Subgenome parallel selection is associated with morphotype diversification and convergent crop domestication in Brassica rapa and Brassica oleracea

Transcription

1 Subgenome parallel selection is associated with morphotype diversification and convergent crop domestication in Brassica rapa and Brassica oleracea Supplementary Note 1. In-silico assesment of impact of paralogous sequencing on variant calling We found the sub-genomes to be sufficiently differentiated to avoid producing false SNPs from such cross-mapping between sub-genomes (Supplementary Tab le 3). SNP density exhibited a limited effect on the SNP calling (Supplementary Figure 2). High levels of sequencing errors may produce a high proportion of false variant calls. However, with moderate ( %) sequencing errors rates, false variant calls can be simply prevented by having a reasonable read depth (Supplementary Figure 2). 2. Linkage Disequilibrium (LD) The B. rapa LD length (the length of half-maximum decay of LD) is 2.9 Kb (Supplementary Figure 5c), similar to that of A. thaliana (< 5 Kb) 1-3. However, LD length in B. oleracea is 36.8 Kb (Supplementary Figure 5d), which is over six times that of A. thaliana. We also calculated LD length in the B. rapa Chinese cabbage, turnip and pak choi subgroups. The LD for Chinese cabbage is 8.6 Kb, which is nearly twice the LD for pak choi (4.0 Kb) and six times the LD for turnip (1.5 Kb) (Supplementary Figure 5c). The LD of the B. oleracea subgroup cabbage is 54.1 Kb, which is smaller than that of kohlrabi (98.6 Kb), cauliflower (63.6 Kb) or broccoli (>100 Kb) (Supplementary Figure 5d). 3. Genome diversity We estimated group-specific selection sweeps using ROD (reduction of diversity) 4. The average ROD was also calculated for each 200 Kb window with a 5 Kb sliding step across all of the B. rapa and B. oleracea chromosomes. The ROD values range from 0 to 1 and represent low to high diversity reduction, respectively (Supplementary Figures 6-15).

2 To determine group specific differentiation signatures, we used a measure PiHS (population based integrated haplotype score) to compare the genomic variations between subgroups in B. rapa, or in B. oleracea. PiHS is a self-developed measure which detects unusually long haplotypes in one group compared to another group of samples. The frequency of such a haplotype soon expands in the population, and will remain for a time unbroken down by recombination, meaning it will be larger in size than background haplotypes. Therefore, the haplotype-based measure PiHS is suitable for screening for signals of recent positive selection in sub-population genomes. PiHS is an extension to the ihs metric that was used to detect recent positive selection signals in human genomes 5. Artificial selection during crop cultivation is a positive selection imposed by human beings, and Brassica cultivars are relatively recent-developed morphotypes, thus PiHS is well suited to detect recent positive selection signals by comparing the haplotype extending variations (main text, Figure 2, Supplementary Figures 6-15). In this analysis, the genome of each of the 199 B. rapa accessions and each of the 113 homozygous B. oleracea accessions represents a complete haplotype. 4. GO term enrichment analysis The enriched GO term analysis was performed in all selected genomic regions combined in heading or organ enlargement morphotypes of B. rapa and B. oleracea to discriminate real causal genes among false positive or hitchhiking genes. The impact of founder effects or genetic bottlenecks rather than artificial selection of certain traits would also be detected as outlier regions, thus introducing false candidate genes. However, the functions of genes from either founder/bottleneck effects or hitchhiking would be selection-free relative to the studied trait so such genes are expected to appear randomly, while causal genes may show functional enrichment. Common phytohormone-related GO terms were selectively enriched in both Br H and Bo H. In Br H, four enriched GO categories representing functions related to four phytohormones (cytokinin, auxin, gibberellins, and jasmonic acid) (Supplementary Tab le 21) were enriched in regions detected by ROD; while other enriched GO terms

3 were related to general functions such as signal transduction or transporter-related activities (Supplementary Tab le 17-S20). Additionally, two ( auxin mediated signaling pathway and cytokinin mediated signaling pathway ) of the above four phytohormone-related GO categories showed significant enrichment in Br H using PiHS (Supplementary Tab le 21). In Bo H of B. oleracea, two ( auxin mediated signaling pathway and jasmonic acid mediated signaling pathway ) of the four GO terms were also enriched in ROD outliers, and one ( jasmonic acid mediated signaling pathway ) of the four GO categories, as well as two others ( gibberellic acid mediated signaling pathway and response to brassinosteroid stimulus ) were enriched in the 55 PiHS outliers (Supplementary Tab le 21). 5. Pseudogene analysis The distribution of the number of lost or gained amino acids (aa) of B. rapa accessions is shown in Supplementary Figure 3. The number of genes decreases rapidly when the size of aa variations increases to more than seven. We classified genes which lost or gained more than eight aa as pseudogenes. Using this approach, we detected 1,741 pseudogenes in the re-sequenced B. rapa accessions (ranging from 295 to 903 pseudogenes per accession), and 2,892 pseudogenes in the B. oleracea accessions (ranging from 1,027 to 1,880 per accession). We detected a significantly greater number of pseudogenes in the non-dominant sub-genome MF1 (P value = ) in B. rapa (Supplementary Tab le 8) and in the non-dominant sub-genomes MF1 (P value = ) and MF2 (P value = ) in B. oleracea as compared with the dominant sub-genome LF (Supplementary Tab le 9). These results indicate the ongoing and extensive fractionation of the non-dominant Brassica sub-genomes 6,7.

4 Supplementary Tables Supplementary Tab le 1. The information of 199 B. rapa accessions. Index Name English name morphotype Origin 1 ssp. pekinensis Chinese cabbage Company DH line 2 ssp. pekinensis Chinese cabbage Company DH line 3 ssp. pekinensis Chinese cabbage Company DH line 4 ssp. pekinensis Chinese cabbage Company inbred line 5 ssp. pekinensis Chinese cabbage Company DH line 6 ssp. pekinensis Chinese cabbage Company DH line 7 ssp. pekinensis Chinese cabbage Company DH line 8 ssp. pekinensis Chinese cabbage Company DH line 9 ssp. pekinensis Chinese cabbage Company inbred line 10 ssp. pekinensis Chinese cabbage Company DH line 11 ssp. pekinensis Chinese cabbage Company inbred line 12 ssp. pekinensis Chinese cabbage Company DH line 13 ssp. pekinensis Chinese cabbage Company DH line 14 ssp. pekinensis Chinese cabbage Company DH line 15 ssp. pekinensis Chinese cabbage Company DH line 16 ssp. pekinensis Chinese cabbage Company DH line 17 ssp. pekinensis Chinese cabbage Company DH line 18 ssp. pekinensis Chinese cabbage Company DH line 19 ssp. pekinensis Chinese cabbage Company DH line 20 ssp. pekinensis Chinese cabbage Company DH line 21 ssp. pekinensis Chinese cabbage Company inbred line 22 ssp. pekinensis Chinese cabbage Company DH line 23 ssp. pekinensis Chinese cabbage Company DH line 24 ssp. pekinensis Chinese cabbage Company DH line 25 ssp. pekinensis Chinese cabbage Company inbred line 26 ssp. pekinensis Chinese cabbage Company inbred line 27 ssp. pekinensis Chinese cabbage Company DH line 28 ssp. pekinensis Chinese cabbage Company DH line 29 ssp. pekinensis Chinese cabbage Company DH line 30 ssp. pekinensis Chinese cabbage Company DH line 31 ssp. pekinensis Chinese cabbage Company DH line 32 ssp. pekinensis Chinese cabbage Company DH line 33 ssp. pekinensis Chinese cabbage Company DH line 34 ssp. pekinensis Chinese cabbage Company inbred line 35 ssp. pekinensis Chinese cabbage Company DH line 36 ssp. pekinensis Chinese cabbage Company DH line 37 ssp. pekinensis Chinese cabbage Company DH line 38 ssp. pekinensis Chinese cabbage Company DH line

5 39 ssp. pekinensis Chinese cabbage Company DH line 40 ssp. pekinensis Chinese cabbage Company inbred line 41 ssp. pekinensis Chinese cabbage Company DH line 42 ssp. pekinensis Chinese cabbage Company DH line 43 ssp. pekinensis Chinese cabbage Company DH line 44 ssp. pekinensis Chinese cabbage Company inbred line 45 ssp. pekinensis Chinese cabbage Company inbred line 46 ssp. pekinensis Chinese cabbage Plant breeding germplasm 47 ssp. rapa Turnip Company DH line 48 ssp. rapa Turnip Company inbred line 49 ssp. rapa Turnip Company DH line 50 ssp. rapa Turnip Company DH line 51 ssp. rapa Turnip Company DH line 52 ssp. rapa Turnip Company DH line 53 ssp. rapa Turnip Plant breeding germplasm 54 ssp. rapa Turnip Plant breeding germplasm 55 ssp. rapa Turnip Plant breeding germplasm 56 ssp. rapa Turnip Plant breeding germplasm 57 ssp. rapa Turnip Plant breeding germplasm 58 ssp. rapa Turnip Plant breeding germplasm 59 ssp. rapa Turnip Plant breeding germplasm 60 ssp. rapa Turnip Plant breeding germplasm 61 ssp. rapa Turnip Plant breeding germplasm 62 ssp. rapa Turnip Plant breeding germplasm 63 ssp. rapa Turnip Plant breeding germplasm 64 ssp. rapa Turnip Plant breeding germplasm 65 ssp. rapa Turnip Plant breeding germplasm 66 ssp. rapa Turnip Plant breeding germplasm 67 ssp. rapa Turnip Plant breeding germplasm 68 ssp. rapa Turnip Plant breeding germplasm 69 ssp. rapa Turnip Plant breeding germplasm 70 ssp. rapa Turnip Plant breeding germplasm 71 ssp. rapa Turnip Plant breeding germplasm 72 ssp. rapa Turnip Plant breeding germplasm 73 ssp. rapa Turnip Plant breeding germplasm 74 ssp. rapa Turnip Plant breeding germplasm 75 ssp. rapa Turnip Plant breeding germplasm 76 ssp. rapa Turnip Plant breeding germplasm 77 ssp. rapa Turnip Plant breeding germplasm 78 ssp. rapa Turnip Plant breeding germplasm 79 ssp. rapa Turnip Plant breeding germplasm 80 ssp. rapa Turnip Plant breeding germplasm 81 ssp. rapa Turnip Plant breeding germplasm 82 ssp. rapa Turnip Plant breeding germplasm

6 83 ssp. rapa Turnip Plant breeding germplasm 84 ssp. rapa Turnip Plant breeding germplasm 85 ssp. rapa Turnip Plant breeding germplasm 86 ssp. rapa Turnip Plant breeding germplasm 87 ssp. rapa Turnip Plant breeding germplasm 88 ssp. rapa Turnip Plant breeding germplasm 89 ssp. rapa Turnip Plant breeding germplasm 90 ssp. rapa Turnip Plant breeding germplasm 91 ssp. rapa Turnip Plant breeding germplasm 92 ssp. rapa Turnip Plant breeding germplasm 93 ssp. rapa Turnip Plant breeding germplasm 94 ssp. rapa Turnip Plant breeding germplasm 95 ssp. rapa Turnip Plant breeding germplasm 96 ssp. rapa Turnip Plant breeding germplasm 97 ssp. rapa Turnip Plant breeding germplasm 98 ssp. rapa Turnip Plant breeding germplasm 99 ssp. rapa Turnip Plant breeding germplasm 100 ssp. rapa Turnip Plant breeding germplasm 101 ssp. chinensis Pak choi Plant breeding germplasm 102 ssp. chinensis Pak choi Company DH line 103 ssp. chinensis Pak choi Company DH line 104 ssp. chinensis Pak choi Company inbred line 105 ssp. chinensis Pak choi Company DH line 106 ssp. chinensis Pak choi Company DH line 107 ssp. chinensis Pak choi Company inbred line 108 ssp. chinensis Pak choi Company DH line 109 ssp. chinensis Pak choi Company inbred line 110 ssp. chinensis Pak choi Company DH line 111 ssp. chinensis Pak choi Company DH line 112 ssp. chinensis Pak choi Company DH line 113 ssp. chinensis Pak choi Company DH line 114 ssp. chinensis Pak choi Company DH line 115 ssp. chinensis Pak choi Company DH line 116 ssp. chinensis Pak choi Company DH line 117 ssp. chinensis Pak choi Company DH line 118 ssp. chinensis Pak choi Company DH line 119 ssp. chinensis Pak choi Company inbred line 120 ssp. chinensis Pak choi Company DH line 121 ssp. chinensis Pak choi Company DH line 122 ssp. chinensis Pak choi Company DH line 123 ssp. chinensis Pak choi Company DH line 124 ssp. chinensis Pak choi Company DH line 125 ssp. chinensis Pak choi Company DH line 126 ssp. narinosa Wutacai Plant breeding germplasm

7 127 ssp. narinosa Wutacai Company DH line 128 ssp. narinosa Wutacai Plant breeding germplasm 129 ssp. narinosa Wutacai Company DH line 130 ssp. narinosa Wutacai Company DH line 131 ssp. narinosa Wutacai Company DH line 132 ssp. narinosa Wutacai Company DH line 133 ssp. parachinensis Caixin Company DH line 134 ssp. parachinensis Caixin Plant breeding germplasm 135 ssp. parachinensis Caixin Plant breeding germplasm 136 ssp. parachinensis Caixin Plant breeding germplasm 137 ssp. parachinensis Caixin Plant breeding germplasm 138 ssp. parachinensis Caixin Plant breeding germplasm 139 ssp. parachinensis Caixin Plant breeding germplasm 140 ssp. parachinensis Caixin Plant breeding germplasm 141 ssp. parachinensis Caixin Plant breeding germplasm 142 ssp. parachinensis Caixin Plant breeding germplasm 143 ssp. parachinensis Caixin Plant breeding germplasm 144 ssp. parachinensis Caixin Plant breeding germplasm 145 ssp. parachinensis Caixin Plant breeding germplasm 146 ssp. parachinensis Caixin Plant breeding germplasm 147 ssp. parachinensis Caixin Plant breeding germplasm 148 ssp. parachinensis Caixin Plant breeding germplasm 149 ssp. parachinensis Caixin Plant breeding germplasm 150 ssp. parachinensis Caixin Plant breeding germplasm 151 ssp. parachinensis Caixin Plant breeding germplasm 152 ssp. parachinensis Caixin Plant breeding germplasm 153 ssp. parachinensis Caixin Plant breeding germplasm 154 ssp. parachinensis Caixin Plant breeding germplasm 155 ssp. parachinensis Caixin Plant breeding germplasm 156 ssp. parachinensis Caixin Plant breeding germplasm 157 ssp. parachinensis Caixin Plant breeding germplasm 158 ssp. parachinensis Caixin Plant breeding germplasm 159 ssp. parachinensis Caixin Plant breeding germplasm 160 ssp. parachinensis Caixin Plant breeding germplasm 161 ssp. parachinensis Caixin Plant breeding germplasm 162 ssp. parachinensis Caixin Plant breeding germplasm 163 ssp. chinensis var. Zicaitai Plant breeding germplasm purpurea Bailey 164 ssp. chinensis var. Zicaitai Plant breeding germplasm purpurea Bailey 165 ssp. chinensis var. Zicaitai Plant breeding germplasm purpurea Bailey 166 ssp. chinensis var. purpurea Bailey Zicaitai Plant breeding germplasm

8 167 ssp. chinensis var. Zicaitai Plant breeding germplasm purpurea Bailey 168 ssp. chinensis var. Zicaitai Plant breeding germplasm purpurea Bailey 169 ssp. chinensis var. Zicaitai Plant breeding germplasm purpurea Bailey 170 ssp. chinensis var. Zicaitai Plant breeding germplasm purpurea Bailey 171 ssp. chinensis var. Zicaitai Plant breeding germplasm purpurea Bailey 172 ssp. chinensis var. Zicaitai Plant breeding germplasm purpurea Bailey 173 ssp. chinensis var. Zicaitai Plant breeding germplasm purpurea Bailey 174 ssp. chinensis var. Zicaitai Plant breeding germplasm purpurea Bailey 175 ssp. chinensis var. Zicaitai Plant breeding germplasm purpurea Bailey 176 ssp. chinensis var. Taicai Company DH line tai-tsai Lin 177 ssp. chinensis var. Taicai Company DH line tai-tsai Lin 178 ssp. chinensis var. Taicai Company DH line tai-tsai Lin 179 ssp. chinensis var. Taicai Company DH line tai-tsai Lin 180 ssp. perviridis Komatsuna Company DH line 181 ssp. perviridis Komatsuna Company DH line 182 ssp. nipposinica Mizuna Company inbred line 183 ssp. nipposinica Mizuna Company inbred line 184 ssp. broccoletto Edible Flower Company DH line 185 ssp. tricolaris Yellow Sarson Company inbred line 186 ssp. oleifera Oil seeds Plant breeding germplasm 187 ssp. oleifera Oil seeds Plant breeding germplasm 188 ssp. oleifera Oil seeds Plant breeding germplasm 189 ssp. oleifera Oil seeds Plant breeding germplasm 190 ssp. oleifera Oil seeds Plant breeding germplasm 191 ssp. oleifera Oil seeds Plant breeding germplasm 192 ssp. oleifera Oil seeds Plant breeding germplasm 193 ssp. oleifera Oil seeds Plant breeding germplasm 194 ssp. oleifera Oil seeds Plant breeding germplasm 195 ssp. oleifera Oil seeds Plant breeding germplasm 196 ssp. oleifera Oil seeds Plant breeding germplasm 197 ssp. oleifera Oil seeds Plant breeding germplasm

9 198 ssp. oleifera Rapid cycling Company DH line 199 ssp. oleifera Rapid cycling Company DH line Note: DH, doubled haploid.

10 Supplementary Tab le 2. The information of 119 B. oleracea accessions. Index Name English name morphotype Origin Genebank Number 1 var. capitata Cabbage Company - 2 var. capitata Cabbage Company - 3 var. capitata Cabbage Company - 4 var. capitata Cabbage Company - 5 var. capitata Cabbage Company - 6 var. capitata Cabbage Company - 7 var. capitata Cabbage Company - 8 var. capitata Cabbage Company - 9 var. capitata Cabbage Company - 10 var. capitata Cabbage Plant breeding germplasm - 11 var. capitata Cabbage Plant breeding germplasm - 12 var. capitata Cabbage Plant breeding germplasm - 13 var. capitata Cabbage Plant breeding germplasm - 14 var. capitata Cabbage Plant breeding germplasm - 15 var. capitata Cabbage Plant breeding germplasm - 16 var. capitata Cabbage Plant breeding germplasm - 17 var. capitata Cabbage Plant breeding germplasm - 18 var. capitata Cabbage Plant breeding germplasm - 19 var. capitata Cabbage Plant breeding germplasm - 20 var. capitata Cabbage Plant breeding germplasm - 21 var. capitata Cabbage Plant breeding germplasm - 22 var. capitata Cabbage Plant breeding germplasm - 23 var. capitata Cabbage Plant breeding germplasm - 24 var. capitata Cabbage Plant breeding germplasm - 25 var. capitata Cabbage Plant breeding germplasm - 26 var. capitata Cabbage Plant breeding germplasm - 27 var. capitata Cabbage Plant breeding germplasm - 28 var. capitata Cabbage Plant breeding germplasm - 29 var. capitata Cabbage Plant breeding germplasm - 30 var. capitata Pointed Cabbage Company - 31 var. capitata Pointed Cabbage Company - 32 var. capitata Pointed Cabbage Company - 33 var. capitata White Cabbage Company - 34 var. capitata White Cabbage Company - 35 var. capitata White Cabbage Company - 36 var. capitata White Cabbage Company - 37 var. capitata White Cabbage Company - 38 var. capitata White Cabbage Company - 39 var. capitata White Cabbage Company - 40 var. capitata White Cabbage Company -

11 41 var. capitata White Cabbage Company - 42 var. capitata White Cabbage Company - 43 var. capitata White Cabbage Company - 44 var. capitata Cabbage Plant breeding germplasm - 45 var. capitata Cabbage Plant breeding germplasm - 46 var. gongylodes Kohlrabi Company - 47 var. gongylodes Kohlrabi Company - 48 var. gongylodes Kohlrabi Company - 49 var. gongylodes Kohlrabi Company - 50 var. gongylodes Kohlrabi Company - 51 var. gongylodes Kohlrabi Company - 52 var. gongylodes Kohlrabi Genebank CGN18459/China 53 var. gongylodes Kohlrabi Genebank CGN18463/Soviet union 54 var. gongylodes Kohlrabi Company - 55 var. gongylodes Kohlrabi Company - 56 var. gongylodes Kohlrabi Company - 57 var. gongylodes Kohlrabi Company - 58 var. gongylodes Kohlrabi Company - 59 var. gongylodes Kohlrabi Company - 60 var. gongylodes Kohlrabi Company - 61 var. gongylodes Kohlrabi Plant breeding germplasm - 62 var. gongylodes Kohlrabi Plant breeding germplasm - 63 var. gongylodes Kohlrabi Plant breeding germplasm - 64 var. gongylodes Kohlrabi Plant breeding germplasm - 65 var. botrytis Cauliflower Company - 66 var. botrytis Cauliflower Company - 67 var. botrytis Cauliflower Company - 68 var. botrytis Cauliflower Company - 69 var. botrytis Cauliflower Company - 70 var. botrytis Cauliflower Company - 71 var. botrytis Cauliflower Company - 72 var. botrytis Cauliflower Company - 73 var. botrytis Cauliflower Company - 74 var. botrytis Cauliflower Company - 75 var. botrytis Cauliflower Company - 76 var. botrytis Cauliflower Company - 77 var. botrytis Cauliflower Company - 78 var. botrytis Cauliflower Company - 79 var. botrytis Cauliflower Company - 80 var. botrytis Cauliflower Plant breeding germplasm - 81 var. botrytis Cauliflower Plant breeding germplasm - 82 var. botrytis Cauliflower Plant breeding germplasm - 83 var. botrytis Cauliflower Plant breeding germplasm - 84 var. botrytis Cauliflower Plant breeding germplasm -

12 85 var. italica Broccoli Company - 86 var. italica Broccoli Company - 87 var. italica Broccoli Company - 88 var. italica Broccoli Company - 89 var. italica Broccoli Company - 90 var. italica Broccoli Company - 91 var. italica Broccoli Company - 92 var. italica Broccoli Company inbred line - 93 var. italica Broccoli Company - 94 var. italica Broccoli Company - 95 var. italica Broccoli Genebank CGN18448/Iraq 96 var. italica Broccoli Genebank CGN18473/USA 97 var. italica Broccoli Company - 98 var. italica Broccoli Company - 99 var. italica Broccoli Company var. italica Broccoli Company var. italica Broccoli Company var. italica Broccoli Plant breeding germplasm var. italica Broccoli Plant breeding germplasm var. italica Broccoli Plant breeding germplasm var. italica Broccoli Plant breeding germplasm var. italica Broccoli Plant breeding germplasm var. italica Broccoli Plant breeding germplasm var. alboglabra Chinese kale Plant breeding germplasm var. alboglabra Chinese kale Plant breeding germplasm var. alboglabra Chinese kale Plant breeding germplasm var. alboglabra Chinese kale Plant breeding germplasm var. gemmifera Brussels sprouts Plant breeding germplasm var. gemmifera Brussels sprouts Plant breeding germplasm var. acephala Kale Plant breeding germplasm var. acephala Kale Plant breeding germplasm var. sabellica Curly Kale Company var. sabellica Curly Kale Company wild type Wild Genebank CGN06903/France 119 wild type Wild Genebank CGN18947/Germany

13 Supplementary Tab le 3. Statistics for SNP callings based on simulation data. SNP density (#bp/1snp) #SNPs simulated #SNPs called #False SNPs Calling ratio Error ratio 0 a % 0.00E ,145,461 4,139, % 1.98E ,572,730 2,362, % 1.02E ,286,365 1,206, % 6.96E , , % 5.46E , , % 5.12E , , % 5.37E * b 514, , % 4.73E , , % 4.05E-05 1, , , % 5.37E-05 a : no SNPs simulated; b : 100 bp pair-end reads were simulated, others are 75 bp pair-end reads.

14 Supplementary Tab le 4. The distribution of SNPs in the 199 B. rapa accessions*. Genic CDS Intron UTR Non-genic Total nonsyn Syn splice intron 5UTR 3UTR 160, , , , , ,065 2,249,473 *: Abbreviations: CDS for coding sequences; UTR for untranslated region; Syn for synonymous; nonsyn for non-synonymous.

15 Supplementary Tab le 5. The distribution of InDels in the 199 B. rapa accessions. Genic CDS Intron UTR Non-genic Total Frameshift* Non-frameshift splice intron 5UTR 3UTR 4,467 10,728 1,710 68,514 81,779 56,341 82, ,617 *: frameshift means InDel variation causing frameshift mutation. Note: Abbreviations are the same as in Table 4.

16 Supplementary Tab le 6. The distribution of SNPs in the 119 B. oleracea accessions. Genic CDS Intron UTR Nongenic Total nonsyn Syn splice intron 5UTR 3UTR 154, , , , ,303 2,402,238 3,852,169 Note: Abbreviations used are the same as in Table 4.

17 Supplementary Tab le 7. The distribution of InDels in the 119 B. oleracea accessions. Genic CDS Intron UTR Nongenic Total Frameshift Non-frameshift splice intron 5UTR 3UTR 5,724 9,516 1,447 57,427 82,447 59, , ,004 Note: Abbreviations used are the same as in Tables S4 and S5.

18 Supplementary Tab le 8. Fisher s exact test for the biased distribution of pseudogenes between subgenomes LF and MF1, as well as LF and MF2 of B. rapa. LF MF1 MF2 #Total genes 17,484 12,556 10,314 #pseudogenes P-value / Abbreviations: LF denotes the least fractionated subgenome, MF1 denotes themore fractionated subgenome 1 and MF2 denotes the more fractionated subgenome 2.

19 Supplementary Tab le 9. Fisher s exact test for the biased distribution of pseudogenes between subgenomes LF and MF1, as well as LF and MF2 of B. oleracea. LF MF1 MF2 #Total genes 19,489 13,796 11,949 #pseudogenes 1, P value / Note: Abbreviations used are the same as in Table 9.

20 Supplementary Tab le 10. Genotype verification for five SNPs in 95 B. rapa accessions. Loci Chromosome Position #Consistent #Inconsistent Ratio of correction 1 A % 2 A % 3 A % 4 A % 5 A % Total / / %

21 Supplementary Tab le genomic regions detected by π in Br H of B. rapa. (Excel spreadsheet) Supplementary Tab le genomic regions detected by π in Bo H of B. oleracea. (Excel spreadsheet) Supplementary Tab le genomic regions detected by ROD (reduction of diversity) in Br H of B. rapa. (Excel spreadsheet) Supplementary Tab le genomic regions detected by ROD (reduction of diversity) in Bo H of B. oleracea. (Excel spreadsheet) Supplementary Tab le genomic regions detected by PiHS (population-based integrated haplotype score) in Br H of B. rapa. (Excel spreadsheet) Supplementary Tab le genomic regions detected by PiHS (population-based integrated haplotype score) in Bo H of B. oleracea. (Excel spreadsheet)

22 Supplementary Tab le 17. The enriched GO-term categories in the candidate genes detected by ROD (reduction of diversity) in Br H of B. rapa. Index GO* #Selected genes #Total genes P value GO annotation 1 GO: E-06 clathrin binding 2 GO: gibberellin biosynthetic process 3 GO: phospholipid binding 4 GO: cytokinin mediated signaling pathway 5 GO: binding 6 GO: iron-sulfur cluster binding 7 GO: vesicle-mediated transport 8 GO: embryonic development 9 GO: transporter activity 10 GO: actin binding 11 GO: drug transmembrane transporter activity 12 GO: sugar mediated signaling pathway 13 GO: water channel activity 14 GO: auxin mediated signaling pathway 15 GO: jasmonic acid mediated signaling pathway 16 GO: heat shock protein binding *GO: gene ontology.

23 Supplementary Tab le 18. The enriched GO-term categories of candidate genes detected by ROD (reduction of diversity) in Bo H of B. oleracea. Index GO* #Selected #Total genes genes P value GO annotation 1 GO: response to oxidative stress 2 GO: response to wounding 4 GO: response to cold 5 GO: potassium ion transport 6 GO: jasmonic acid mediated signaling pathway 7 GO: protein ubiquitination 8 GO: sodium ion transport 9 GO: ribosome biogenesis 10 GO: translational elongation 11 GO: SCF ubiquitin ligase complex 12 GO: response to osmotic stress 13 GO: lignin biosynthetic process 14 GO: auxin mediated signaling pathway 15 GO: ribosome 16 GO: defense response to fungus 17 GO: ubiquitin-protein ligase activity *GO: gene ontology.

24 Supplementary Tab le 19. The enriched GO-term categories detected by PiHS (population-based integrated haplotype score) in Br H of B. rapa. Index GO* #Selected #Total genes genes P value GO annotation 1 GO: protein homodimerization activity 2 GO: identical protein binding 3 GO: signal transducer activity 4 GO: potassium ion transport 5 GO: oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecula 6 GO: peptidyl-cysteine S-nitrosylation 7 GO: cytokinin mediated signaling pathway 8 GO: stromule 9 GO: carbohydrate binding 10 GO: clathrin binding 11 GO: actin binding 12 GO: auxin mediated signaling pathway 13 GO: response to osmotic stress 14 GO: oxidoreductase activity 15 GO: transporter activity *GO: gene ontology.

25 Supplementary Tab le 20. The enriched GO-term categories of candidate genes detected by PiHS (population-based integrated haplotype score) in Bo H of B. oleracea. Index GO* #Selected #Total genes genes P value GO annotation 1 GO: protein tyrosine kinase activity 2 GO: ubiquitin-protein ligase activity 3 GO: jasmonic acid mediated signaling pathway 4 GO: gibberellic acid mediated signaling pathway 5 GO: response to wounding 6 GO: apoptosis 7 GO: signal transduction 8 GO: ubiquitin-dependent protein catabolic process 9 GO: defense response 10 GO: plastoglobule 11 GO: protein amino acid phosphorylation 12 GO: stromule 13 GO: response to brassinosteroid stimulus 14 GO: phloem or xylem histogenesis 15 GO: sugar binding 16 GO: thylakoid 17 GO: regulation of meristem growth 18 GO: protein kinase activity 19 GO: ribosome biogenesis 20 GO: protein folding 21 GO: xyloglucan:xyloglucosyl transferase activity 22 GO: ATP binding 23 GO: root development 24 GO: chloroplast thylakoid membrane 25 GO: kinase activity 26 GO: response to oxidative stress

26 Supplementary Tab le 21. Enrichment status of four GO terms related to phytohormones in genomic regions under selection in heading B. rapa and B. oleracea. GO enrichment test B. rapa B. oleracea GO function ROD PiHS ROD PiHS #gene P value #gene P value #gene P value #gene P value 6 (58) a 7.10E-03** 4 (58) 1.52E-02* / / 3 (69) 3.19E-01 cytokinin mediated signaling pathway 4 (44) 3.84E-02* 3 (44) 3.26E-02* 2 (53) 3.38E-02* 3 (53) 2.01E-01 auxin mediated signaling pathway 4 (47) 4.64E-02* 2 (47) 1.80E-01 3 (59) 4.33E-03* 7 (59) 2.31E-03** jasmonic acid mediated signaling pathway 5 (32) 2.85E-03** 2 (32) 9.02E-02 1 (34) 1.67E-01 1 (34) 6.24E-01 gibberellin biosynthetic process a the number of particular genes located in the genomic regions under selection, and the total number of corresponding genes (in parentheses) with the same GO terms in the whole genome. Fisher s exact test was performed to test the enrichment status of each GO term. Abbrevations: GO for gene ontology, ROD for reduction of diversity and PiHS for population-based integrated haplotype score.

27 Supplementary Tab le 22. The genetic and physical positions (from a RIL population) of five selection regions corresponding to two loci of subgenome parallel selection in heading B. rapa. (Excel spreadsheet)

28 Supplementary Tab le 23. Values of measures used to estimate the selection pressure on three candidate genes related to the heading trait of B. oleracea. Genes genes At ortholog π ROD PiHS F ST BoKAN2.2 Bol AT1G BoBRX.2 Bol AT1G BoATHB15.2 Bol AT1G Abbrevations: GO for Gene Ontology, π for nucleotide diversity, ROD for reduction of diversity, PiHS for population-based integrated haplotype score, F ST for fix index, KAN for KANADI, BRX for BREVIS RADIX and ATHB for ARABIDOPSIS THALIANA HOMEOBOX

29 Supplementary Tab le 24. Candidate genes of heading trait in B. rapa and phenotypes of corresponding mutants in A. thaliana. Genes Symbol Reported phenotype/function in Arabidopsis ARF3.1 ARF4.1 AT2G33860 AT5G60450 highly twisted leaves, curled and irregularly shaped a KAN2.1 AT1G32240 organ polarity defects, severe curling leaves b AXR1.1 AT1G05180 crinkled, irregular leaves curled around leaf axis c BRX.1 AT1G31880 curled upwards leaves, smooth leaf margins and long petioles d BRX.2 a: phenotypes observed in A. thaliana mutants CS66481 and CS66480 in the TAIR database and also from 8. b: phenotypes of the mutant CS67888 and from 8,9. c: phenotypes of the mutants CS3075, CS3076, and CS8038, and from 10,11. d: phenotypes of the mutant CS6879 and from 12.

30 Supplementary Tab le 25. The expression values of nine genes in 47 Br H and 46 Br NH accessions of B. rapa. (Excel spreadsheet)

31 Supplementary Tab le 26. Statistics showing that genes under selection (P1) are significantly over expressed compared to their paralogs (P2) that were not under selection. Genes P value P1 a P2 (paired T-test) BrARF3.1 BrARF E-21 BrARF4.1 BrARF E-21 BrBRX.1 BrBRX E-08 BrBRX.2 BrBRX E-12

32 Supplementary Tab le S genomic regions detected by ROD (reduction of diversity) in the turnip subset of B. rapa. (Excel spreadsheet) Supplementary Tab le genomic regions detected by PiHS (population-based integrated haplotype score) in the turnip subset of B. rapa. (Excel spreadsheet) Supplementary Tab le genomic regions detected by ROD (reduction of diversity) in the kohlrabi subset of B. oleracea. (Excel spreadsheet) Supplementary Tab le genomic regions detected by PiHS (population-based integrated haplotype score) in the kohlrabi subset of B. oleracea. (Excel spreadsheet)

33 Supplementary Tab le 31. The shared selection regions detected by PiHS (population-based integrated haplotype score) among the six subgenomes of the turnip accessions in B. rapa and the kohlrabi accessions in B. oleracea. B. rapa B. oleracea B. rapa B. oleracea LF MF1 MF2 LF MF1 MF2 LF 11 MF1 0 9 MF LF MF MF

34 Supplmentary Tab le 32. A selected list of candidate genes for tuberous organ enlargement in both B. rapa turnip and B. oleracea kohlrabi. (Excel spreadsheet)

35 Supplementary Tab le 33. Distribution of morphotypes of the 806 B. rapa germplasm accessions used to validate the candidate selection targets. Type Subspecies Name #accessions Br H ssp. pekinensis 359 ssp. chinensis 113 ssp. parachinensis 78 ssp. rapa 68 ssp. narinosa 7 ssp. broccoletto 15 Br NH ssp. nipposinica 6 ssp. tricolaris 87 ssp. chinensis var. purpurea Bailey 60 ssp. chinensis var. tai-tsai Lin 7 ssp. perviridis 5 ssp. oleifera 1 Sum / 806

36 Supplementary Tab le 34. Functional mutations detected in 46 Br H and 153 Br NH, respectively. Gene Name Mutation site Functional change #mutation in Br H * #mutation in Br NH 568 Val127Ile 1 70 BrARF3.1 Bra ,299 Val284Ala ,264 Gln521His 4 98 BrKAN2.1 Bra Del3-CDS *: number of genotypes with corresponding mutation; mutation is the genotype that is different from the reference genome of Chiifu.

37 Supplementary Tab le 35. Markers used for validating the selection signals of the six genes in B. rapa germplam. Gene Name Mutation site Genotype Dominant in Br H Marker name BrARF3.1 Bra G/C G BrARF3.1CAPS BrKAN2.1 Bra In/Del (CAG) In BrKAN2.1Indel BrBRX.1 Bra A/T A BrBRX.1CAPS BrBRX.2 Bra b A/G A BrBRX.2dCAPS BrARF4.1 Bra In/Del (TTTT) In BrARF4.1indel Primers F: GGATGAGCCAGAGGAACATT R: TAGAGAGCAATGTCTAGCAACA F: ACAACAATAGCTTTGGTACCAGT R: ATGCTTCGTTTAGCTGGGAA F: TTCCATCTTCGAGTAAGTTGAATCT R: AGAAATTTAACCGCCAAGCTCT F: TGTCCTTTCTTCATGGGGCTTC R: TAAACTTCTCTTGATGCTTAAAGCC F: AGGCTTCCTTGCTTGTGA R: TCAAACCAGCAAAGCTCA Restriction Digest length enzyme polymorphism (bp) MvaI 256/331 / 224/227 a RsaI 142/199 Taq α I 180/206 / 132/136 a a : The size difference is caused by an InDel polymorphism. b :5 UTR (untranslated region), 1318 bp upstream of the translation start site.

38 Supplementary Tab le 36. Validation of the candidate genes in a B. rapa germplasm collections with 806 accessions. Genes BrARF3.1 BrKAN2.1 BrBRX.1 BrBRX.2 BrARF4.1 Group Genotype A Genotype B Br H Br NH Br H Br NH Br H Br NH Br H Br NH Br H Br NH P value (Fisher s exact test) 2.03E E E E E-20 Note: Genotype A, Non-dominant allele in Br H ; Genotype B, Dominant allele in Br H, refer to Supplementary Table 13, Heterozygous genotypes were not counted.

39 Supplementary Figures Supplementary Figure 1. Map showing the distribution of the 199 B. rapa and 119 B. oleracea accessions. The B. oleracea accessions were mostly company breeding lines, where no detailed information on geographical origin was available.

40 Supplementary Figure 2. Statistics for variation callings based on simulated resequencing data of 6 coverage B. rapa genomes. (a) SNP calling efficiency on simulated data with different SNP densities, with the black line denoting the fraction of simulated SNPs that were actually called out, while the blue line denotes the absolute number of false SNPs that were called out. (b) SNP calling efficiency on simulated data with variant sequencing errors, with solid lines denoting the fraction of simulated SNPs correctly called out (applying a threshold for detection of the SNP of either one-, two-, or three-fold coverage), while dashed lines show the fraction of SNPs incorrectly called due to simulated sequencing errors, depending on the SNP detection threshold used.

41 Supplementary Figure 3. Frequency distribution in the B. rapa collection of gene variants with the numbers of amino acids lost or gained with respect to the reference genes. Genes with length variations of more than eight amino acids were classified as pseudogenes.

42 Supplementary Figure 4. The frequency distribution of K a /K s values for gene pairs between A. thaliana and all B. rapa accessions (a), and A. thaliana and all B. oleracea accessions (b). Two stars indicate significant differences in number of genes with small K a /K s values (0-0.2) among subgenomes. P value = 5.23E-53 and 4.14E-119 for K a /K s = and in B. rapa; P value = 8.38E-46 and 1.18E-86 for K a /K s = and in B. oleracea (χ 2 test).

43 Supplementary Figure 5. Population genetic features of B. rapa and B. oleracea. (a) The decay of linkage disequilibrium (LD) in the B. rapa population. The half-maximum decay of total LD for B. rapa was 2.9 Kb. (b) The decay of LD in the B. oleracea population. The half-maximum decay of total LD for B. oleracea was 36.8 Kb. The genetic components calculated by the tool STRUCTURE 13 for the 199 B. rapa accessions (c) and the 119 B. oleracea accessions (d).

44 Supplementary Figure 6. Selection signals detected by PiHS and ROD across chromosome A01 of B. rapa. Values of PiHS and ROD were plotted as dots in colors of yellow and light blue, respectively. Outliers (empirical α=0.01) of PiHS and ROD were plotted with colors of orange and dark blue. PiHS was calculated for each core SNP across the chromosome, while ROD was calculated with a 30 Kb window and 10 Kb step sliding the whole chromosome. So each point of PiHS was for a SNP, while each point of ROD was the average value for SNPs in a 30 Kb window. The lines in ROD (blue) plot the values that are generated from using a 300 Kb window and 100 Kb step moving through the chromosome.

45 Supplementary Figure 7. Selection signals on chromosome A02 of B. rapa. Detailed information is the same as the legend of Supplementary Figure 6.

46 Supplementary Figure 8. Selection signals on chromosome A03 of B. rapa. Detailed information is the same as the legend of Supplementary Figure 6.

47 Supplementary Figure 9. Selection signals on chromosome A04 of B. rapa. Detailed information is the same as the legend of Supplementary Figure 6.

48 Supplementary Figure 10. Selection signals on chromosome A05 of B. rapa. The location of the example of gene BrARF3.1 is labeled with a red line on the left, while the right red line shows the location of BrKAN2.3 which shows weak selection signals. Detailed information is the same as the legend of Supplementary Figure 6.

49 Supplementary Figure 11. Selection signals on chromosome A06 of B. rapa. Detailed information is the same as the legend of Supplementary Figure 6.

50 Supplementary Figure 12. Selection signals on chromosome A07 of B. rapa. Detailed information is the same as the legend of Supplementary Figure 6.

51 Supplementary Figure 13. Selection signals on chromosome A08 of B. rapa. The vertical red line shows the location of gene BrBRX.2 which was listed as an example in the main text. Detailed information is the same as the legend of Supplementary Figure 6.

52 Supplementary Figure 14. Selection signals on chromosome A09 of B. rapa. The two vertical red lines show the locations of genes BrKAN2.1 and BrBRX.1 that were listed as examples in the main text. Detailed information is the same as the legend of Supplementary Figure 6.

53 Supplementary Figure 15. Selection signals on chromosome A10 of B. rapa. The location of the example of gene BrARF4.1 iss labeled with a red line, which shows outlier value of ROD (the dark blue point). Detailed information is the same as the legend of Supplementary Figure 6.

54 Supplementary Figure 16. The workflow to reconstruct the six subgenomes for B. rapa and B. oleracea.

55 Supplementary Figure 17. The overlap of selection targets among subgenomes of B. rapa and B. oleracea. (a) The selection signals detected by PiHS in genomes of heading B. rapa. (b) The ten chromosomes of B. rapa, with read, green and blue denoting subgenomes LF, MF1 and MF2, respectively. (c) The seven chromosomes of the Brassica ancestor before the whole genome triplication, the colors denote the 24 genomic blocks 14. (d) The nine chromosomes of B. oleracea, colored like (b). (e) The selection signals detected by PiHS in the genomes of heading B. oleracea. Light green vertical lines on (c) denote the overlapping selection targets shared between subgenomes of B. rapa and B. oleracea, while light blue vertical lines denote the overlapping selection targets between subgenomes uniqe to B. rapa or to B. oleracea. Figure 3 (Maintext) shows the same lines. We picked three examples to show the different types of overlap between selection signals: 1) Light green dashed lines link the three selection targets in B. rapa to their convergent selection target in B. oleracea, with selection target on B. rapa A08 and B. oleracea C08 located on the same subgenome MF1, while the other two selection targets are on B. rapa A05 in MF2, and B. rapa A09 in LF. 2) Light blue dashed lines above (c) link two parallel selection targets between subgenomes (A01 in LF, A09 in MF2) within B. rapa; 3) the light blue dashed lines below (c) link two parallel selection targets between subgenomes (C03 in MF2, A04 in MF1) within B. oleracea.

56 Supplementary Figure 18. Permutation test for the shared subgenomic loci under selection in B. rapa and B. oleracea. One million permutation tests have been performed for the 24 selected regions in Br H (red) and 55 regions in Bo H (light green) within their subgenomes, as well as between the two species (light blue). For example, the P value for four overlapping subgenomic loci in Br H is 1.0E-6, i.e. four shared subgenomic loci was observed only once in the one million permutation tests.

57 Supplementary Figure 19. The violin plot of K s values between homologous gene pairs under selection in heading B. rapa (Br) and B. oleracea (Bo). A violin plot is a combination of a boxplot and a kernel density plot. Parallel denotes paralogous gene pairs between subgenomes within Br or Bo, such as Br LF vs. Br MF1 or Bo LF vs. Bo MF1. 48 such gene pairs were found, with a smallest K s = Convergent means orthologous gene pairs from the same subgenomes between Br and Bo, such as Br LF vs. Bo LF. 102 such pairs were found, with the smallest K s = Parallel and convergent denote gene pairs under convergent selection on different subgenomes between Br and Bo, for example Br LF & Bo MF1. 24 such gene pairs were found, with the smallest K s =0.211.

58 Supplementary Figure 20. Candidate genes involved in establishing leaf polarity are under selection in the B. rapa and B. oleracea leaf-heading morphotypes. (a) A B. rapa Chinese cabbage, of the Br H morphotype, cut in half longitudinally. Also shown are the main pathway genes that pattern the leaf adaxial/abaxial axes. Two genes that function in leaf abaxial patterning, highlighted by red boxes, are under selection in this B. rapa morphotype. (b) A B. oleracea cabbage, of the Bo H morphotype, cut in half longitudinally. Only the main leaf-patterning genes are shown for brevity. Two genes involved in leaf polarity patterning, highlighted by red boxes, are under selection in this B. oleracea morphotype. The pathway data shown are taken from the following references Abbreviations: HD-ZIPIII for class III homeodomain-leucine zipper, ZPR for LITTLE ZIPPER, AS1 for ASYMMETRIC LEAVES1, BOP for Blade On Petiole, JAG for JAGGED, ARF3 for Auxin Response Factor 3, TAS3 for TRANS-ACTING SIRNA3, AGO1 for ARGONAUTE1.

59 Supplementary Figure 21. Recent positive selection signals detected in genes BrKAN2.1 and BrBRX.1 in Br H, as well as BoKAN2.2 and BoBRX.2 in Bo H. (a) PiHS identified recent positive selection on haplotypes that harbored genes BrKAN2.1 and BrBRX.1, the stars show the SNP located in the genic region of the two genes; (b) the haplotypes extending from the core SNP located in genic region of BrKAN2.1; (c) the extended haplotype homozygosity (EHH) for BrKAN2.1 between Br H and Br NH. (d) the haplotypes extending from the core SNP located in the genic region of BrBRX.1; (e) the extended haplotype homozygosity for BrBRX.1 between Br H and Br NH ; (f) PiHS identifies recent positive selection on BoKAN2.2 and BoBRX.2, the stars show the SNP located in the genic region of the two genes; (g) the haplotypes extending from the core SNP located in genic region of BoKAN2.2; (h) the extended haplotype homozygosity (EHH) for BoKAN2.2 between Bo H and Bo NH. (i) The haplotypes extending from the core SNP located in genic region of BoBRX.2; (j) The extended haplotype homozygosity for BoBRX.2 between Bo H and Bo NH.

60 Supplementary Figure 22. Recent positive selection signals detected in gene BrBRX.2 in B. rapa. (a) PiHS identifies recent positive selection on the BrBRX.2 harboring haplotype, the stars show the SNP located in the genic region of BrBRX.2; (b) the haplotypes extended from the core SNP located in genic region of BrBRX.2; (c) The extended haplotype homozygosity (EHH) for BrBRX.2 between Br H and Br NH.

61 Supplementary Figure 23. Genomic signatures showing strong selection signals in the genomes of turnip and kolhrabi. (a) ROD (reduction of diversity) and PiHS (population based integrated haplotype score) values were normalized as Z-scores for the B. rapa population. A 200 Kb sliding window with a 5 Kb increment was used to calculate these values; each point represents a value in a 200 Kb window. The black horizontal dashed lines show the empirical thresholds α = 0.01 (Z = 2.33). The seven red triangles denote Quantitative Trait Loci detected in turnip Recombinant Inbred Line (RIL) populations from crosses between a Japanese turnip and a non-turnip morphotype that overlap with eight subgenome regions under selection. (b) The distributions of normalized values of ROD, π, and PiHS for the B. rapa population. The rightward tails of Z(ROD) and Z(PiHS) indicate the existence of highly differentiated and strongly positive-selected regions in the genome of turnips compared with non-turnips, while the leftward tail of Z(π) reflects the existence of genomic regions with low diversity in the turnip group. (c) Venn diagram showing the unique and shared outlier regions detected by ROD, π, and PiHS for turnips. (d) Normalized Z-scores of ROD and PiHS for kohlrabi. (e) The distributions of normalized values of ROD, π, and PiHS for the kohlrabi s. (f) Venn diagram of outlier regions detected by ROD, π, and PiHS for kohlrabi s.

62 Supplementary Figure 24. Parallel subgenomic selection is observed among subgenomes of turnip and kolhrabi. The subgenomes LF, MF1 and MF2 were aligned along the diploid ancestral chromosomes of Brassicas (tpck, translocation Proto-Calepineae Karyotype) 18. The Z-scores of PiHS values were then plotted against the six subgenomes of B. rapa and B. oleracea. The red vertical dashed lines show the empirical thresholds α = 0.01 (Z = 2.33), while the red horizontal dashed lines show subgenomic parallel selection regions relating to root/stem enlargement trait among the six subgenomes. The blue arrows denote the subgenomic parallel selection among the three subgenomes of B. rapa (leftside) or B. oleracea (rightside), while the green arrows denote the parallel/convergent selection between subgenomes of B. rapa and B. oleracea. Full circles in light-blue show the location of retained paralogues syntenic to orthologous genes EXPB3 (EXPANSIN B3) and STP1 (SUGAR TRANSPORTER 1) in A. thaliana, while circles with the red crosses denote the fractionated gene copies in corresponding subgenomes. The suffix.1,.2 or.3 to the gene names denote genes locations at subgenome LF, MF1 or MF2, respectively. The seven red triangles denote QTLs detected in turnip Recombinant Inbred Line (RIL) populations from crosses between a Japanese turnip and a non-turnip morphotype that overlap with eight subgenome regions under selection.

63 REFERENCES 1. Kim, S. et al. Recombination and linkage disequilibrium in Arabidopsis thaliana. Nat Genet 39, (2007). 2. Gan, X. et al. Multiple reference genomes and transcriptomes for Arabidopsis thaliana. Nature 477, (2011). 3. Cao, J. et al. Whole-genome sequencing of multiple Arabidopsis thaliana populations. Nat Genet 43, (2011). 4. Xu, X. et al. Resequencing 50 accessions of cultivated and wild rice yields markers for identifying agronomically important genes. Nat Biotechnol 30, (2012). 5. Voight, B.F., Kudaravalli, S., Wen, X. & Pritchard, J.K. A map of recent positive selection in the human genome. PLoS Biol 4, e72 (2006). 6. Cheng, F. et al. Biased gene fractionation and dominant gene expression among the subgenomes of Brassica rapa. PLoS One 7, e36442 (2012). 7. Tang, H. et al. Altered patterns of fractionation and exon deletions in Brassica rapa support a two-step model of paleohexaploidy. Genetics 190, (2012). 8. Pekker, I., Alvarez, J.P. & Eshed, Y. Auxin response factors mediate Arabidopsis organ asymmetry via modulation of KANADI activity. Plant Cell 17, (2005). 9. Wu, G. et al. KANADI1 regulates adaxial-abaxial polarity in Arabidopsis by directly repressing the transcription of ASYMMETRIC LEAVES2. Proc Natl Acad Sci U S A 105, (2008). 10. Leyser, H.M. et al. Arabidopsis auxin-resistance gene AXR1 encodes a protein related to ubiquitin-activating enzyme E1. Nature 364, (1993). 11. Hobbie, L. & Estelle, M. The axr4 auxin-resistant mutants of Arabidopsis thaliana define a gene important for root gravitropism and lateral root initiation. Plant J 7, (1995). 12. Beuchat, J. et al. BRX promotes Arabidopsis shoot growth. New Phytol 188, 23-9 (2010). 13. Pritchard, J.K., Stephens, M. & Donnelly, P. Inference of population structure using multilocus genotype data. Genetics 155, (2000). 14. Schranz, M.E., Lysak, M.A. & Mitchell-Olds, T. The ABC's of comparative genomics in the Brassicaceae: building blocks of crucifer genomes. Trends Plant Sci 11, (2006). 15. Kidner, C.A. & Timmermans, M.C. Mixing and matching pathways in leaf polarity. Curr Opin Plant Biol 10, (2007). 16. Townsley, B.T. & Sinha, N.R. A new development: evolving concepts in leaf ontogeny. Annu Rev Plant Biol 63, (2012). 17. Kidner, C.A. & Timmermans, M.C. Signaling sides adaxial-abaxial patterning in leaves. Curr Top Dev Biol 91, (2010). 18. Cheng, F. et al. Deciphering the diploid ancestral genome of the Mesohexaploid Brassica rapa. Plant Cell 25, (2013).