Analysis on the arcelin expression in bruchid pest resistant wild pulses using real time RT-qPCR

Transcription

1 Indian Journal of Experimental Biology Vol.52, December 2014, pp Analysis on the arcelin expression in bruchid pest resistant wild pulses using real time RT-qPCR Shanmugavel Sakthivelkumar, Velayutham Veeramani, Karuppiah Hilda, Munusamy Arumugam & Sundaram Janarthanan* Department of Zoology, University of Madras, Guindy Campus, Chennai , India Received 29 October 2013; revised 19 August 2014 Arcelin, the antimetabolic protein from wild pulses is a known natural insecticidal molecule. Wild pulses with high arcelin content could serve as potential source to increase the levels of insect resistance in cultivated pulse crops. In this study, arcelin (Arl) gene expression was screened in seven stored product insect pest resistant wild pulse varieties using real time RT-qPCR. Arcelin gene specific real time PCR primers were synthesized from arcelin mrna sequence of the wild pulse variety, Lablab purpureus. The results revealed different levels of arcelin gene expression in the tested varieties. Canavalia virosa registered significantly high content indicating its suitability for utilization of arcelin gene in developing stored product insect pest resistance with other cultivated pulses. Keywords: Antimetabolic protein, Canavalia virosa, Gene expression, Insects, Lablab purpureus, Pest resistance, Vigna umbellata *Correspondence: Phone: ; Fax: janas_09@yahoo.co.in Post harvest loss due to stored product insect pests largely affects the overall food grain production and consumption 1. It is estimated to be 13 % out of a total loss of 37 % in world agricultural production caused by pests and diseases 2. Controlled temperature and humidity or introduction of volatiles, such as methyl bromide, phosphine and sulfur protect stored pulses from pest damage 3,4. Increased use of chemical compounds during the recent decades proved harmful for non-target organisms and the environment. In this context, alternative approach such as identification and manipulation of inherent resistance mechanisms in cultivated crop varieties and their wild relatives, provide an effective method to manage stored product pests without compromising agricultural, environmental and health issues 5. Many cultivated bean varieties with good yield potentials are highly susceptible to stored product insect pests, whereas the wild varieties have acquired chemical defenses against insects by accumulating insect resistant principles such as phenolics, cyanogens, tannins, protease inhibitors, amylase inhibitors, lectins and arcelins 6-8. In the wild bean Phaseolus vulgaris, a multi-gene family encoding the α-amylase inhibitor, phytohemagglutinin and lectin-like proteins (APL family) is known to contribute the seed protein, arcelins that prevents infestation by stored product insect pests 9. Arcelins, the lectin-like proteins described in eight allelic variants in various accessions of wild bean P. vulgaris exhibit different levels of resistance to the bruchid insect pests 8,9. The variations in the gene family has already been exploited to breed cultivated bean genotypes for bean weevil resistance 10. In the present study, we explored a new source of insecticidal gene arcelin and its levels of expression in different stored product pest resistant Indian wild pulse varieties. Materials and Methods Plant material Indian wild pulse varieties Canavalia virosa, Lablab purpureus (brown), Mucuna pruriens, Phaseolus sp., Vigna aconitifolia, V. umbellata (rice bean-red) and V. umbellata (rice bean-yellow) were collected from various locations in Tamil Nadu (Fig. 1), dried and stored at room temperature (28 ± 2 o C) for two weeks. Insect feeding bioassay The seeds (pulses) were subjected to insect infestation for a period of one complete life cycle i.e., till adult emergence (27-30 days) with the stored product pest, Callosobruchus maculatus (Bruchidae: Coleoptera). Five pairs of mature C. maculatus adults were introduced in plastic

2 1196 INDIAN J EXP BIOL, DECEMBER 2014 Fig. 1 Selected wild pulses from various parts of Tamil Nadu, India. containers with 100 g of each seed material to evaluate infestation potential of bruchid beetle. Five replicates were maintained for each seed variety. The infestation potential of the bruchid was assessed by observing parameters like adult emergence and seed damage. Seeds of cowpea Vigna unguiculata, an established C. maculatus susceptible variety, served as control. Isolation of total RNA The pulse varieties were germinated under laboratory condition. After four days, the tender leaves were plucked for isolation of total RNA using Mini RNA extraction kit (Shrimpex Biotech Limited, India) following the manufacturer's protocol. Briefly, the germinated tender leaves of different wild pulses were surface sterilized with glass distilled water followed by physiological saline (0.9 %) and DEPC treated water. The leaf samples (100 mg) were homogenized using RNase free teflon micropestle in 1.5 ml centrifuge tubes containing 650 µl of SL buffer and 6.5 µl of β-mercaptoethanol. The homogenized tissue sample was incubated at room temperature for 5 min and centrifuged at rpm for 10 min. The supernatant (350 µl) was collected and loaded with pre filter column placed in 2 ml collection tube. It was again centrifuged at rpm for 30 s and lysate collected was added with an equal volume (350 µl) of 70% ethanol, mixed thoroughly and loaded to SMS column placed in a 2 ml collection tube. This column was centrifuged at rpm for 15 s and the flowthrough was discarded and the column was washed with 550 µl of 70% ethanol and centrifuged again at rpm for 15 s. Finally, the column was transferred to a new 2 ml collection tube, added with 50 µl of SE buffer, incubated for 5 min followed by centrifuging at rpm for 1 min. Later, the column was discarded and the RNA was collected at the tube bottom.

3 SAKTHIVELKUMAR et al.: RT-qPCR ANALYSIS ON ARCELIN GENE EXPRESSION IN INDIAN WILD PULSES 1197 The quantity and quality of RNA was verified using a spectrophotometer (NanoDrop 2000C UV-Vis Spectrophotometer, Thermo Scientific) at a wavelength ratio of A260/280. The integrity of total RNA was also determined by running the samples on 1.2% agarose gel. Aliquots of RNA were stored at -80 C for use in cdna synthesis. cdna synthesis The prime RT premix (2X) kit purchased from Genetbio Inc. was used for synthesizing single strand cdna. Briefly, cdna was synthesized in a volume of 20 µl with reaction mixture containing approximately 0.5 µl of total RNA (equivalent to10 pg), 0.2 µl of random hexamer and 9.3 µl of DEPC water. The mixture was incubated at 70 C for 5 min, added with 10 µl of 2x RT premix and mixed gently by pipetting up and down. This reaction tube was incubated at 37 C for 60 min. The reaction was stopped by giving a heat shock at 70 C for 10 min. The tube was chilled on ice for 30 min. It was then briefly centrifuged and stored at 20 C. Primer designing, specificity verification and selection of housekeeping gene Arcelin cdna sequence of Lablab purpureus submitted to NCBI from our earlier work was retrieved (GenBank Accession No DQ ) for designing of arcelin primers specifically for real time RT-qPCR. Primer sequences were designed using Primer Express-3 software provided by Applied Biosystems, USA. A set of primer sequences was designed (Forward: ACTGGGTTCTCCGTTGTGTGTA and Reverse: CAATGCCACCGTCTCATTCA), got commercially synthesized (Eurofins MWG Operon, Germany), and used for real time RT-qPCR. To optimize polymerization efficiency with reduced impact of RNA integrity on gene expression in RT-qPCR, primers with C Tm, bp length and 45 55% GC content were selected. Amplicon lengths were optimized to bp on relative quantification of gene expression. Specificity of the amplified product of primer pair was verified by the presence of a single peak in melting curve analysis which were performed at the end of PCR run, and the presence of a single band of the expected size using agarose gel electrophoresis 11. For housekeeping genes, the 18S rrna was used as a suitable internal control for analyzing the arcelin gene expression in various pulse varieties by real time RT-qPCR. Real time RT-qPCR with SYBR green PCR reactions were carried out in a StepOne TM Real Time PCR Systems (Applied Biosystems, USA). SYBR Green was used to quantify dsdna synthesis with PCR reaction volume, 10 µl with 1 µl of diluted cdna, 0.3 µm of each primer containing SYBR Green master mix. Thermal cycling conditions were set as an initial polymerase activation step for 10 min at 95 C, followed by 40 cycles of 15 s at 94 C for template denaturation, and 1 min at 60 C for annealing and extension. Afterwards, for melting curve analysis, a dissociation protocol with a gradient from C was used for each primer pair to verify the specificity of the RT-qPCR reaction and the absence of primer dimer. A housekeeping gene (i.e., 18S rrna) was used as internal control for the normalization of real-time RT-PCR. In addition, each PCR reaction included a negative control containing SYBR Green master mix and primers without template cdna to detect possible reagent contamination. All samples were amplified in triplicates and the mean values were used for RT-PCR analysis. Relative quantification and data analysis The relative quantity of arcelin gene expression was calculated for each of the samples using a mathematical model described earlier 12. Results The insect feeding bioassay with the selected wild pulse varieties viz. L. purpureus, C. virosa, V. umbellata (red), V. umbellata (yellow), Phaseolus sp., and M. pruriens revealed their resistant nature towards infestation of the stored product pest, Callosobruchus maculatus. However, seeds of V. aconitifolia registered a significant damage of 44% while in V. umbellata (yellow) it was insignificant with 0.18% damage (Table 1). Table 1 Screening of selected wild pulses against the infestation of stored product insect pest, Callosobruchus maculates [Values are mean ± SD of five replicates] Wild Pulse Period of study (days) Adult emergence (%) Seed damage (%) Lablab purpureus 23 Nil Nil Canavalia virosa 23 Nil Nil Vigna umbellata (red) 23 Nil Nil Vigna umbellata (yellow) 23 Nil 0.18 ± 0.03 NS Vigna aconitifolia ± ± 2.1 S Phaseolus sp. 23 Nil Nil Mucuna pruriens 23 Nil Nil S, significant at 5%; NS, non-significant

4 1198 INDIAN J EXP BIOL, DECEMBER 2014 Screening of the above varieties for the antimetabolic protein, arcelin gene expression confirmed the suitability of primers sequences with a single peak in melt curve analysis and a product of 90 bp in 2% agarose gel (Fig. 2). It also indicated that there were no primer-dimers and other non-specific amplification products. The melting temperature (Tm) for the amplified product of double stranded arcelin DNA product was 74 C while it was 85 C for 18S rrna (internal control). Additionally, no RT-qPCR detection signals were collected on reactions without template i.e., negative control. Further, the amplicon size of these primers was 90 bp for arcelin gene and 150 bp for internal control (Fig. 2). Table 2 details the mean threshold cycle (Ct) value. The mean Ct values of 18S rrna in reference sample (Lablab purpureus) and other pulse varieties ranged from to while, mean Ct value of arcelin cdna in different wild seed varieties measured a range of The wild seed variety Canavalia virosa recorded a high level of arcelin gene expression with the threshold fluorescence of cycles compared to the other varieties. Calculated relative quantity (RQ) or fold change in arcelin gene expression for the seven wild pulses are also provided in Table 2. The arcelin gene expression explicitly differed among the studied varieties with 8.95 fold increase in Canavalia virosa and a mere 0.37 fold in Mucuna puriens over the reference variety Lablab purpureus (its cdna was used for designing real time RT-qPCR primers). The susceptible variety Vigna aconitifolia reported significantly higher quantity than the two resistant varieties Mucuna puriens and Phaseolus sp. Discussion The antimetabolic protein arcelin is known to play a possible role in resistance against stored product insect pests. Earlier researchers have demonstrated such resistance in wild Phaseolus vulgaris against the Mexican bean weevil, Zabrotes subfasciatus This discovery has further lead to identification of different arcelin types and come up with arcelin allelic series 8. Transferring three of such arcelin allelic variants to cultivated varieties was successful through backcross techniques. Studies on dosage response using purified arcelin isolated from the seeds of P. vulgaris and Lablab purpureus collected from their natural condition in artificial diet have demonstrated the correlation between arcelin concentration and resistance to infestation by Zabrotes subfasciatus and Callosobruchus maculatus Therefore, it was understood that if dosage response relationships are obtained for any of these arcelin types, it may be possible to increase levels of resistance by selective breeding 17. Table 2 Threshold cycle (Ct) value and relative quantification (RQ) of arcelin and 18S rrna gene expression in selected wild pulses Wild Pulse Ct (Mean) Ct (SD) RQ Target (18S rrna) # Lablab purpureus (brown)* Canavalia virosa Vigna umbellata (red) Vigna umbellata (yellow) Vigna aconitifolia Mucuna pruriens Phaseolus sp Target (Arcelin) Lablab purpureus (brown)* Canavalia virosa Vigna umbellate (red) Vigna umbellata (yellow) Vigna aconitifolia Mucuna pruriens Phaseolus sp # Endogenous control; *Reference sample Fig. 2 Agarose gel electrophoretic analysis of real time RT-PCR amplification product for arcelin (target) and 18S rrna (endogenous control) genes. [Lane 1: Molecular weight marker (100 bp); Lane 2: Negative control; Lanes 3-16: Amplified products of target and endogenous control from the cdnas of L. purpureus (lanes 3 & 4), C. virosa (lanes 5 & 6), V. umbellata-red (lanes 7 & 8), V. umbellatayellow (lanes 9 & 10), V. aconitifolia (lanes 11 & 12), M. puriens (lanes 13 & 14) and Phaseolus sp. (lanes 15 & 16)].

5 SAKTHIVELKUMAR et al.: RT-qPCR ANALYSIS ON ARCELIN GENE EXPRESSION IN INDIAN WILD PULSES 1199 Here, using real time RT-qPCR, we have demonstrated that the arcelin primers designed from the arcelin mrna sequence of Lablab purpureus (retrieved from GenBank) are suitable for analysis of gene expression for seven wild pulse varieties such as Lablab purpureus-brown, Canavalia virosa, Vigna umbellata-red, V. umbellata-yellow, V. aconitifolia, Mucuna puriens and Phaseolus sp. Selection of reference genes or housekeeping genes is important for quantifying gene expression. Reference genes are required to be expressed at a constant level throughout the life of the plant, and not influenced by experimental conditions 19,20. Therefore, it is necessary to validate expression stability of selected reference genes under specific conditions. In this study three different housekeeping genes such as β-actin, GAPDH and 18S rrna were tested for validation, of which the 18S rrna was found suitable and proved better for amplification in the same PCR conditions with arcelin primers. Interestingly, the gene expression results confirm the presence of significantly higher level of arcelin gene expression in C. virosa compared to the seeds of reference variety, Lablab purpureus, used by us in our earlier studies 18,19. Hence, this study concludes that the seeds of C. virosa can be used for breeding or gene hunting for improving bruchid insect resistance in cultivars. In addition, the allelic variation in arcelin genes should also be considered 8 while selecting genes for developing insect resistance in cultivars and also the influence of quantity (copy numbers) of arcelin gene expression. Higher level of arcelin gene expression in the insect susceptible variety Vigna aconitifolia compared to other resistant varieties in our results further supports this view. Such susceptibility in a seed variety with significant levels of arcelin gene expression could be due to unfavourable arcelin allelic variant towards bruchid beetle infestation. Nevertheless, the involvement of resistant factors other than arcelin in conferring resistance should also be not ruled out. Acknowledgement The first author SS acknowledges the UGC, New Delhi for providing Rajiv Gandhi National Fellowship [F.14-2(SC)/2010(SA-III)] and the corresponding author SJ, the support received from UGC-Special Assistance Programme, Department of Zoology, University of Madras, India. References 1 Obeng-Oferi D, The use of botanicals by resource poor farmers in Africa and Asia for the protection of stored agricultural products, Stewart Postharvest Review, 3 (2007) 1. 2 Gatehouse A M R & Gatehouse J A, Identifying proteins with insecticidal activity: Use of encoding genes to produce insect-resistant transgenic crops, Pesticide Sci, 52 (1998) Dugravot S, Sanon A, Thibout E & Huignard J, Susceptibility of Callosobruchus maculatus (Coleopteran: Bruchidae) and its parasitoid Dinarmus basalis (Hymenoptera: Pteromalidae) to sulphur containing compounds: Consequences on biological control, Environ Entomol, 31 (2002) Johnson J A & Valero K A, Use of commercial freezers to control cowpea weevil Callosobruchus maculatus (Coleopteran: Bruchidae), in organic garbanzo beans, J Econ Entomol, 96 (2003) Aronson A I, Bacillus thuringiensis and its use as a biological insecticide, in Plant Breeding Reviews, edited by J Janick (Wiley, New York, USA) 1994, Osborn T C, Alexander D C, Sun S S, Cardona C & Bliss F A, Insecticidal activity and lectin homology of arcelin seed protein, Science, 240 (1988a) Osborn T C, Burow M & Bliss F A, Purification and characterization of arcelin seed protein from common bean, Plant Physiol, 86 (1988b) Zaugg I, Magni C, Panzeri D, Daminati M G, Bollini R, Benrey B, Bacher S & Sparvoli F, QUES, a new Phaseolus vulgaris genotype resistant to common bean weevils, contains the Arcelin-8 allele coding for new lectin-related variants, Theor Appl Genet, 126 (2013) Blair W M, Prieto S, Díaz M L, Buendía H F & Cardona C, Linkage disequilibrium at the APA insecticidal seed protein locus of common bean (Phaseolus vulgaris L.), BMC Plant Biol, 10 (2010) Kusolwa P M & Myers J R, Peptide sequences from seed storage proteins of tepary bean (Phaseolus acutifolius) accession G40199 demonstrate the presence of multiple variants of APA proteins, International J Biotech Biochem, 1 (2012) Sambrook J, & Russel D W, Molecular Cloning: a Laboratory Manual, (New York: Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, USA) chapter 5, Gel electrophoresis of DNA and Pulse field agarose gel electrophoresis, (1989) p Pfaffl M W, A new mathematical model for relative quantification in real-time RT PCR, Nucl Acid Res, 29 (2001) e Schoonhoven A, Cardona C & Valor J, Resistance to the bean weevil and the Mexican bean weevil (Coleoptera: Bruchidae) in noncultivated common bean accessions, J Econ Entomol, 76 (1983) Romero-Andreas J, Yandell B S & Bliss F A, Bean arcelin-1, Inheritance of a novel seed protein of Phaseolus vulgaris L. and its effect on seed composition, Theor Appl Genet, 72 (1986) Osborn R C, Blake T, Gepts P & Bliss F A, Bean arcelin-2, Genetic variation, inheritance and linkage relationships of a novel seed protein of Phaseolus vulgaris L, Theor Appl Genet, 71 (1986) 847.

6 1200 INDIAN J EXP BIOL, DECEMBER Harmsen R, Bliss F A, Cardona C, Posso, C E & Osborn T C, Transferring genes for arcelin protein from wild to cultivated beans: implications for bruchids resistance, Annual Report Bean Improvement Cooperative 31 (1987) Janarthanan S, Morgan T M, Suresh P, Oppert B & Radke G, Arcelins from an Indian wild pulse, Lablab purpureus, and insecticidal activity in storage pests, J Agri Food Chem, 56 (2008) Janarthanan S, Sakthivelkumar S, Veeramani V, Radhika D & Subbaratnam M, A new variant of antimetabolic protein, arcelin from an Indian bean, Lablab purpureus (Linn.) and its effect on the stored product pest, Callosobruchus maculatus, Food Chem, 135 (2012) Tatsumi K, Ohashi K, Taminishi S, Okano T, Yoshioka A & Shima M, Reference gene selection for real-time RT-PCR in regenerating mouse livers, Biochem Biophys Res Commun, 374 (2008) Tong Z, Gao Z, Wang F, Zhou J & Zhang Z, Selection of reliable reference genes for gene expression studies in peach using real-time PCR, BMC Mol Biol, 10 (2009) 1.