Genetic Diversity of Grape Phylloxera Leaf Galling Populations on Vitis species in Uruguay

AJEV Papers in Press. Published online October 1, 2014. 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 Research Article Genetic Diversity of Grape Phylloxera Leaf Galling Populations on Vitis species in Uruguay Leticia V. Bao, 1 Iris B. Scatoni, 1 Carina Gaggero, 2 Lucía Gutiérrez, 3 Jorge Monza, 4 and M. Andrew Walker 5 * 1 Departamento de Protección Vegetal, Entomología, Facultad de Agronomía, Universidad de la República, Uruguay; 2 Departamento de Biología Molecular, Instituto de Investigaciones Biológicas Clemente Estable (IIBCE), Uruguay; 3 Departamento de Biometría, Estadística y Computación, Facultad de Agronomía, Universidad de la República, Uruguay; 4 Departamento de Biología Vegetal, Sección Bioquímica, Facultad de Agronomía, Universidad de la República, Uruguay; and 5 Department of Viticulture and Enology, University of California, Davis. *Corresponding author (awalker@ucdavis.edu) Acknowledgments: The authors gratefully acknowledge INAVI and CSIC for financial support: CSIC SP Manejo de plagas de la Viña, and the INIA Las Brujas, vine growers and nurseries for permission to sample from their vines. We also thank Valeria Vidart and Valentina Mujica who kindly provided the samples from Canelones and Florida. Manuscript submitted Feb 2014, revised Aug 2014, accepted Sept 2014 Copyright 2014 by the American Society for Enology and Viticulture. All rights reserved. Abstract: Grape phylloxera (Daktulosphaira vitifoliae) feeds exclusively on Vitis species preferentially on leaves of American Vitis species and roots of European V. vinifera. Recently, extensive feeding and galling on V. vinifera leaves has been observed in Italy, Brazil and Peru. In Uruguay D. vitifoliae infestations on V. vinifera leaves were recently detected in very high densities. The cause of this unexpected insect behavior is unknown, but could be due to selection pressure for more aggressive native strains in the new context of vigorous plants replacing old vineyards, loss of resistance in plants from improvement programs, or importation of exotic strains. The aims of this research were to evaluate genetic diversity of leaf galling populations of Uruguayan phylloxera; estimate genetic distances among them, and compare Uruguayan and foreign phylloxera populations (Brazilian, Peruvian and European). Genetic distances between root and leaf samples from the same plant individual were also estimated. Four polymorphic microsatellite primers were used. In the analysis of leaf and root insect populations from the 1

32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 same plant individuals, different insect genotypes were found on grafted vines, with one genotype on the rootstock and one on the V. vinifera (cultivar scion). For Uruguayan leaf galling insect populations the average number of alleles per locus was 4.25. Genetic variance found among individuals within populations was 88% (SE=2,298, p< 0,001), and 12% between populations (SE=0,319, p< 0,001). An F ST of 0.211(p<0.001) suggests limited genetic flow among populations. Significant deviation from Hardy Weinberg equilibrium detected for the loci analyzed and negative F IS values suggest that parthenogenesis could be the reproductive mode. Genetic diversity found in this work shows a considerable potential for host adaptation to environmental variability. Key words: Daktulosphaira vitifoliae, Phylloxeridae, parthenogenesis, gene flow, microsatellite markers Introduction Grape phylloxera, Daktulosphaira vitifoliae (Homoptera: Phylloxeridae) is a tiny insect (1.5 mm long) first described by Asa Fitch in 1854 on North American Vitis species. It has been considered one of the world s most important vineyard pests for over 100 years after it spread to Europe and began to feed on roots on the highly susceptible European grapevine (V. vinifera). The insect spread rapidly and soon destroyed the majority of European vineyards (Granett et al. 2001). By the end of the 19 th Century grape phylloxera had arrived in Brazil, Argentina and Peru (Botton and Walker 2009, Gironés de Sanchez 2007, Huertas 2004). It was found in Uruguay on Vitis vinifera plants coming from Europe in 1888(Alvarez 1909). The current distribution of the pest includes almost all viticulture regions of the world with the exception of Chile and part of Australia. In South America grape phylloxera is found in Venezuela, Colombia, Bolivia, Peru, Argentina, Brazil and Uruguay (CABI 2013). When it was realized that roots of American Vitis species were not severely damaged by phylloxera feeding, breeders began to use these resistant species to create rootstocks. Because 2

57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 these rootstocks have proven to be durably resistant, research support for studies on the biology, ecology, and control of this important pest have diminished (Granett et al. 2001). Grape phylloxera feeding induces galls on roots and leaves. Leaf galls are pocket-like cavities surrounded by trichomes, in which the insect feeds and lays eggs. Leaf galls are commonly seen on American Vitis species leaves, but are less common on V. vinifera leaves. Root galls on the tips of feeder roots (nodosities) occur on European and American Vitis species. Galls can also form on mature storage roots (tuberosities), but these galls normally only occur on the roots of V. vinifera, or hybrids with V. vinifera (Galet, 1982). When tuberosity galls swell and crack, root- rotting pathogens enter and damage large portions of the roots, and eventually result in vine death (Granett et al. 2001). The phylloxera life cycle is complex and not well understood; it includes sexual and asexual, winged and wingless reproductive forms. In spring and summer under favorable conditions successive generations of wingless parthenogenetic individuals occur in root and leaves. The winged individuals appear under certain conditions, generally from midsummer to autumn, they can asexually produce males and females that mate and originate overwintering eggs. The eggs hatch in spring and when the first instars mature they recommence asexual parthenogenetic reproduction cycle. In regions where parthenogenetic reproduction predominates and sexual forms are rare or absent, phylloxera overwinter as first instars on the roots (Granett et al. 2001, Powell et al. 2013). In the southwestern United States Downie and Granett (1998) documented a variation in the life cycle where only the leaf galling portion of the life cycle exists on V. arizonica and winged forms were not found. In Europe, winged forms have been found in vineyards and sexual individuals have been observed in laboratory situations, but the completion of the sexual cycle in the vineyard has not been confirmed (Forneck et al. 2001). Sexual and asexual grape phylloxera lifecycles are completed on roots and leaf galls from the same plant (Vorwerk and Forneck 2007). Feeding by female asexual crawlers (first instars) 3

82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 initiates galls on the leaves and phylloxera soon begin producing eggs by apomictic parthenogenesis. All offspring are genetically identical except for changes caused by mutations, chromosomal rearrangements, and rare mitotic recombination events (Hales et al.2002). Worldwide, the predominant form of reproduction occurs through parthenogenesis (Corrie et al. 2002, Granett et al. 2001). However, population genetics data strongly suggest that rare sexual events do occur (Forneck et al. 2001, Islam et al. 2013, Vorwerk and Forneck 2007). In Uruguay, the winged sexual form has been detected only in laboratory conditions, and all reproduction seems to be parthenogenetic (Scatoni et al 1981). Leaf galling of V. vinifera is normally absent, but limited amounts of leaf galling have been observed in Italy, France, New York, and Hungary (Granett et al. 2001, Molnar et al.2009), Austria (Könnecke et al. 2011) and more recently in Panama (Quirós et al.2009). Daktulosphaira vitifoliae infestations on V. vinifera leaves have been detected in Italy (Crovetti and Rossi, 1987), Brazil (Botton and Walker 2009), Germany (Kopff 2000) and Peru (Walker personal communication). Although gall formation on V. vinifera leaves in Uruguay was rare, new plantations have recently suffered D. vitifoliae leaf infestations in very high densities and at many locations (Vidart et al. 2013). Uruguayan vineyards are primarily planted with certified high-quality stock because of the Vineyard Recovery Plan (VRP), which made it possible to remove old vineyards and replant them with certified grapevines imported from European nurseries. This program has replanted more than 1,700 hectares (21% of total area) in Uruguay (Macagno 2006). The unexpected presence of high densities of leaf galls on V. vinifera in Uruguayan vineyards could be explained by three phenomena: a) selection pressure for more aggressive native strains in the new context of more vigorous and healthy plants replacing old vineyards (Kimberling et al. 1990); b) loss of resistance in plants from plant improvement programs, which may have altered their polyphenol composition or other innate resistance mechanism; or c) importation of exotic 4

107 108 109 110 111 112 113 114 115 116 117 118 119 120 121 122 123 124 125 126 127 128 129 130 strains from other countries (Granett et al.1996). A first step in determining which of these phenomena may be responsible for leaf galling would be a thorough evaluation of phylloxera s genetic diversity. The aims of this research were to evaluate the genetic diversity of leaf galling populations of Uruguayan phylloxera (gallicole form); estimate genetic distances among these populations; and compare Uruguayan and foreign phylloxera populations (Brazilian, Peruvian and European) by estimating Nei s genetic distances. A descriptive genetic analysis comparing populations of leaf and root galling forms from the same individual plant in Uruguay was also performed. Sample collection Materials and Methods Phylloxera samples were collected across Uruguay from all vineyards and nurseries in which leaf galling on V. vinifera was detected. The Uruguayan regions of: Durazno (Du), Florida (Fl), Canelones (Ca), Colonia (Co), San José (Sj) and Montevideo (Mv) were sampled between February 2005 and March 2006 (growing season) (Figure 1, Table 1). Each vineyard or nursery was considered to be a sample site, and each site was managed in a homogenous manner. At each site leaves were selected randomly. Individual galls on a leaf were chosen making sure that they could be individually distinguished from other galls on the same leave. Eggs coming from a unique gall were removed with a brush to ensure that all offspring from a single plant originated from a single female. Eggs were stored at -20 C until processed. Foreign leaf gall samples were obtained from Brazil (BR, provided by Marcos Botton: EMBRAPA, CNPUV), Peru (PE, provided by Juan Carlos Brignardello, VITICOLA S.A.), and Europe (EU, provided by Walker s laboratory). Roots were sampled for phylloxera at all sites where leaf galls were collected, but it was difficult to obtain enough eggs from root galls to allow analysis. Root gall samples from Canelones (n=4), 5

131 132 133 134 135 136 137 138 139 140 141 142 143 144 145 146 147 148 149 150 151 152 153 154 155 Florida (n=2) and Durazno (n=2) were successfully collected from plants that were also sampled for leaf gall phylloxera (Table 1). Due to the small number of root samples only a descriptive analysis was performed to compare root and leaf phylloxera from the same plants. Leaf and root samples were processed following the same methodology. Microsatellite analysis Eggs were ground in 1µL of ultrapure water per egg. The mix was centrifuged at 6000 x g for 1 min. Primers DVIT1, DVIT2, DVSSR3 and DVSSR4 (Table 1) were tested in 20 µlpcr reactions containing 2µL of the egg mixture, 1.5mM MgCl 2, 0.2mM dntp, 0.2U Taq DNA polymerase, 1X reaction buffer and 0.5µM of the SSR primers. DVIT1 and DVIT2 primers were included because at the beginning of the research DVSSR7, DVSSR9, DVSSR16 and DVSSR17 resulted in monomorphic allelic profiles for the populations analyzed. PCR reactions were conducted in a Px2 thermal cycler (Electron Corporation, California, USA). The following temperature profiles were used: denaturation at 94 o C for five minutes, followed by 40 cycles of 94 o C 45 s, 58 o C 30 s, 72 o C, and a final extension at72 o C for ten minutes. Annealing temperatures were 58 o C for DVSSR 3 and DVSSR4, 55 o C for DVIT1 and 52 o C for DVIT2.DVIT1 and DVIT2 were altered with Primer3 software to improve annealing temperatures (Table 2). PCR products were mixed with sample-loading dye (10 mm NaOH, 95% formamide, 0.05% bromophenol blue, and 0.05% xylene cyanol) at a 2:1 ratio. A 4µL aliquot of this mixture was resolved on a 5% polyacrylamide, 7M urea sequencing gel. Gels were run at a constant 55W, 1650 V for 35 min to 2 hr depending on amplicon size. A 10bp molecular size marker (Invitrogen, California, USA) was included in every run. Silver staining (Promega Biosciences, Madison, USA) was used to visualize gels and record polymorphisms among samples. Genetic analysis Characterization of grape phylloxera populations was conducted with primers DVSSR3, DVSSR4 (Lin et al. 2006), DVIT1 and DVIT2 (Corrie et al. 2002). Allele sizes at each locus 6

156 157 158 159 160 161 162 163 164 165 166 167 168 169 170 171 172 173 174 175 176 177 178 179 were assigned using the data obtained from the polyacrylamide gels considering existing alleles for each primer amplification product (available at NCBI http://www.ncbi.nlm.nih.gov/nucleotide/?term=daktulosphaira+vitifoliae). Analysis of molecular variance (AMOVA), principal coordinates analysis (PCoA), allele frequencies, number of alleles per locus, observed heterozygosity (Ho), expected heterozygosity (He), and deviations from Hardy Weinberg Equilibrium were estimated using GenAlex V6 (Peakall and Smouse 2006).A dendrogram was constructed with GDAsoftware (Genetic Distance Analysis by Lewis and Zaykin 2002)using Nei s genetic distance and coancestry identity coefficients. Results were presented as graphical clusters using TreeView 1.6.6 (Page 1996).In order to test for significant isolation by distance, a Mantel Test was carried out between genotypic distance matrix (Nei`s distance) and geographic distance (km) matrix. This test was also performed using the GenAlex V6. Polymorphism in Uruguayan populations Results The four primers used in our study were polymorphic. The average number of alleles per locus was 4.25 ranging from 3 to 7 alleles per locus (Table 3). For DVSSR3 the predominant allele size was 240bp (allelic frequency 0.65), while for DVSSR4 it was 254bp (allelic frequency 0.53). For DVIT1 the predominant allele size was 180bp (allelic frequency 0.59) and for DVIT2 it was 150bp (allelic frequency 0.76). There was a significant deviation from Hardy-Weinberg Equilibrium (P<0.05) for the gallicole Uruguayan populations. For DVSSR3 the allele of 278bp was only found in two samples from Sj2. Genetic diversity in Uruguayan populations A dendrogram using Nei s genetic distances among populations shows that the samples clustered according to geographic location, except for Co3, which was genetically close to the Mv 7

180 181 182 183 184 185 186 187 188 189 190 191 192 193 194 195 196 197 198 199 200 201 202 203 population although geographically distant (Table 4, Figure 2a). Eighty-eight percent of the genetic variance was found among individuals within populations (df=56, SS=128,69, SE=2,298%, p< 0,001,F ST =0.211, P<0.001, Table 5), while 12% was found among populations (df=12, SS=47,21, SE=0,319%,p<0,001). An F ST value of 0.211 (P<0.001) suggests that gene flow is limited between populations (Table 2). The Mantel Test did not reveal a meaningful association between genetic and geographical distance (r =0.096, P=0.017). Some genotypes were restricted to certain vineyards while others were more evenly distributed. Genetic relationships among samples evaluated through UPGMA cluster analysis revealed that clustering of samples was not associated with the geographic location of the samples (Figure 2b). Additionally, there were only two clusters that grouped samples by plant host (V. vinifera or American Vitis species - rootstocks). Leaf and root populations There were differences between root and leaf populations from the same grafted plants. However, Nei s genetic distances were always smaller between root and leaf samples from the same plant than between different sample locations (Figure 3, Table 5). Genetic distance between Uruguayan, European, Peruvian and Brazilian populations Nei s genetic distances among foreign and Uruguayan populations were calculated and PCoA analysis was carried out. The Peruvian populations were the most genetically distant while European and Brazilian populations were in the same quadrant as the Co and Sj populations (Figure 4). Discussion New plantations in Uruguay have recently suffered D. vitifoliae infestations on V. vinifera leaves in very high densities and at various locations (Vidart et al. 2013). The cause of this change in insect behavior is unknown. Selection pressure for more aggressive native strains with more 8

204 205 206 207 208 209 210 211 212 213 214 215 216 217 218 219 220 221 222 223 224 225 226 227 228 vigorous plants replacing old vineyards, loss of resistance in plants during improvement programs, or importation of exotic strains from other countries could partly explain this change. This infestation was also coincidental with the Vineyard Recovery Plan (VRP), which resulted in the eradication and replanting of nearly 1,700 hectares (Macagno 2006) and required seven million grafted plants to be imported from European nurseries (INAVI, unpublished data). Microsatellite or SSR markers have been intensively used for various applications in many different species (Wang et al 2009). This molecular tool has been extensively used to study the genetic diversity of Aphidoidea insects (Islam et al 2013, Sandrock et al. 2011), and has overturned many classical predictions about patterns of genotypic diversity and heterozygosity (Wilson et al 2002). Genetic differences and structure of phylloxera populations have been studied with microsatellites in California (Lin et al. 2006, Islam et al. 2013) and Australia (Corrie et al. 2004). Microsatellite analysis was performed in this study at four loci (DVSSR3, DVSSR4, DVIT1 and DVIT2) all of which detected polymorphisms among the grape phylloxera populations. Initially eight loci were utilized but four were discarded because they produced monomorphic data for the populations analyzed. Although the results should be analyzed with caution, there are other studies that have achieved interesting results with this number of microsatellites (Corrie et al. 2002, Corrie and Hoffmann 2004). An F ST value of 0.211 suggests limited genetic flow among populations. Significant deviation from Hardy Weinberg equilibrium detected for all the loci analyzed and negative F IS values suggest that the major reproductive mode is through parthenogenesis. However, the high genotypic diversity detected and the occurrence of unique phylloxera genotypes (ex. the Sj2 population) indicates that rare sexual recombination events occur. Similar findings were detected in Australian, Californian, and European grape phylloxera populations (Corrie et al. 2002, Islam et al. 2013, Lin et al. 2006, Vorwek and Forneck 2007). 9

229 230 231 232 233 234 235 236 237 238 239 240 241 242 243 244 245 246 247 248 249 250 251 252 253 Given grape phylloxera s restricted mobility, the clustering observed in the dendrogram within geographically close populations could be explained by geographic isolation. Samples from Canelones grouped into two close clades while samples from San José and Colonia (except for Co3) grouped together. This result is in accordance to geographic distances among sample sites as Colonia and San José are relatively close viticultural regions. The Co3 population came from an old planting of the rootstock Rupestris du Lot (more than 35 years old, not replanted during VPR) and was genetically closer to the Mv population, which came from an old American hybrid vineyard that had been isolated for more than twenty years. Given geographic distance, isolation and different hosts, Co3 and Mv were expected to be more genetically distant. However cluster analysis among samples revealed high diversity within geographic locations, which was also detected with AMOVA (88% variation within populations). The high diversity observed could be explained partly by multiple plant introductions (Granett et al. 1996) capable of shaping the genetic structure of populations. Future studies should conduct genetic analysis within geographically isolated vineyards (with isolated phylloxera populations) to evaluate the impact of introduced plant material on the evolution of populations and on phylloxera s reproductive mode. PCoA analysis indicated that the Peruvian populations were the most genetically distant while European and Brazilian populations appeared to be very similar and grouped in the same quadrant as the Co and SJ populations. It was also clear that the Peruvian samples were distinct from the Uruguayan samples and there was no evidence of movement of phylloxera from Peru to Uruguay. The geographic proximity of Uruguay to Brazil coincides with the genetic similarity of the phylloxera populations. Although the flow of plants between these countries is regulated, the genetic similarity between Uruguayan and Brazilian populations, given the limited natural movement of the insect, suggests that both countries received infested plant material from the same source, or that introduction and subsequent movement to the adjacent country occurred. 10

254 255 256 257 258 259 260 261 262 263 264 265 266 267 268 269 270 271 272 273 274 275 276 277 278 The clustering of these phylloxera populations with the European populations supports an introduction from a European source. Leaf and root phylloxera populations taken from the same host plant were also compared and differences were detected in 5 of the 8 pairs of samples. These differences were found on V. vinifera grafted on American Vitis species rootstock (Ca and Fl populations). No such differences were found in un-grafted rootstock mother vines or French/American hybrids. In these the leaf and root gall phylloxera were sampled from a homogeneous single host environment, while the paired root and leaf gall samples with genetic differences were taken from grapevines with two host tissues: a V. vinifera scion for the leaf galls and an American Vitis species rootstock for the root galls. Although these observations are consistent with those reported by Corrie et al. (2003), more samples need to be studied so that these host-based associations can be better detailed and the cause or source of these differences determined. Using microsatellite DNA markers Corrie et al. (2003) detected strong associations between D. vitifoliae asexual lineages and vine host type within a vineyard. They also used excised root bioassays to show host-specific differences in life table parameters of reproductive rate and intrinsic rate of increase. A discontinuous plant host, such as a grafted vine, could favor population differentiation within the same plant. Since movement within a plant is not physically restricted, the presence of host-associated genotypes suggests that certain genotypes have an adaptive advantage, and it provides evidence of grape phylloxera host adaptation. The leaf galling form was found on all of the V. vinifera cultivars sampled in this research, with the exception of Tannat, a high tannin grape variety commonly grown in Uruguay. Further work is needed to understand the lack of leaf galling on Tannat and whether it is due to host preference or Uruguayan grape phylloxera s restricted genetic diversity. The primers employed in this study (DVSSR3, DVSSR4, DVIT1 and DVIT2) were able to differentiate the analyzed populations. Variability was observed between individuals from the 11

279 280 281 282 283 284 285 286 287 288 289 290 291 292 293 294 295 296 297 298 299 300 301 302 303 304 same population. This observation is in accordance with results obtained for grape phylloxera with RAPD (Downie, 2000) and SSR (Islam et al. 2013) markers both of which detected differences in samples that were adjacent to each other. The detection of multiple phylloxera genotypes suggests that the colonization of Uruguay s vineyards was not a single unique event, but rather that phylloxera were imported on multiple occasions. Conclusions Microsatellite analysis of gallicole grape phylloxera populations detected high genetic diversity in Uruguayan vineyards. Leaf and root samples analyzed from the same grafted plants in Canelones, Florida and Durazno, were genetically different. When the Uruguayan samples were compared to international samples, the Peruvian populations were the most genetically distant from the Uruguayan samples. Several lines of evidence suggest that parthenogenesis is the principal mode of reproduction including an F ST value of 0.211, negative F IS values, deviation from Hardy Weinberg equilibrium, and the presence of multicopy genotypes. The facts that phylloxera have a high parthenogenetic reproductive capacity, and the potential to move on planting materials, vineyard equipment, and through the air, have important implications for management strategies. These biological and cultural factors in conjunction with the recent Vineyard Recovery Plan, which has introduced imported grafted grapevines with greater vigor into places where older plants were uprooted, could have promoted the appearance and selection of host-adapted populations in Uruguay and may have increased the risk of grape phylloxera outbreaks. Literature Cited Alvarez, T. 1909. Parásitos animales. In: Viticultura General Adaptada al País. Montevideo, Dornaleche y Reyes Impresores. p.161-180. Botton, M. and M.A. Walker.2009. Grape phylloxera in Brazil. Acta Hort. 816:39-40. CABI. 2013. Viteus vitifoliae (grapevine phylloxera). In: Invasive Species Compendium. Wallingford, UK: CAB International. www.cabi.org/isc. 12

305 306 307 308 309 310 311 312 313 314 315 316 317 318 319 320 321 322 323 324 325 326 327 328 329 330 331 332 Corrie, A.M., R. Crozier, R. Van Heeswijck and A.A. Hoffmann. 2002. Clonal reproduction and population genetic structure of grape phylloxera, Daktulosphaira vitifoliae, in Australia. Heredity 88:203-211. Corrie, A.M. and A.A. Hoffmann. 2004. Fine scale genetic structure of grape phylloxera from the roots and leaves of Vitis. Heredity 92:118-27. Corrie, A.M., R. Van Heeswijck and A.A. Hoffmann. 2003. Evidence for host-associated clones of grape phylloxera, Daktulosphaira vitifoliae (Hemiptera: Phylloxeridae) in Austral.Bull. Entomol. Res.93:193-201. Crovetti, A. and E. Rossi. 1989. Field and laboratory observations on some eco-ethological aspects of the grape phylloxera (Viteus vitifoliae (FITCH)). In: Cavalloro, E. (Ed.): Influence of Environmental Factors on the Control of Grape Pests, Diseases and Weeds. Proc. Meeting Experts Group, Thessaloniki, Greece 6-8 October 1987 pp. 107-114. A.A. Balkema, Rotterdam. Downie, D.A. 2000. Patterns of genetic variation in native grape phylloxera on two sympatric host species. Molec. Ecol. 9:505-514. Downie, D.A. and J. Granett. 1998. A life cycle variation in grape phylloxera Daktulosphaira vitifoliae (Fitch). Southwest. Entomol. 23:11-16. Forneck, A., M.A. Walker and R. Blaich. 2001. An in vitro assessment of phylloxera (Daktulosphaira vitifoliae Fitch) life cycle. J. Appl. Entomol.125:443-447. Galet, P. 1982. Les maladies et les parasites de la vigne. Tome II Les parasites animaux. Paysan du Midi Montpellier pp.1059-1312. Gironés de Sánchez, I. 2007. Filoxera en los viñedos argentinos de San Juan. Reseña de una crisis olvidada en la década de 1930. Rev. Universum 22: 186-206. Granett, J., B. Bisabri-Ershadi and J. Carey. 1983.Life tables of phylloxera on resistant and susceptible grape rootstocks. Entomol. Exp. Appl. 34:13-19. Granett, J., M.A. Walker, J. De Benedictis, G. Fong, H. Lin and E. Weber. 1996. California grape phylloxera more variable than expected. Calif. Agric.50:9-13. Granett, J., M.A. Walker, L. Kocsis and A.D. Omer. 2001. Biology and management of grape phylloxera. Ann. Rev. Entomol. 26:387-412. 13

333 334 335 336 337 338 339 340 341 342 343 344 345 346 347 348 349 350 351 352 353 354 355 356 357 358 359 360 361 Hales, D.H., A.C.C. Wilson, M.A. Sloane, J.C. Simon, J.F. Le Gallc and P. Sunnucks. 2002. Lack of detectable genetic recombination on the X chromosome during parthenogenetic production of female and male aphids. Gene. Res. 79:205-209. Huertas Vallejos, L. 2004. Historia de la producción de vinos y piscos in el Perú. Rev. Universum 19: 44-61. Islam, M.S., T. Roush, M.A. Walker, J. Granett and H. Lin. 2013. Reproductive mode and fine-scale population structure of grape phylloxera (Daktulosphaira vitifoliae) in a viticultural area in California. BMC Genet. 14:123 Kimberling, D.N., E.R. Scott and P.W. Price. 1990. Testing a new hypothesis: plant vigor and phylloxera distribution on wild grape in Arizona. Oecologia 84:1-8. Könnecke T., C. Aigner, S. Specht, N.C. Lawo and A. Forneck. 2011. A stepwise assessment of Daktulosphaira vitifoliae infested grapevines in a Viennese vineyard site. Acta Hort. 904:59-62 Kopf, A., 2000. Untersuchungen zur Abundanz der Reblaus (Dactylosphaera vitifolii Shimer) und zur Nodositätenbildung in Abhängigkeit von Umweltfaktoren. Ph.D. Thesis, University of Hohenheim, Germany. Lewis, P.O. and D. Zaykin. 2002. Genetic Data Analysis: Computer program for the analysis of allelic data. Version 1.0 (d16c). http://lewis.eeb.uconn.edu/lewishome/software.html. Lin, H., M.A. Walker, R. Hu, R. and J. Granett. 2006. New simple sequence repeat loci for the study of grape phylloxera (Daktulosphaira vitifoliae) genetics and host adaptation. Amer. J. Enol. Viticult. 57:33-40. Macagno L.F. 2006. Reconversion and development program of the farm; final project report (online). IDB, Montevideo, p 30, Available in http://idbdocs. iadb.org/wsdocs/getdocument.aspx?docnum=837262. Accessed June 2014. Molnár, J.G., C.S. Neméth, J. Máyer, and G.G. Jahnke. 2009. Assessment of leaf-galling incidence on European grapevines in Badascony, Hungary. Acta Hort. 816, 97 104. Page, R.D.M. 1996. TREEVIEW: An application to display phylogenetic trees on personal computers. Comput. Appl. Biosci.12: 357-358. Peakall, R. and P.E. Smouse. 2006. GENALEX 6: genetic analysis in Excel. Population genetic software for teaching and research. Molec. Ecol. Notes 6:288-295. 14

362 363 364 365 366 367 368 369 370 371 372 373 374 375 376 377 378 379 380 381 Powell, K.S. P.D. Cooper and A. Forneck.2013.The biology, physiology and host plant interactions of grape phylloxera Daktulosphaira vitifoliae. Adv. Insect Physiol.45:159-218. Quirós, D.I., G. Remaudière and J.M. Nieto Nafría. 2009. Contribución al conocimiento de Aphididae y Phylloxeridae (Hemiptera: Sternorrhyncha) de Panamá. Neotrop. Entomol.38:791-800. Sandrock, C., J. Razmjou and C. Vorburger. 2011. Climate effects on life cycle variation and population genetic architecture of the black bean aphid, Aphis fabae. Mol. Ecol. 19:4165-81. Scatoni, I.B., W.R. Chiaravalle and J.H. Muzante. 1981. Filoxera de la vid Viteus vitifoliae (Fitch) (Homoptera: Phylloxeridae) en el Uruguay. Tesis Facultad de Agronomía, Montevideo, Uruguay. 48p. Vidart, M.V., M.V. Mujica, L. Bao, F. Duarte, C.M. Bentancourt, J. Franco, J. and I.B. Scatoni, I.B. 2013.Life history and assessment of grape vine phylloxera leaf galling incidence on Vitis species in Uruguay. SpringerPlus 2:181. Vorwerk, S. and A. Forneck. 2007. Genetic structure of European populations of grape phylloxera (Daktulosphaira vitifoliae Fitch) as determined by SSR-analysis. Acta Hort.733:89-95. Wang, M., Barkley, NA and T.M. Jenkins. 2009. Microsatellite Markers in Plants and Insects. Part I: Applications of Biotechnology. Genes, Genomes and Genomics Global Science Books 3(1): 1-13. Wilson A.C.C., P. Sunnucks, R.L. Blackman and D.F. Hales. 2002. Microsatellite variation in cyclically parthenogenetic populations of Myzus persicae in south-eastern Australia. Heredity 88:258-266. 15

Table 1 Description of Uruguayan grape phylloxera samples and their host plants. Collection site Host plant n l (number of galls on leaves) n r (number of galls on roots) Distance from Mv (km) Montevideo (Mv) Villard noir (Hybrid) 2-0 Canelones 1 (Ca1) 140 Rut a 2-18 Canelones 2 (Ca2) Canelones 3 (Ca3) Viognier b 4-25.4 3309C a 3-25.4 Chardonnay b 1-25.4 Chardonnay b 5 2 20.3 Viognier b 2-20.6 Cabernet Sauvignon b 1-20.6 Canelones 4 (Ca4) Moscatel b 2 2 9.7 Canelones 5 (Ca5) San José 1 (Sj1) San José 2 (Sj2) Colonia 1 (Co1) Colonia 2 (Co2) Colonia 3 (Co3) Florida (Fl) Durazno (Du) 3309C a 1-48.3 SO4 a 1-48.3 Moscatel b 2-48.7 Ugni Blanc b 1-48.7 Merlot b 1-48.7 Villard noir (Hybrid) 1-60 Syrah b 1-60 Cabernet Sauvignon b 3-57.7 Riesling b 2-57.2 Villard noir (Hybrid) 1-57.2 SO4 a 2-149 Rupestris du Lot a 1-149 SO4 a 6-169 Cabernet Sauvignon b 2-168 Rupestris du Lot a 5-208 Cabernet Sauvignon b 2-207 Cabernet Sauvignon b 1 1 70 Villard blanc (Hybrid) 1 1 69 SO4 a 3-175 101-14 a 5 1 175 P1103 a 4-175 3309C a 1 1 175 a Rootstock - b Vitis vinifera - 16

Table 2 Microsatellites employed for D. vitifoliae genetic diversity analysis and results for Uruguayan leaf-gall phylloxera populations from AMOVA, number of alleles, expected (He) and observed (Ho) heterozygosity, and fixation index (Significance was calculated by 999 permutations of the data n=69). Primer sequences shown for DVIT1 and DVIT2 correspond to that redesigned with Primer 3 software from original sequences to improve annealing temperature (see M&M). Locus Primer sequences 5'-3' Annealing temperature (ºC) Repeated motif Allele Accession number NCBI Reference n Number of alleles He Ho F IS F IT F ST DVSSR3 DVSSR4 F AGCATGTGAGGTGCAAGGC R CCTCGGGCGGAACAATCG F TGGTATTCACCTTGGAGCCTAG R GCTACTGAAACCCCTTCAACAC 58 (CA) 17 240 DQ16973 Lin et al. 2006 69 7 0.456±0.047 0.398±0.080 0.126 0.305 0.204 58 (CT) 12 253 DQ16974 Lin et al. 2006 68 4 0.504±0.045 0.719±0.097-0.427-0.211 0.151 DVIT1 F CGTTATTTTCTACCCACTCG R CGACGTGTTCTATGTGTGAG 55 (CA) 9(CG) 4 184 AY056815 Corrie et al. 2002 and this work 69 3 0.455±0.045 0.475±0.084-0.043 0.134 0.170 DVIT2 F ACAACGAACAATAGATAAACC R AGCTCGATAATAATGCTTCG 52 (CT) 14(AT) 16 179 AY056816 Corrie et al. 2002 and this work 68 3 0.272±0.068 0.261±0.083 0.042 0.345 0.317 Mean 4.25 0.422 0.463-0.076 (-0.198-0.047) 0.143 (0.016-0.270) 0.211 (0.174-0.248) 17

Table 3 Allelic frequencies per locus obtained for Uruguayan gallicole phylloxera populations. Allele size (bp) Mv n=2 Ca1 n=2 Ca2 n=8 Ca3 n=8 Ca4 n=2 Ca5 n=6 DVSSR3 Sj1 n=2 Sj2 n=6 Co1 n=3 Co2 n=7 Co3 n=2 Fl n=13 240 1.000 0.750 0.688 0.750 0.750 0.583 0.750 0.583 0.667 0.357 0.500 0.654 0.063 244 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.077 0.313 258 0.000 0.000 0.125 0.000 0.000 0.000 0.000 0.000 0.000 0.143 0.000 0.000 0.000 264 0.000 0.250 0.063 0.188 0.000 0.333 0.250 0.083 0.333 0.000 0.000 0.231 0.375 272 0.000 0.000 0.125 0.000 0.000 0.000 0.000 0.083 0.000 0.500 0.500 0.000 0.000 278 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.167 0.000 0.000 0.000 0.000 0.000 286 0.000 0.000 0.000 0.063 0.250 0.083 0.000 0.083 0.000 0.000 0.000 0.038 0.250 DVSSR4 240 0.000 0.000 0.000 0.125 0.000 0.083 0.500 0.083 0.000 0.071 0.250 0.000 0.000 246 0.000 0.000 0.125 0.063 0.000 0.000 0.000 0.083 0.000 0.071 0.000 0.000 0.000 250 0.000 0.500 0.375 0.313 0.500 0.333 0.500 0.500 0.500 0.571 0.250 0.346 0.500 254 1.000 0.500 0.500 0.500 0.500 0.583 0.000 0.333 0.500 0.286 0.500 0.654 0.500 DVIT1 180 0.500 0.000 0.063 0.250 0.250 0.083 0.000 0.083 0.333 0.286 0.250 0.115 0.063 182 0.500 0.750 0.688 0.188 0.750 0.583 1.000 0.583 0.667 0.500 0.750 0.385 0.625 184 0.000 0.250 0.250 0.563 0.000 0.333 0.000 0.333 0.000 0.214 0.000 0.500 0.313 DVIT2 148 0.000 0.250 0.000 0.250 0.000 0.417 0.000 0.167 0.000 0.000 0.000 0.000 0.063 150 1.000 0.500 0.563 0.438 0.250 0.583 1.000 0.750 1.000 0.929 1.000 0.917 0.875 152 0.000 0.250 0.438 0.313 0.750 0.000 0.000 0.083 0.000 0.071 0.000 0.083 0.063 Du n=8 18

AJEV PAPERS IN PRESS AJEV PAPERS IN PRESS Table 4 Nei s genetic distances between 13 Uruguayan gallicole phylloxera populations calculated from allelic frequencies for SSR loci DVSSR3, DVSSR4, DVIT1 and DVIT2. Mv Ca1 Ca2 Ca3 Ca4 Ca5 SJ1 SJ2 Co1 Co2 Co3 F D ***** 0.779 0.811 0.774 0.694 0.810 0.680 0.793 0.882 0.731 0.845 0.873 0.662 Mv 0.249 ***** 0.949 0.863 0.862 0.946 0.825 0.932 0.884 0.768 0.786 0.879 0.790 Ca1 0.209 0.052 ***** 0.851 0.905 0.861 0.795 0.915 0.865 0.826 0.833 0.881 0.762 Ca2 0.257 0.148 0.161 ***** 0.754 0.878 0.624 0.850 0.759 0.697 0.660 0.893 0.668 Ca3 0.366 0.148 0.100 0.282 ***** 0.718 0.665 0.762 0.736 0.646 0.667 0.689 0.613 Ca4 0.210 0.055 0.150 0.131 0.331 ***** 0.780 0.922 0.882 0.760 0.796 0.910 0.835 Ca5 0.385 0.193 0.229 0.471 0.408 0.248 ***** 0.874 0.875 0.795 0.850 0.755 0.743 SJ1 0.232 0.070 0.088 0.162 0.272 0.082 0.135 ***** 0.918 0.894 0.869 0.925 0.851 SJ2 0.125 0.123 0.145 0.276 0.306 0.126 0.133 0.086 ***** 0.872 0.897 0.909 0.851 Co1 0.313 0.264 0.191 0.362 0.437 0.274 0.229 0.112 0.137 ***** 0.928 0.831 0.806 Co2 0.168 0.240 0.183 0.415 0.405 0.229 0.163 0.140 0.109 0.074 ***** 0.824 0.776 Co3 0.136 0.129 0.126 0.114 0.372 0.095 0.281 0.078 0.096 0.185 0.193 ***** 0.859 F 0.413 0.236 0.272 0.404 0.489 0.180 0.297 0.162 0.161 0.216 0.253 0.152 ***** D 19

Table 5 Nei s genetic distances (below diagonal) and Nei s genetic Identity (above diagonal) between eight Uruguayan gallicole phylloxera samples (g), and their respective radicicole samples (r) calculated from allelic frequencies for SSR loci DVSSR3, DVSSR4, DVIT1 and DVIT2. Ca3(g) Ca3(r) Ca4(g) Ca4(r) F(g) F(r) D(g) D(r) ***** 0.825 0.564 0.564 0.776 0.756 0.624 0.685 Ca3(g) 0.192 ***** 0.487 0.487 0.867 0.903 0.759 0.764 Ca3(r) 0.572 0.719 ***** 1.000 0.609 0.651 0.584 0.568 Ca4(g) 0.572 0.719 0.000 ***** 0.609 0.651 0.584 0.568 Ca4(r) 0.254 0.142 0.496 0.496 ***** 0.980 0.792 0.866 F(g) 0.279 0.102 0.430 0.430 0.020 ***** 0.847 0.874 F(r) 0.472 0.275 0.537 0.537 0.233 0.166 ***** 0.972 D(g) 0.378 0.269 0.566 0.566 0.144 0.134 0.029 ***** D(r) 20

Figure 1 Geographic origin of Uruguayan grape phylloxera samples. Abbreviations indicate regions Ca (Canelones), Co (Colonia), Du (Durazno), Fl (Florida), Sj (San José) and Mv (Montevideo). 21

Figure 2 Dendrogram for Uruguayan gallicole phylloxera populations constructed through GDA (Genetic Distance Analysis) using Nei s genetic distances and co-ancestry identity coefficients as revealed by UPGMA clustering analysis. (A) Genetic relationship among zones and (B) among samples. Genetic relationship among grape phylloxera leaf samples from six vineyard areas in Uruguay. Different colors indicate different counties and different color tones represent different vineyards from the same county. Rootstock hosts are in italics and underlined. 22

23

Figure 3 Descriptive analysis of haplotypes found in each sample of phylloxera eggs collected from leaves (L) or roots (R) from the same plant. Each row represents a sample (Ca: Canelones, Fl: Florida, Du: Durazno) from leaf (L) or root (R), each column represents a locus, and different colors in each half-cell represent different alleles. 24

Figure 4 Principal Coordinates Analysis (PCoA) of Uruguayan phylloxera populations from Mv: Montevideo, Ca: Canelones, Sj: San José, Co: Colonia, Fl: Florida, Du: Durazno; and foreign samples from BR: Brazil, PE: Perú, EU: Europe. 25