018 B_4022-3H B_4472-3H B_3179-3H B_5555-3H Protein, Wort Protein, and FAM AB H B_9552-1H B_6065-1H ABC B_7949-1H B_8983-1H B H B_9611-1H B_1922-1H B_5292-1H B_2087-1H/5H B_8662-1H B_1586-1H B_5672-1H B_1535-1H B_1398-1H B_0851-1H B_0760-1H B_9288-1H B_0301-1H B_9415-1H H ~100 cm B_4293 B_7557-2H B_5519-2H B_7024-2H B_4704-2H B_0615-2H B_5688-2H B_7445 B_3186-2H B_8399-2H B_6128-2H B_5326 B_4877-2H B_ ConsensusGBS037 ABC B_9458-2H Alpha Amylase TE Kernel wt. AB/TE ~140 cm 4H B_ B_6631-3H ConsensusGBS B_3899-3H B_ B_ B_7719-4H B_3739-4H B_6096-4H B_8701-4H ABC B_6145 bpt h B_8896-4H

15 Kernel wt. TE Malt ext. AB/TE Protein AB/TE DP TE Protein AB, S/T AB, FAN AB, AA TE H ~70c M ABC ABC06144-pHv ABC ABC ABC ABC B_6183-5H ABC B_9896-6H ConsensusGBS039 B_2006-5H B_1420-5H B_9733 B_4318-5H B_4970-5H Protein AB/TE Malt ext., Protein, w_ protein, and DP AB/TE FAN AB/TE H ~65c M ABC ABC10265-sfp ABC ABC ConsensusGBS ABC ABC ABC B_6023-6H B_0922 B_0481-6H B_9841-6H B_6990-6H B_3141-6H B_9807-6H B_2058-6H B_8170 B_ B_9749-6H B_8278 B_9840 B_6669 B_7467-6H B_9651-6H B_0572-6H B_4778-6H B_5498-6H B_3433-6H B_3070 B_0403-6H B_2137-6H B_2304-6H B_1621-6H B_7146-6H B_2863-6H FAN AB Protein AB/TE H B_5935-7H B_6054 B_2595-7H B_7769-7H B_8043-7H B_7863-7H B_8939-7H B_0678-7H B_2533-7H B_5074-7H B_5732 B_5852-7H B_8140 B_6156-7H B_3589-7H B_8568-7H ABC B_8051-7H B_9457-7H B_4441-7H B_7517-7H B_7583 B_3703-7H B_1591-7H B_6301 B_4856-7H B_3419-7H B_0182-7H B_8867-2H 7H B_8778-7H B_2328-7H B_6166-7H B_5923-7H B_0917-7H B_1645 B_0889-7H

16 Cultivars Released recently in the Breeding Program Winter barley malt cultivars: Charles (2006). Endeavor (2009) Both cultivars have been planted in Idaho for more than Acres Spring malt Cultivars: Sublette (2006) Spring food barley cultivars: Tetonia (2009) Julie (2012)

17 Charles Winter barley Cultivar Cultivar Grain yield Bu/Acre Extract Charles (2-row) Eight-Twelve (Feed) AB536-B (6-row)

18 Endeavor Winter Barley Cultivar Cultivar Grain Yield (Bu/A irrigated) Height (cm) BG (g/kg) DP Endeavor * Charles AB536-B Endeavor has better winter hardiness than Charles

19 Sublette Spring Malting Cultivar Cultivar Grain Yield (Bu/A. In 40 yearlocations) % Plump Kernel AA BG (ppm) Sublette Harrington Merit DP

20 Elite Lines of 2-row winter Barley Name Year/ locations Mean Yield (Bu/A) Yield mean% Extract% DP AA Endeavor Charles Maja Ab Ab Ab Ab Ab Ab Ab Ab Ab Ab Ab Ab08-X03W Ab08-X03W

21 Winter Hardiness Screening in Soda Spring Line Barley Type %Spring Stand 02Ab170 2-M 85/100/90 4Ab08-X03W M 95/100/100 02Ab645 2-M 100/95/40 02Ab339 2-M 100/95/60 02Ab710 2-M 100/70/85 4Ab08-X03W M 100/98/95 2Ab09-X05W HL 2-Food 100/95/90 2Ab09-X05W Food 100/85/95 2Ab09-X05W HL 2-Food 100/70/80 2Ab09-X05W049HL-15 2-Food 100/95/90 Schuyler 6-F 100/100/100 Charles 2-M 80/80/75 Endeavor 2-M 95/95/ F 95/95/90 Finess 2-F 100/85/85 SunStar pride 6-F 100/98/95 Lewjain (WW) Winter wheat 98/98/95

22 Winter hardiness of the lines in pilot test (Soda Spring) Genotype Yield ( dryland) Spring Stand% (Soda Spring) 02Ab /80/60 02Ab /85/100 02Ab /80/85 Charles 76 80/80/75 Endeavor 80 95/90/95

23 Malting barley lines in the UI extension Winter Nursery (Aberdeen and Rupert) Cultivar Type Average Yield (Bu/A) Spring Stand (% AB/Rupert) Alba 6-M /95 93Ab669 6-M /88 02Ab431 2-M /95 OR92 6-M /98 OR91 6-M /94 02Ab671 2-M /90 Maja 6-M /98 Charles 2-M /95 Endeavor 2-M /98 OR818 6-M /99 Mathias 6-M /98

24 Winter Hardiness Screening in To repeat the screening process on our elite materials. To expand to some materials from germplasm collections. To look for an additional nursery location in Idaho Falls area.

25 Elite Spring barley Lines 02Ab17271 (Spring 2-row): Under plant scale Evaluation. 02Ab04-X (Spring 2- row): Passed the 2nd year of pilot scale evaluation 01AB9663 (Spring 6-row): Passed the 2 nd year of pilot test.

26 Yield Potential of the Spring Elite lines Variety or Selection Yield (% of control) (Yr/location) Kernel Weight (mg) on 6/64" (%) Malt Extract (%) 2Ab04-X (39) Ab (52) CDC Copeland (10) M (30) HARRINGTON (52) row 01Ab (44) Tradition (46) Morex (44)

27 Summary for the Aberdeen Barley Program Genetic research provided good materials and markers for better barley cultivar development. Breeding program developed barley cultivars used in production. Winter malting lines with better winter hardiness and yield potential developed and are under pilot scale tests.

28 Future studies Look for molecular marker-assistant selection in special traits. Focus on 2-row malting barley for better malting quality and high yield. Enhance the winter malting barley cultivars: focusing on better winter hardiness and malting quality. Look for new technologies for speed up the winter cultivar development such as DH.

29 AMBA Acknowledgements Idaho Barley Commission Collaborators: BARI, Eric Jackson, Emir Islamovic, Pat Hayes, Juliet Marshal, USDA-ARS, Madison, WI. Cooperator Growers: Dave Bodine, Evan Hayes, Clark Kauffman, Craig Ozburn, Sid Cellan Genetics/Breeding program Gongshe Hu Chris Evans Kathy Satterfield Sherry Ellberg Natalie Klassen

Malting Barley Development at OSU. Scott Fisk Cascadia Grains Conference January 12, 2013

Malting Barley Development at OSU Scott Fisk Cascadia Grains Conference January 12, 2013 The ancestral state World s oldest crop Native to Middle East Ancestral form is winter habit 2- row hulled 2-row