Xanthomonas arboricola pv. juglandis

023_COST(Moreagra)_S155_COL 15-06-2012 14:24 Pagina 155 Journal of Plant Pathology (2012), 94 (1, Supplement), S1.155-S1.159 Edizioni ETS Pisa, 2012 S1.155 DETECTION AND IDENTIFICATION METHODS AND NEW TESTS AS DEVELOPED AND USED IN THE FRAMEWORK OF COST 873 FOR BACTERIA PATHOGENIC TO STONE FRUITS AND NUTS Xanthomonas arboricola pv. juglandis C. Moragrega INTEA, Institute of Food and Agricultural Technology, University of Girona. C/ Maria Aurèlia Capmany 61, 17003 Girona, Spain INTRODUCTION Xanthomonas arboricola pv. juglandis (Pierce) Vauterin et al. (1995) is the causal agent of walnut bacterial blight, the major nut and foliage disease of Persian (English) walnut (Juglans regia). The disease limits walnut production in most regions of the world. All new walnut tissues are susceptible to infection and necrosis can occur in catkins, female flowers, leaves, fruit and green shoots (Miller and Bollen, 1946). Over time, the bacterium has been classified into different genera under different names, i.e. Pseudomonas juglandis Pierce (1901); Bacterium juglandis (Pierce) Smith (1905); Phytomonas juglandis (Pierce) Bergey et al. (1930); Xanthomonas juglandis (Pierce) Dowson (1939) and Xanthomonas campestris pv. juglandis (Pierce) Dye (1978), which is officially accepted in the International standards for naming pathovars of phytopathogenic bacteria (Dye et al., 1980). Recently, however, it was re-classified by Vauterin et al. (1995) as Xanthomonas arboricola pv. juglandis (Xaj). Xaj is the causal agent of two new emerging diseases of Persian (English) walnut (J. regia) known as vertical oozing canker (VOC) (Hajri et al., 2010), and apical necrosis (Moragrega and Ozaktan, 2010; Moragrega et al., 2011). According to molecular studies based on fluorescent amplified fragment length polymorphism (F- AFLP), in France VOC is caused by a distinct genetic lineage of the bacterium which is also able to induce blight symptoms on leaves and fruits (Hajri et al., 2010). Bacterial strains isolated from apical necrosis lesions in Spain are also able to infect walnut leaves, causing typical blight lesions (Moragrega et al., 2011). HOST RANGE Among Juglans species, only J. regia is currently known as being naturally susceptible to Xaj. Most of its commercial cultivars are susceptible (Woeste et al., Corresponding author: C. Moragrega Fax: +34 972418399 E-mail: concepcio.moragrega@udg.edu 1992), as ascertained under laboratory and field conditions (Aletà et al., 2001; Moragrega et al., 2008). In the Mediterranean area, where rains are usually concentrated in early spring, late vegetating cultivars, such as Franquette, are often less susceptible to the disease than in wetter and less warm regions. DETECTION AND IDENTIFICATION Media for bacterial growth and detection. Differential and semi-selective media have been described and should be used for isolating xanthomonads from plant tissues. Media that are widely used for isolation from walnut tissues, also recommended in EPPO protocols, are YPGA (yeast peptone glucose agar) and YDC (yeast extract dextrose calcium carbonate) (Schaad, 2001). YDC is a differential medium in which xanthomonads produce large, smooth, mucoid, domed and typically yellow-pigmented colonies. Semi-selective media for differentiating Xaj colonies include modified Tween or mtween (Schaad, 2001), where the bacterium produces small, round, yellow colonies surrounded by a small milky and a large clear area (Fig. 1A) and Brilliant cresyl blue-starch or BS medium (Mulrean and Scroth, 1981; Schaad, 2001) on which colonies are small, round, pale blue, opalescent with entire margins and surrounded by an opaque zone (Mulrean and Scroth, 1981). Recently, a new selective medium based on yeast extract peptone glucose agar supplemented with 30 mg l -1 cephalexin and 100 mg l -1 cycloeximid (YPGAc) has been developed and presented under the COST Action 873 (http://www.cost873.ch/5_activites/meeting_detail.php?id=24). On YPGAc, Xaj forms yellow colonies that are clearly visible 4-5 days after incubation at 27-28ºC and grow slower than those of to other Xanthomonads. ISOLATION METHODS The following methods were adapted or developed and used under the COST Action 873 frame (see also Mulrean and Scroth, 1980; Ninot et al., 2002; Schaad et al., 2001).

023_COST(Moreagra)_S155_COL 15-06-2012 14:24 Pagina 156 S1.156 X. arboricola pv. juglandis detection and identification methods Journal of Plant Pathology (2012), 94 (1, Supplement), S1.155-S1.159 Isolation can be done from all infected organs (leaves, fruit, catkins, twigs). New infections in young tissues are preferable to old infections which can give problems due to colonization by secondary parasites and/or saprophytes (mainly fungi). Leaf, fruit and twig lesions: disinfect the entire organs or a piece thereof by immersion for 1 min in 1% solution of commercial sodium hypochlorite followed by three rinses of at least 1 min each in sterile distilled water (SDW). For fruit and twig lesions remove the epidermis until clear progressive lesions are observed in the internal tissues. Excise 3-5 mm tissue fragments at the margin of the lesions and crush in a droplet of SDW on the lid of a sterile disposable Petri dish using a sterile scalpel or razor blade. Incubate the resulting suspension for 15 min at room temperature and streak onto differential media YDC or semi-selective mtween or BS media (Schaad, 2001). Incubate agar plates at 27ºC for 4-5 days. Infected catkins and buds: homogenize 0.5 g fresh material in 5 ml SDW with a Polytron (Brinkmann Homogenizer Model PT 10/35, Brinkmann Instruments, USA) or a similar tissue grinder. Dilute the sample and plate 100 µl of the adequate dilution on differential or semi-selective media as indicated above, and incubate at 27ºC for 4-5 days. Assessment of epiphytic populations of Xanthomonas arboricola pv. juglandis from walnut organs. Detection and quantification of epiphytic bacterial levels on walnut organs has widely been used in walnut blight epidemiological studies. The methodology was standardized under the COST 873 frame and successfully adopted by research groups (http://www.cost873.ch/5_activites/meeting_detail.php?id=24) as described below. Fruit and leaf populations: place 5 g fresh tissue in flasks with 50 ml SDW with 0.001% Tween 20, and shake at 150 rpm in an orbital shaker for 1 h in the cold (4ºC) to avoid bacterial multiplication. Spread a 100 µl aliquot from selected dilutions onto the surface of mtween agar plates (BS and YPGAc media can also be used). After 4 days of incubation in the dark at 25 C, the colonies displaying characteristic color and morphology described for X. a. pv. juglandis are counted and bacterial populations are expressed as CFU per gram of fresh weight of fruit or leaf. Catkins and buds: homogenize 0.5 g fresh material in 5 ml SDW and proceed as described above for bacterial isolation from fruit and leaves. Dilute the sample and plate 100 µl of the appropriate dilution on semi-selective media described above, and incubate at 27ºC for 4-5 days. Count bacterial colonies resembling Xaj and express bacterial populations as CFU per gram of fresh weight of buds or catkins. Pollen: pollen should be collected from catkins that have completed development, at the beginning of anther dehiscence, as follows: spread catkins over filter paper and allow the anthers to dehisce overnight, then pass released pollen through a 100 µm mesh screen to remove debris. Transfer 0.10 g pollen to an Eppendorf with 1 ml SDW. Agitate intermittently the sample on a vortex mixer for 10 min. Dilute the sample and plate 100 µl of the appropriate dilutions on semi-selective media described above. Incubate at 27ºC for 5-7 days and count the CFU per gram of fresh weight. Storage of isolates/strains and control strains. Isolates obtained should be stored frozen (-80ºC) as soon as possible. For freezing, two loopfuls of bacteria collected from a fresh culture are suspended in sterile cryovials containing 1 ml sterile yeast peptone glucose broth (YPGB) supplemented with 15% glycerol. Suspensions are vortexed and incubated for 15 min at room temperature before transferring to a -80ºC in a freezer. Working cultures can be maintained on YDC or YPGA slants at 4ºC. Reference strains can be used as positive controls in the tests. The type strain isolated in 1956 by D.W. Dye from J. regia in New Zealand is frequently used. Collection accession numbers for this strain are CFBP 2528, ICMP 35, ATCC 49083, LMG 747, NCPPB 411. IDENTIFICATION METHODS Phenotypic description. Xaj is a Gram-negative aerobic rod with a single polar flagellum. As most xanthomonads, the species produces the unique yellow membrane-bound non-water soluble pigments xanthomonadins, soluble in benzene, methanol and petroleum ether (Starr et al., 1977). Xanthomonads can be readily differentiated from other yellow pigmented phytopathogenic bacteria when growing on YDC agar, since they produce mucoid, convex and yellow colonies. The genus can be clearly differentiated from other Gram-negative rods causing plant diseases on the basis of phenotypic characters as reported by Schaad (2001). Identification of xanthomonadin pigment. Xanthomonadins are useful chemotaxonomic markers for Xanthomonads. They are classified into 15 groups according to the number of bromine atoms, the absorption maxima and mass spectrometric M + value, and methylation (Chun, 2002). Absorption maxima (mµ) of xanthomonadins of Xaj are 437 and 463 on petroleum ether extracts; 454 and 481 on benzene ether extracts; and 441 on methanol ether extracts (Starr et al., 1964). Several protocols have been described for pigment extraction and identification (Lelliott and Stead, 1987). The following one is summarized from Schaad (2001): scrape the bacteria from the surface of colonies grown for 48 h on nutrient agar (NA) and add to 3 ml of spectrophotometry grade methanol in a test tube with a screw cap (suspension turbidity must be equivalent to

023_COST(Moreagra)_S155_COL 15-06-2012 14:24 Pagina 157 Journal of Plant Pathology (2012), 94 (1, Supplement), S1.155-S1.159 C. Moragrega S1.157 near 10 10 CFU/ml). Place the capped tube in water bath with boiling water until the solution becomes yellow. Centrifuge at 1,000 g for 15 min, decant supernatant and evaporate in a water bath at 50-60ºC until the optical density of the pigment extract reaches ca. 0.4 at 443 nm (it occurs when solution becomes intense yellow). Spot five 5 µl aliquots (allowing each 5 µl to dry before applying the next) on a 0.2 mm thick thin-layer chromatography sheet of silica gel 60 (Merck, Germany) and place in developing apparatus with anhydrous spectrophotometry grade methanol as solvent. Allow the solvent front to move approximately 10 cm and outline the yellow spots with a pencil when the silica gel is still wet. A yellow spot with an average Rf value of 0.45 (range of 0.42 to 0.49) is positive for xanthomonadins. Always use reference strains as positive and strains of other genera as negative controls. Biochemical tests. Phenotypic traits and biochemical test have been described for differentiating Xanthomonas from other plant pathogenic bacteria and species within the genus Xanthomonas (Schaad et al., 2001). However, no information is available on specific biochemical tests for distinguishing among pathovars of X. arboricola species. Xaj biochemical traits are: oxidase-negative, oxidative glucose metabolism, growth at 35 C, ability to hydrolyze aesculin and starch, and protein digestion test-positive. Substrate utilization kits from Biolog and API can be used for biochemichal tests. The use of a reference strain as positive control and other genera as negative controls is recommended. Serological techniques. Immunofluorescence tests using polyclonal antisera are generally specific at the species level only. Identification at the pathovar level is not possible for the juglandis pathovar, since monoclonal antibodies are only available for a reduced number of X. campestris pathovars. DNA-based techniques PCR primers are available for the identification of X. campestris at species level (XV; 5 TTCGGCAACGGCAGTGACCACC3 ) (Schaad, 2001). A specific PCR for Xaj has been developed by Gironde and Manceau (INRA Angers-Nantes, France) and presented in the COST Action 873 to be adopted as a molecular detection technique. Their specific primers Xaj F and XajR have also been succesfully used in a Bio- PCR detection method, an easy to use and rapid trechnique that permits detection of viable bacteria. A protocol for Xaj detection in plant samples by the Bio-PCR technique was presented in the COST873-EPPO Diagnostics Conference that took place at York in May 2009 (http://www.cost873.ch/5_activites/meeting_detail.php?i D=23) and in the Xanthomonas Diagnosis and Biodiversity Training Workshop held in Angers (France) in September 2009 (http://www.cost873.ch/5_activites/meeting_detail.php?id=17). Finally, a protocol for Xaj ientification in samples from symptomatic plants by Real-time PCR was developed and tested in COST873 activities. Protocols are available at http://www.cost873.ch/5_activites/training.php. Pathogenicity tests. Inoculations can be made either on healthy vigorously growing walnut potted plants of a susceptible cultivar or on detached immature walnut fruits. Inoculation on detached walnut leaves are not recommended due to the release of phenolic compounds on detached leaves during manipulations that can modify the results. Inoculation methods are exhaustively described by Schaad (2001). Inoculation of whole plants (developed by C. Moragrega, Institute of Food and Agricultural Technology and used under the COST Action 873 frame): 1 to 2- year-old potted plants of a cultivar susceptible to walnut blight should be used. Bacterial infections require young leaves, which are more susceptible than the mature and old ones. Inoculum suspensions are prepared from 4 to 5-day-old Xaj cultures grown on NA (nutrient agar) medium at 27ºC. Suspensions on SDW are adjusted to 1-5 10 8 CFU ml -1 with a spectrometer (A 600nm = 0.2) and serial dilutions are plated on YDC medium and counted for confirmation of inoculum concentration. Inoculum suspensions must be prepared on the same day of inoculation and maintained at 4ºC until use. To facilitate infection diatomaceous earth (0.2 g l -1 ) can be added to the inoculum. Bacterial suspensions are sprayed under pressure (1-2 bar) on both faces of walnut leaves until runoff. Inoculated plants are immediately covered with plastic bags which are internally sprayed with sterile water and incubated for 24-48 h at 25ºC in a climatic chamber. Then, plastic bags are removed and plants are re-introduced into the climatic chamber at 25ºC, 70-80% RH, 16 h photoperiod for 7-10 days for symptom development. Pathogenic bacterial strains produce brown spots often surrounded by a yellowish halo (Fig. 1B). Inoculation of fruits: (summarized from the protocol reported in http://www.cost873.ch/5_activites/training.php). Immature fruits aged under Gf+45 should be used. Puncture the equatorial zone of the fruit (from external face to mesocarp) with a needle impregnated with bacterial colony (from a fresh culture grown on NA). Incubate inoculated fruits in plastic boxes for 10-15 days at 25ºC and RH higher than 90% (high RH is assured if fruits are placed onto wet filter paper in the boxes) and a 16 h light photoperiod. Pathogenic strains produce progressive necrotic lesions through walnut fruit tissues. Inoculation methods for screening assays [developed and used as standard protocols under the COST Action 873 frame (C. Moragrega, 2009 posted in http:// www.cost873.ch/5_activites/training.php; see also Aletà

023_COST(Moreagra)_S155_COL 15-06-2012 14:24 Pagina 158 S1.158 X. arboricola pv. juglandis detection and identification methods Journal of Plant Pathology (2012), 94 (1, Supplement), S1.155-S1.159 Fig. 1. A. Colonies of Xanthomonas arboricola pv. juglandis growing on modified Tween medium, B. Symptoms induced by X. a. pv. juglandis infections 15 days post inoculation on leaves of potted walnut plants. et al. (2001) and Moragrega et al. (2008)]. To evaluate walnut susceptibility or resistance to bacterial blight a detached immature fruit inoculation test has been developed and widely used in cultivar susceptibility evaluation assays, assessment of strain virulence or determination of the efficacy of chemicals in walnut blight control. The method consists of artificial inoculation of bacterial suspensions on immature fruits (Gf+30) and incubation under controlled environment conditions as follows: (i) Immature fruits are collected, transported to the laboratory in cool boxes avoiding direct contact among them (lesions or blackening can occur if fruits are not carefully packed) and kept at 4ºC. Fruits can be stored for several days under these conditions before inoculation. (ii) Fruits are disinfected in a sodium hypochlorite solution (3-5 % i.a.) for 5 min followed by three rinses in sterile distilled water are placed on sterile wet filter paper into transparent plastic boxes to assure high RH during incubation and avoid fruit dehydration. A virulent strain of the bacterium must be used. (iii) Inoculate by injection a 30 µl drop of ca. 10 8 CFU ml -1 (A600 = 0.2) bacterial suspension on the equatorial zone of the fruits. Bacterial suspensions in sterile distilled water are obtained from cultures grown on NA medium at 27ºC for 3-4 days. Three inoculations are made per fruit. Bacterial suspension should be inoculated in the mesocarp (just at the end of the green tissue at the limit with the white tissue) with a syringe. It is very important to make all inoculations on the same fruit tissue (do not reach the endocarp nor the seed). (iv) Incubate inoculated fruits at 25ºC, >90% RH (high RH is assured if fruits are placed onto sterile wet filter paper into boxes) and 16 h light photoperiod, for 10-15 days at 25 C. (v) Control fruits are inoculated with sterile distilled water instead of bacteria. The number of fruits per replicate can vary according to experimental design or availability. (vi) After 10-15 days incubation (when disease progression in a susceptible cultivar is clearly observed through all walnut tissues and they become necrotic) the incidence and severity of the symptoms on inoculated fruits is determined. Each fruit is transversally cut and disease progression in the fruit is assessed. Disease incidence is determined by the presence of symptoms (necrosis surrounding the inoculation point and extending to other tissues) on each inoculation in a fruit. Disease severity is determined according to Infection Severity Indexes (I): 0, no infection; 1, necrosis located to the inoculation point; 2, necrosis extending from the inoculation point through the green tissue; 3, necrosis extending through the mesocarp and reaching the endocarp; and 4, necrosis affecting the seed. Disease severity per replicate (S) is calculated from disease severity indexes. REFERENCES Aletà N., Ninot A., Moragrega C., Llorente I., Montesinos E., 2001. Blight sensitivity of Spanish selections of Juglans regia. Acta Horticulturae 544: 353-362. Bergey s Manual of Determinative Bacteriology (1930): Phytomonas juglandis (Pierce) Bergey et al. 3rd Ed. William and Wilkins, Baltimore, MD, USA. Chun W.W.C., 2002. Xanthomonadins, unique yellow pigments of the genus Xanthomonas. The Plant Health Instructor. DOI: 10.1094/PHI-A-2000-0824-01. Dowson W.J., 1939. On the systematic position and generic names of the Gram negative bacterial pathogens. Zentralblatt für Bakteriologie und Parasitenkunde 100: 177-193.

023_COST(Moreagra)_S155_COL 15-06-2012 14:24 Pagina 159 Journal of Plant Pathology (2012), 94 (1, Supplement), S1.155-S1.159 C. Moragrega S1.159 Dye D.W., 1978., Genus Xanthomonas Dowson 1939. New Zealand Journal of Agricultural Research 21: 153-177. Dye D.W., Bradbury J.F., Goto M., Hayward A.C., Lelliott R.A., Scroth M.N., 1980. International standards for naming pathovars of phytopathogenic bacteria and a list of pathovar names and pathotypes. Review of Plant Patholology 59: 153-168. Hajri A., Meyer D., Delort F., Guillaume J., Brin C., Manceau C., 2010. Identification of a genetic lineage within Xanthomonas arboricola pv. juglandis as the causal agent of vertical oozing canker of Persian (English) walnut in France. Plant Pathology 59: 1014-1022. Lelliott R.A., Stead D.E., 1987. Methods for the Diagnosis of Bacterial Diseases of Plants.: British Society for Plant Pathology Blackwell Scientific Publications, Oxford, UK. Miller P.W., Bollen W.B., 1946. Walnut bacteriosis and its control. Oregon Agricutural. Experimental Station Technical Bulletin No. 9. Moragrega C., Llorente I., Montesinos E., Rovira M., Aletà N., 2008. Susceptibility of walnut cultivars and Spanish selections to bacterial blight (Xanthomonas arboricola pv. juglandis). Journal of Plant Pathology 90: S2.362. Moragrega C., Ozaktan H., 2010. Apical necrosis of Persian (English) walnut (Juglans regia): An update. Journal Pant Pathology 92: S167-S171. Moragrega C., Matias J., Aletà N., Montesinos E., Rovira M., 2011. Apical necrosis and premature drop of Persian (English) walnut fruit caused by Xanthomonas arboricola pv. juglandis. Plant Disease 95: 1565-1570. Mulrean E.N., Schroth M.N., 1981. A semiselective agar medium for the isolation of Xanthomonas campestris pv. juglandis from walnut buds and catkins. Phytopathology 71: 336-339. Ninot A., Aletà N., Moragrega C., Montesinos E., 2002. Evaluation of a reduced copper spraying program to control bacterial blight of walnut. Plant Disease 86: 583-587. Pierce N.B., 1901. Walnut bacteriosis. Botanical Gazette 31: 272-273. Schaad N.W, Jones J.B., Chum W., 2001. Laboratory Guide for Identification of Plant Pathogenic Bacteria. 3rd Ed. APS Press, St. Paul, MN, USA. Smith E.F., 1905. Bacterium juglandis (Pierce) E.F. Smith. In: Smith E.F. (ed.). Bacteria in Relation to Plant Diseases. Carnegie Institute, Whashington DC, USA. Starr M.P., Jenkins C.L., Bussey L.B., Andrews A.G., 1977. Chemotaxonomic significance of the xanthomonadins, novel brominated arylpolyene pigments produced by bacteria of the genus Xanthomonas. Archives of Microbiology 113: 1-9. Starr M.P., Stephens W.L., 1964. Pigmentation and taxonomy of the genus Xanthomonas. Journal of Bacteriology 87: 293-302. Vauterin L., Hoste B., Kerster K., Swings J., 1995 Reclassification of Xanthomonas. International Journal of Systematic Bacteriology 45: 472-489. Woeste K.E, McGranahan G.H., Schroth M.N., 1992. Variation among Persian walnuts in response to inoculation with Xanthomonas campestris pv. juglandis. Journal of the American Society of Horticultural Science 117: 527-531.

023_COST(Moreagra)_S155_COL 15-06-2012 14:24 Pagina 160