Diversity and dynamics of lactobacilli populations during ripening of RDO Camembert cheese

218 Diversity and dynamics of lactobacilli populations during ripening of RDO Camembert cheese Ségolène Henri-Dubernet, Nathalie Desmasures, and Micheline Guéguen Abstract: The diversity and dynamics of Lactobacillus populations in traditional raw milk Camembert cheese were monitored throughout the manufacturing process in 3 dairies. Culture-dependent analysis was carried out on isolates grown on acidified de Man Rogosa Sharpe agar and Lactobacillus anaerobic de Man Rogosa Sharpe agar supplemented with vancomycin and bromocresol green media. The isolates were identified by polymerase chain reaction temperature gradient gel electrophoresis (PCR TGGE) and (or) species-specific PCR and (or) sequencing, and Lactobacillus paracasei and Lactobacillus plantarum isolates were characterized by pulsed field gel electrophoresis (PFGE). Milk and cheese were subjected to culture-independent analysis by PCR TGGE. Presumed lactobacilli were detected by plate counts throughout the ripening process. However, molecular analysis of total DNA and DNA of isolates failed to detect Lactobacillus spp. in certain cases. The dominant species in the 3 dairies was L. paracasei. PFGE analysis revealed 21 different profiles among 39 L. paracasei isolates. Lactobacillus plantarum was the second most isolated species, but it occurred nearly exclusively in one dairy. The other species isolated were Lactobacillus parabuchneri, Lactobacillus fermentum, Lactobacillus acidophilus, Lactobacillus helveticus, alactobacillus psittaci/delbrueckii subsp. bulgaricus/gallinarum/crispatus group, Lactobacillus rhamnosus, Lactobacillus delbrueckii subsp. bulgaricus, L. delbrueckii subsp. lactis, Lactobacillus brevis, Lactobacillus kefiri, and Lactobacillus perolens. Lactobacilli diversity at the strain level was high. Dynamics varied among dairies, and each cheese exhibited a specific picture of species and strains. Key words: Lactobacillus, bacterial dynamics, TGGE, PFGE, Camembert de Normandie cheese. Résumé : La diversité et les dynamiques des lactobacilles ont été étudiées dans trois fromageries au cours de la fabrication de Camembert traditionnel au lait cru. Une analyse culture-dépendante a été réalisée àpartir d isolats, obtenus sur géloses MRS acidifiée et LAMVAB, qui ont été identifiés par PCR TGGE et (ou) PCR espèce-specifique et (ou) séquençage. Les isolats de Lactobacillus paracasei et Lactobacillus plantarum ont été caractérisés par PFGE. Les laits et fromages ont été soumis à une analyse culture-indépendante par PCR TGGE. Bien que des lactobacilles présumés aient été dénombrés tout au long de l affinage, l analyse moléculaire pratiquée en parallèle n a pas toujours permis de confirmer la présence de lactobacilles. L espèce dominante était L. paracasei, l analyse PFGE a révélé la présence de 21 profils différents parmi 39 isolats. Lactobacillus plantarum était la deuxième espèce la plus représentée globalement, bien que détectée presque exclusivement dans une seule fromagerie. Les autres espèces étaient Lactobacillus parabuchneri, Lactobacillus fermentum, Lactobacillus acidophilus, Lactobacillus helveticus, le groupe Lactobacillus psittaci/delbrueckii subsp. bulgaricus/gallinarum/ crispatus, Lactobacillus rhamnosus, Lactobacillus delbrueckii subsp. bulgaricus, L. delbrueckii subsp. lactis, Lactobacillus brevis, Lactobacillus kefiri et Lactobacillus perolens. La diversité au niveau souche des lactobacilles était importante. Les dynamiques variaient d une fromagerie à l autre, chaque fromage avait une image propre en termes d espèces et de souches. Mots-clés : Lactobacillus, dynamiques bactériennes, TGGE, PFGE, Camembert de Normandie. Introduction Complex biochemical and microbiological processes occur during the production of Registered Designation of Origin (RDO) Camembert cheese, leading to the development Received 23 July 2007. Revision received 11 December 2007. Accepted 12 December 2007. Published on the NRC Research Press Web site at cjm.nrc.ca on 7 March 2008. S. Henri-Dubernet. Fromageries BEL S.A, Département Recherche Appliquée Groupe, 7 bd de l Industrie, 41100 Vendome, France. N. Desmasures 1 and M. Guéguen. Laboratoire de Microbiologie Alimentaire E.A. 3213, IFR 146 ICORE, Université de Caen Basse-Normandie, Esplanade de la Paix, 14032 Caen CEDEX, France. 1 Corresponding author (e-mail: nathalie.desmasures@unicaen.fr). of the typical flavour. These processes are mediated in part by the starter, which is mostly composed of lactococci and sometimes leuconostocs and (or) pediococci, and by adventitious nonstarter lactic acid bacteria (NSLAB), which are not always well identified. Nonstarter lactobacilli are often one of the dominant or subdominant microbial groups found during cheese ripening and may contribute to the cheesemaking process (Beresford et al. 2001). They have been shown to be an important part of the NSLAB isolated from Camembert cheese (M. Guéguen, personal communication, 2004), but their identification is based only on phenotypic data that was done about 15 years ago. The genus Lactobacillus, which currently contains 113 species and 18 subspecies (http://www.bacterio.cict.fr, accessed on 5 July 2007), is the largest genus within the lactic acid bacteria (LAB) group and is subject to continual taxonomic changes. Lactobacilli have been examined extensively in some hard Can. J. Microbiol. 54: 218 228 (2008) doi:10.1139/w07-137

Henri-Dubernet et al. 219 cheeses, such as cheddar (Fitzsimons et al. 1999; Dasen et al. 2003), emmental (Demarigny et al. 1996), Comté (Depouilly et al. 2004), and in Italian cheeses (Randazzo et al. 2002; Lazzi et al. 2004). However except for a few studies (Ugarte et al. 2006), little is known about lactobacilli in soft ripened cheeses, especially in RDO Camembert cheese. Research on food microflora, which has relied mainly on cultivation until recently, may not always be representative of the complexity of a food ecosystem. Cultivation and phenotypic identification methods are not always able to distinguish among and to quantify lactobacilli species within a food-associated LAB community. Several techniques for the isolation, characterization, and identification of lactobacilli species have been reviewed (Coeuret et al. 2003). Among them, PCR-based methods, such as single-strand conformation polymorphism and denaturing/temperature gradient gel electrophoresis (D/TGGE) have been developed to analyse the diversity of microorganism communities and to monitor their evolution within dairy-food ecosystems (Ercolini 2004), including raw milk (Lafarge et al. 2004; Callon et al. 2007) and traditional cheeses (Randazzo et al. 2002; Ercolini et al. 2004; Duthoit et al. 2005; Dèlbes and Montel 2005). The aim of this study was to assess the diversity and dynamics of Lactobacillus populations during the production of traditional Camembert cheese (raw milk cheese). To reach this objective, we chose to use mainly TGGE. One of the innovative aspects of this work was to focus on one genus, whereas TGGE has been mainly applied to the study of global bacterial populations. Another innovative aspect was linked to the fact that this technique was applied both to the direct examination of total DNA isolated from cheese and to the analysis of DNA extracted from isolates. Materials and methods Milk and cheese samples We monitored 3 batches of raw milk Camembert cheese manufactured in the spring in 3 dairies (A, B, and C) located in Normandy, France. Samples were taken from the raw ripened milk (day 0) and during the manufacturing process (2 cheeses per analysis) at 1, 14, 30, and 60 days. They were immediately subjected to analysis. Analysis based on bacterial isolates Presumed lactobacilli counts Microorganisms were extracted from the food matrix as follows: 20 ± 0.1 g of cheese was transferred to a sterile blender and mixed with 180 ml of 2% tri-sodium acetate (Sigma Aldrich, St Quentin Fallavier, France), ph 7.0, at room temperature for 1 min at high speed. Ten-fold dilutions of the cheeses and the corresponding ripened milks were made in peptone saline solution (1 gl 1 pancreatic casein peptone and 8.5 gl 1 sodium chloride in distilled water, ph 7.0) and were then plated on acidified de Man Rogosa Sharpe agar (AMRSA) and Lactobacillus anaerobic de Man Rogosa Sharpe agar supplemented with vancomycin and bromocresol green (LAMVAB) (Hartemink et al. 1997), media on which starter and non-starter lactococci were not able to grow. Incubation was done at 37 8C under anaerobic conditions for 72 h. Identification and characterization of isolates For each batch at each sampling point, 5 isolates from AMRSA and 5 from LAMVAB media were randomly selected, giving rise to a total of 150 presumed lactobacilli. The isolates were stored at 80 8C until further analysis. All isolates were Gram stained and subjected to the catalase test using standard procedures. Genomic DNA was extracted by the phenol chloroform method (Sambrook et al. 1989) and subjected to Lactobacillus-specific PCR (Table 1). Products amplified by Lactobacillus-specific PCR were subjected to TGGE for identification to the species level. In addition, 150 isolates obtained in the same conditions during winter batches (Henri-Dubernet et al. 2004) and characterized using the same methodology were included in this study, leading to a collection of 300 isolates representing 6 batches. Species-specific PCR (Table 1) was performed for confirmation purposes for lactobacilli belonging to closely related species. Sequencing was carried out to identify or to confirm the identity of representative isolates from winter and spring batches. All Lactobacillus paracasei isolates from dairy B and all Lactobacillus plantarum isolates from dairy C were subjected to pulsed-field gel electrophoresis (PFGE) analysis. Analysis based on total DNA DNA was extracted from ripened milk by using a protocol involving cell concentration with zirconium hydroxide (Lucore et al. 2000) and by using lytic enzymes (Henri- Dubernet et al. 2004). Total DNA was extracted from 20 g of cheese, as described by Ogier et al. (2002). Samples were subjected to Lactobacillus-specific PCR TGGE. DNA amplification PCR was performed in a PTC 200 thermal cycler (MJC research, Waltham, Massachusetts, USA) using the Lactobacillus-specific primers R16.1-GC and LbLMA1-rev as described previously (Henri-Dubernet et al. 2004) (Table 1). TGGE analysis and PFGE analysis TGGE was performed as previously described (Henri- Dubernet et al. 2004) by using the Dcode system (BioRad, Ivry sur Seine, France) and 16 cm 16 cm 1 mm gels. Lactobacillus-specific PCR products were subjected to electrophoresis for 12 h at 90 V with a temperature gradient of 56 62 8C (rate of 0.5 8Ch 1 ) on gels containing 8% polyacrylamide, 7 moll 1 urea and 1 TAE buffer. PFGE was performed as described by Coeuret et al. (2004). Briefly, bacterial DNA was digested by incubating plugs for 4 h at 37 8C in 0.2 ml of 1 buffer IV containing 20 U NotI (QBIOgene, Illkirch, France). DNA electrophoresis was performed on a 1% agarose gel in 1 TBE buffer in a CHEF DR III apparatus (BioRad) with 0.5 TBE buffer. The gel was run for 18 h at 14 8C using a linear ramp of 2 25 s for L. paracasei subsp. paracasei and a linear ramp of 5 10 s for L. plantarum at 6 Vcm 1.

220 Can. J. Microbiol. Vol. 54, 2008 Table 1. Primers used in this study. Primer Sequence 5 3 Target Reference R16.1-GC* GCclamp-CTTGTACACACCGCCCGTCA 16S rrna gene Nakagawa et al. 1994; Dubernet et al. 2002 LbLMA1-rev (/R16.1-GC)* CTCAAAACTAAACAAAGTTTC 16S 23S SR lactobacilli Lac1* AGCAGTAGGGAATCTTCCA 16S rrna gene Walter et al. 2001 Lac2-GC (/Lac1)* GCclamp-ATTYCACCGCTACACATG V3f { ACTCCTACGGGAGGCAGCAG 16S rrna gene (V3 region) Coppola et al. 2001 V3r (/V3f) { GTATTACCGCGGCTGCTGG 16 { GCTGGATCACCTCCTTTC 16S rrna gene Berthier and Ehrlich 1998; Depouilly et al. 2004 Helv(/16) { CCCCAAGGTCTTTTATTTC 16S 23S SR Lactobacillus helveticus Lpapl (/16) { ATGAGGTATTCAACTTATT 16S 23S SR Lactobacillus paraplantarum Lpl(/16) { ATGAGGTATTCAACTTATG 16S 23S SR Lactobacillus plantarum Y2 { CCCACTGCTGCCTCCCGTAGGAGT 16S rrna gene Ward and Timmins 1999 Para(/Y2) { CACCGAGATTCAACATGG 16S Lactobacillus paracasei PrI { CAGACTGAAAGTCTGACGG 16S rrna gene Walter et al. 2000 RhaII (/PrI) { GCGATGCGAATTTCTATTATT 16S 23S SR Lactobacillus rhamnosus Note: All primers were obtained from Invitrogen (Cergy Pontoise, France). GCclamp: CGGCCGGGGCGCGCCCCGGGCGGCCCGGGGGCACCGGGGG. *Used for total DNA from cheese samples and DNA from isolates. { Used for DNA of isolates. Table 2. Microbial counts in samples taken at various stages during Camembert cheese production in the spring in 3 dairies (A, B, and C). Microbial counts on: Medium Dairy Day 0 Day 1 Day 14 Day 30 Day 60 AMRSA A 3.72 3.71 8.41 6.23 7.85 B 5.04 7.79 8.20 8.23 8.04 C 6.08 6.62 9.28 9.18 8.96 LAMVAB A 3.46 3.86 5.94 5.34 5.35 B 2.94 7.77 8.18 8.23 8.06 C 3.56 6.53 9.15 9.23 8.89 Note: AMRSA, acidified de Man Rogosa Sharpe agar; LAMVAB, Lactobacillus anaerobic de Man Rogosa Sharpe agar supplemented with vancomycin and bromocresol green. Data are presented as log values of colony forming units obtained per millilitre of milk (day 0) or per gram of curd and cheese (days 1 60). Images of the gels were processed using Bionumerics software version 2.0 (Applied Maths, Kortrijk, Belgium). Sequencing of the 16S rrna gene PCR products amplified with the primers V3r and V3f (Table 1) and corresponding to part of the V3 region of 16S rrna (approximately 250 bp) were sequenced by Invitrogen (Cergy Pontoise, France). Each sequence was compared to sequences available in the GenBank and the GenEmbl databases by using the BLASTN program (Altschul et al. 1997). Results Presumed lactobacilli counts in spring samples The counts in raw ripened milk (day 0) were similar on LAMVAB for the 3 dairies (Table 2), reaching about 10 3 cfuml 1, while they were higher (up to 10 6 ) and showed important variations on AMRSA. From day 1 to Table 3. Amplification by Lactobacillusspecific primers of total DNA present in cheese at different processing stages during spring batches. Ripening time A B C Day 0 Day 1 + Day 14 + + Day 30 + + Day 60 + + day 60, counts were similar on LAMVAB and AMRSA for dairies B and C, reaching 10 8 and 10 9 cfug 1, respectively. Conversely, presumptive lactobacilli counts varied strongly between AMRSA and LAMVAB in dairy A during the

Henri-Dubernet et al. 221 Fig. 1. Temperature gradient gel electrophoresis profiles of 16S 23S spacer region rdna fragments of reference strains and of cheese extracts from 2 dairies at various stages of ripening. No PCR products were obtained from dairy A, on day 0 in dairies B and C, and on day 1 in dairy B. BII, dairy B; CII, dairy C. ripening period and remained about 3 orders of magnitude lower on LAMVAB compared with the 2 other dairies. Diversity and dynamics of lactobacilli during cheese processing Confirmation of lactobacilli in spring samples Amplification by Lactobacillus-specific primers of total DNA present in cheese from dairy A never succeeded at any stage (Table 3), whereas PCR products were detected from the 14th or the 1st day of ripening for dairies B and C, respectively. With isolates (data not shown), lactobacilli were detected earlier than with total DNA. Among the isolates, the number of confirmed lactobacilli varied as a function of the dairy and the production stage. In dairy A, no lactobacilli were detected in raw ripened milk and few isolates were confirmed during cheese processing, but their numbers increased during ripening. No lactobacilli were detected on day 1 in dairy B, but they were detected in the raw ripened milk and from day 14 until the end of ripening. Most isolates originating from dairy C were lactobacilli, especially from the 14th day. Diversity and dynamics of lactobacilli at the species level PCR TGGE analysis of total DNA from spring batches using Lactobacillus-specific primers (Fig. 1) revealed, in Camembert cheese from dairy B, one band appearing from the 14th day of ripening that co-migrated with L. paracasei CIP 102993 and CNRZ 763 and with Lactobacillus rhamnosus CIP A 157. From the 30th day of ripening, a second band was seen. None of the reference strains used in this study co-migrated with this band. Analysis of total DNA

222 Can. J. Microbiol. Vol. 54, 2008 from dairy C yielded 2 different pictures, depending on the stage of sampling. In the day 1 ripening sample, 2 major bands appeared. One co-migrated with the major band of Lactobacillus acidophilus CNRZ 204. The second one was seen at all further sampling stages but no corresponding band appeared with reference strains. A minor band was also observed and co-migrated with L. paracasei CIP 102993 and CNRZ 763 and with L. rhamnosus CIP A 157. From the 14th day of ripening, this band and 2 additional ones that co-migrated with L. plantarum CNRZ 211 were observed. No amplification products were obtained at any stage for dairy A. The lactobacilli isolates obtained from the winter and spring batches were divided into 14 groups (Table 4) on the basis of their responses to TGGE analysis, species-specific PCR analysis, and (or) sequencing. Each group corresponded either to a Lactobacillus species or to a group of closely related species. Lactobacillus paracasei (112 isolates) and L. plantarum (46 isolates) were the most encountered species. These were followed by Lactobacillus parabuchneri (9 isolates), Lactobacillus fermentum (8 isolates), Lactobacillus psittaci/delbrueckii subsp. bulgaricus/ gallinarum/crispatus (4 isolates), Lactobacillus helveticus (3 isolates), L. acidophilus (3 isolates), L. rhamnosus (2 isolates), Lactobacillus delbrueckii subsp. lactis (2 isolates), Lactobacillus brevis (1 isolate), L. delbrueckii subsp. bulgaricus (1 isolate), Lactobacillus kefiri (1 isolate), Lactobacillus paraplantarum (1 isolate), and Lactobacillus perolens (1 isolate). Only 2 species were found in all the 3 dairies: L. paracasei (predominant species), and L. parabuchneri. The repartition of the lactobacilli isolates identified during Camembert production in the 3 dairies in winter and spring batches is shown in Fig. 2. Lactobacillus paracasei was globally the predominant species. Although it was not detected in all samples, it was always present at the end of ripening in the 6 batches. Except in winter in dairy C, L. parabuchneri was detected in all batches but at different stages, depending on the batch. Lactobacillus plantarum was isolated nearly exclusively from dairy C where it was detected in all stages in winter as the dominant or one of the co-dominant species. In spring, it was supplanted by L. paracasei, but it was isolated from the 14th day and it co-dominated at day 30. It appeared sporadically in winter in dairy A (in curd and at day 30). Isolates belonging to the L. fermentum species were encountered in winter and spring in dairy C and during the winter batch in A but only in curd. Lactobacillus helveticus, the L. psittaci/delbrueckii subsp. bulgaricus/gallinarum/crispatus group, L. delbrueckii subsp. lactis, L. rhamnosus, and L. brevis seemed to be isolated randomly from samples. The number of species identified was greater in the winter batch than in the spring batch for dairy A and, to a smaller extent, for dairy B, while it was almost the same in the 2 batches for dairy C. Species dynamics were very different between the 2 batches in dairies A and C. Conversely, dairy B exhibited a relative stability in terms of repartition of species at a given stage of sampling. Diversity and dynamics of lactobacilli at the intraspecies level PFGE analysis showed high intra-species diversity within L. paracasei isolates and much lower intra-species diversity within L. plantarum (Figs. 3A and 3B). PFGE analysis of L. paracasei isolates from dairy B showed a wide range of PFGE profiles, as 21 different profiles were obtained from the 39 isolates identified to this species. Among them, 12 were strain specific and 9 were shared by different isolates. For example, profile 5 was displayed by 6 isolates found at different stages of ripening in B in winter and spring (see also profiles 13 and 14, Fig. 3A). Other profiles were detected only at some stages. For example, profile 3 was only associated with raw ripened milk isolates. Similarly, 2 strains seemed to be specific to the end of ripening (Fig. 3A, lines 15 and 19). PFGE analysis of L. plantarum isolates (15 from the winter batch and 9 from the spring batch in dairy C) revealed 4 different profiles. One strain of L. plantarum dominated at all stages in the winter batch in dairy C but was not recovered from the spring batch. Two of the 3 profiles found in spring were associated with different stages of ripening (profiles 2 and 3, Fig. 3B). Other microorganisms Among presumed lactobacilli, isolates that were not confirmed as lactobacilli belonged to 2 main groups. Sequencing of several isolates from these led to the identification of Pediococcus acidilactici for one group and Leuconostoc lactis and Leuconostoc pseudomesenteroides for the second group. Pediococcus acidilactici was found in dairy B where it was the only microorganism isolated from the curd. The genus Leuconostoc was mainly encountered in dairy A and was either subdominant or undetected in the other dairies. In dairy C, virtually no microorganisms other than lactobacilli were present from day 1 onwards. Discussion Microbiological counts and molecular confirmation showed that except at day 1 in dairy B, lactobacilli were present throughout the ripening period in the 3 dairies. However, the molecular methods failed to detect Lactobacillus spp. in several cases. Culture-independent methods may lead to false-negative results owing to low levels of cells and low relative concentration of target DNA, or the presence of competing DNA and PCR reactions can also introduce bias owing to selective amplification (Muyzer 1999; Ercolini et al. 2001; Henri-Dubernet et al. 2004). This was confirmed here. Data from this study reveal that the Camembert cheese microbiology can show strong variability. Both the detection of Lactobacillus DNA and the microbial counts on AMRSA and LAMVAB differed among the dairies, and variations appeared regarding the diversity and dynamics of lactobacilli populations at the species and strains levels. There were also important differences between the 2 batches from dairy A, whereas, in dairy C and especially in dairy B, the results were similar in the winter and spring batches. This suggests, as already shown for artisanal raw milk cheeses (Poznanski et al. 2004), not only a strong influence of the composition of the raw milk but also of the cheesemaking practices that appeared to be highly controlled in dairy B. In 1989, the diversity of LAB in RDO Camembert from

Table 4. Molecular characterization of lactobacilli isolated throughout the cheese-making process in the 3 dairies and subsequent identification. Defined group Dairy No. of isolates PCR genus specific TGGE genus specific PCR species specific Sequencing Final identification L. paracasei A 29 + L. paracasei/rhamnosus L. paracasei ND L. paracasei subsp. paracasei A 3 + L. paracasei/rhamnosus L. paracasei L. paracasei/rhamnosus L. paracasei subsp. paracasei A 2 NR ND NR L. paracasei/rhamnosus L. paracasei/rhamnosus B 37 + L. paracasei/rhamnosus L. paracasei ND L. paracasei subsp. paracasei B 3 + L. paracasei/rhamnosus L. paracasei L. paracasei/rhamnosus L. paracasei subsp. paracasei C 36 + L. paracasei/rhamnosus L. paracasei ND L. paracasei subsp. paracasei C 2 + L. paracasei/rhamnosus L. paracasei L. paracasei/rhamnosus L. paracasei subsp. paracasei L. plantarum A 2 + L. plantarum L. plantarum L. plantarum/paraplantarum/ pentosus L. plantarum C 26 + L. plantarum L. plantarum ND L. plantarum C 9 + NR L. plantarum L. plantarum/paraplantarum/ pentosus L. plantarum C 9 + L. plantarum L. plantarum L. plantarum/paraplantarum/ pentosus L. plantarum L. parabuchneri A 5 NR ND ND L. parabuchneri L. parabuchneri B 3 NR ND ND L. parabuchneri L. parabuchneri C 1 NR ND ND L. parabuchneri L. parabuchneri L. fermentum A 4 NR ND ND L. fermentum L. fermentum L. psittaci/delbrueckii bulgaricus/gallinarum/ crispatus C 4 NR ND ND L. fermentum L. fermentum A 2 + L. helveticus/delbrueckii subsp. NR L. psittaci/delbrueckii subsp. delbrueckii/lactis bulgaricus/heveticus/gallinarum/crispatus L. psittaci/delbrueckii subsp. bulgaricus/gallinarum/crispatus A 2 + L. helveticus/delbrueckii subsp. NR ND L. psittaci/delbrueckii subsp. delbrueckii/lactis bulgaricus/gallinarum/crispatus L. helveticus A 2 + L. helveticus/delbrueckii subsp. delbrueckii/lactis B 1 + L. helveticus/delbrueckii subsp. delbrueckii/lactis L. helveticus L. psittaci/delbrueckii subsp. bulgaricus/heveticus/ gallinarum/crispatus L. helveticus L. psittaci/delbrueckii subsp. bulgaricus/heveticus/ gallinarum/crispatus L. helveticus L. helveticus L. acidophilus B 3 + L. acidophilus ND L. acidophilus L. acidophilus L. rhamnosus B 2 + L. paracasei/rhamnosus L. rhamnosus L. paracasei/rhamnosus L. rhamnosus L. delbrueclii subsp. lactis A 1 + L. delbrueckii subsp. ND L. delbrueckii sp. delbrueckii/lactis L. delbrueckii subsp. lactis* B 1 + L. delbrueckii subsp. ND L. delbrueckii sp. delbrueckii/lactis L. delbrueckii subsp. lactis L. brevis B 1 + ND ND L. brevis L. brevis L. delbrueclii subsp. A 1 + L. delbrueckii subsp. bulgaricus ND L. delbrueckii subsp. bulgaricus bulgaricus L. delbrueckii subsp. bulgaricus L. kefiri C 1 + Non assigned ND L. kefiri L. kefiri L. paraplantarum C 1 + L. plantarum L. paraplantarum ND L. paraplantarum L. perolens A 1 NR ND ND L. perolens L. perolens Note: NR, no response; ND, not determined. *Fermentation of trehalose (+), salicin (+), amygdalin (+), hydrolysis of esculin (+). Henri-Dubernet et al. 223

224 Can. J. Microbiol. Vol. 54, 2008 Fig. 2. Distribution of lactobacilli species or groups among isolates obtained during Camembert cheese production in winter and spring in 3 dairies (A, B, and C).

Henri-Dubernet et al. 225 Fig. 3. Diversity in pulsed-field gel electrophoresis patterns after digestion with NotI of (A) Lactobacillus paracasei from dairy B and (B) Lactobacillus plantarum from dairy C in winter (I) and spring (II). dairy A (10 isolates per stage of ripening) was studied by phenotypic methods (API 50 strips) (M. Guéguen, personal communication, 2004). The most frequently isolated species were L. casei, L. plantarum, and L. brevis. However, the API 50 system could not differentiate between L. paracasei and the closely related L. casei. It is probable that isolates identified as L. casei in the previous study would have been considered as L. paracasei today. Lactobacillus buchneri, L. fermentum, L. acidophilus, L. helveticus, and L. delbrueckii were less abundant. Most species were identified in both studies, suggesting that this panel of lactobacilli is well established in RDO Camembert. However, in the previous study, L. brevis dominated the microflora of raw ripened milk and curd and then decreased during ripening. The fact that L. brevis was subdominant in the present study could be due to (i) its failure to grow on the media used, notably on LAMVAB, (ii) a decrease in the diversity of the raw milk produced nowadays, or (iii) inaccurate identification by API 50 strips. Some general tendencies, observed in cheeses issued from various technologies, were confirmed in Camembert cheese regarding L. paracasei and L. plantarum and their evolution during ripening. Among the different lactobacilli isolated during ripening of raw milk Camembert cheese, L. paracasei was the most common. It seems to find favourable conditions during the cheese-making process (Wouters et al. 2002), whatever the type of cheese. Its presence has already been reported in soft, and in many semi-hard and hard cheeses made from cow, ewe, and goat s milk, such as Caciocavallo (Coppola et al. 2003), Ibores (Mas et al. 2002), Cheddar (Fitzsimons et al. 1999), and Salers (Duthoit et al. 2003). The fact that L. paracasei is widespread in

226 Can. J. Microbiol. Vol. 54, 2008 cheese is probably linked to its mesophilic properties and its origin from raw milk (Depouilly et al. 2004). It is generally believed that when this adventitious bacterium is present in cheese, it overcomes all the other lactobacilli to become predominant by the end of ripening (Ostlie et al. 2004; Poznanski et al. 2004). Although L. paracasei is often isolated from other fermented foods including traditional fermented milk (Mathara et al. 2004), its dominance seems to be restricted to cheese, since other species dominate in such cases (Lee et al. 2005). The fact that L. paracasei is widespread in cheese, whatever the technology, is not well documented. Antimicrobial properties have been demonstrated in this species (Schwenninger et al. 2005) and, compared with L. plantarum, it is able to metabolize citrate (Weinrichter et al. 2001); this could favour its development. Lactobacillus plantarum was the second most-isolated species, but it occurred nearly exclusively in dairy C. Lactobacillus plantarum has also been recovered from different cheeses made from cow s milk (Ercolini et al. 2003; Duthoit et al. 2005), ewe s milk (Mannu et al. 2000), and goat s milk (Oneca et al. 2003). It is also used as an adjunct culture (Dasen et al. 2003; Coeuret et al. 2004). This is the first time that L. perolens and L. kefiri have been detected in Camembert cheese. Lactobacillus perolens, which was recently identified, has only been reported in an artisanal semi-hard cheese made with raw milk (Ugarte et al. 2006). Lactobacillus kefiri has also been described in Ricotta forte cheese (Baruzzi et al. 2000). PFGE analysis of L. paracasei isolates from dairy B revealed numerous different profiles. We also analysed some isolates of L. paracasei from dairies A and C; their patterns were all different from each other and from those of isolates from dairy B (data not shown). Thus, diversity at the intraspecies level was large and varied between batches and especially among dairies. A great diversity of strains has been reported in Comté cheese, and their growth kinetics are cheese specific (Depouilly et al. 2004). Here, we used PFGE to investigate strain dynamics throughout ripening. Although most strains of L. paracasei were recovered only at one clearly defined stage, some strains seemed to be specific to a given stage and others seemed to be specific to a given dairy. For example in dairy B, one strain was encountered only in raw ripened milk, whatever the batch, and another was very stable during the cheese-making process (recovered in raw ripened milk, and at days 14 and 60) and during the 2 seasons. This latter wild strain seemed to be well established in the dairy. Furthermore, the different isolates from dairies A and C showed patterns different from each other, suggesting that the intraspecies diversity and dynamics are dependent on the dairy. In addition, all wild strains belonged to taxa other than the taxon including collection strains. This has already been reported for Staphylococcus strains (Irlinger et al. 1997). The dynamics of L. plantarum strains were studied in dairy C. The fact that only one PFGE profile was found in CI suggests that this strain could intentionally be added during the cheese manufacturing process. Although only one profile was obtained in CI, 3 different strains were isolated in CII. This suggests that the former strain was not established in dairy C and has probably, in winter batches, hidden intraspecies diversity and dynamics that were seen in spring batches (2 strains persistent during ripening). Based on the dynamics of L. paracasei, it appears that a wild strain can become established durably in a dairy and that each cheese exhibits its own diversity and its own specificity regarding population dynamics. Usually, metagenomic approaches are used to describe complex microbial populations involving many known and unknown microbial genera. In food microbial ecology, the study published by Le Bourhis et al. (2005) and the present study are the only two, to our knowledge, to focus on TTGE/TGGE analysis of only one genus. Both studies have shown that TGGE/TTGE can be used as an identification tool at the species level. Indeed, Le Bourhis et al. (2005) were able to detect and distinguish the majority of species belonging to the phylogenetic cluster I of the genus Clostridium. In this study, we were able to generate specific profiles for most of 21 lactobacilli species. It was also possible to distinguish the subspecies bulgaricus from the 2 other subspecies of L. delbrueckii. However, limitations appeared in this approach because the complexity of some profiles (several bands for a given species) led to difficulties in interpreting data from mixed lactobacilli populations, as encountered in cheese. The polyphasic approach that we used here allowed us to examine lactobacilli populations using TGGE with both total DNA and DNA from isolates. If the combination of culturedependent and culture-independent methods is now being widely used to overcome the limitations inherent to each approach (Duthoit et al. 2003; Ercolini et al. 2003), few studies compare the 2 approaches using the same identification tool. Le Bourhis et al. (2005), studying Clostridium species in cheese, showed that culture and direct molecular detection are consistent, but they observed a higher diversity by the direct approach, since spores of some species were not able to grow in the conditions used for the culture approach. Here, we also obtained consistent data using the direct and culture-dependent TGGE, but conversely, we highlighted a higher diversity with the culture method. This is probably due to the fact that DNA from subdominant species was not amplified. Furthermore, it seems that few noncultivable lactobacilli were present, thus limiting the interest of using a culture-independent approach in this field. Microorganisms other than lactobacilli were also recovered from AMRSA and LAMVAB. Members of the leuconostocs and pediococci groups were sometimes abundant. The fact that Leuconostoc lactis was mainly encountered in AII and dominated in raw ripened milk and curd suggests that it was used as a starter. In this batch, diversity was very low and few lactobacilli were isolated. This may be due to leuconostocs, which appear to affect the development of adventitious NSLAB when they are used as a starter (Wouters et al. 2002). In BI and BII, Pediococcus acidilactici dominated the curd microflora. Its presence has already been reported in several different cheeses (Coppola et al. 1997; Depouilly et al. 2004), and furthermore pediococci can be used as a starter (Bhowmik and Marth 1990). The use of molecular methods to monitor lactobacilli throughout Camembert production allowed us to draw a novel and more accurate picture of the diversity and dynamics of lactobacilli populations in Camembert cheese at both the species and strain levels. The polyphasic approach that

Henri-Dubernet et al. 227 we used here allowed us to examine the temporal distribution of species found in different dairies. It underlines the fact that the cultivation method remains necessary and should be maintained together with new approaches. Acknowledgements We thank Jean-Michel Bré and Marie-Joëlle Jacob for their technical assistance. This study was supported in part by the Syndicat Normand des Fabricants de Camembert (SNFC), the Institut National de la Recherche Agronomique (INRA) and the Conseil Régional de Basse-Normandie, France. References Altschul, S.F., Madden, T.L., Schaffer, A.A., Zhang, J., Zhang, Z., and Lipman, D.J. 1997. Gapped BLAST and PSI-BLAST: a new generation of protein database search programs. Nucleic Acids Res. 25: 3389 3402. doi:10.1093/nar/25.17.3389. PMID: 9254694. Baruzzi, F., Morea, M., Matarante, A., and Cocconcelli, P.S. 2000. Changes in the Lactobacillus community during Ricotta forte cheese natural fermentation. J. Appl. Microbiol. 89: 807 814. doi:10.1046/j.1365-2672.2000.01183.x. PMID:11119155. Beresford, T.P., Fitzsimons, N.A., Brennan, N.L., and Cogan, T.M. 2001. Recent advances in cheese microbiology. Int. Dairy J. 11: 259 274. doi:10.1016/s0958-6946(01)00056-5. Berthier, F., and Ehrlich, S.D. 1998. Rapid species identification within two groups of closely related lactobacilli using PCR primers that target the 16S/23S rrna spacer region. FEMS Microbiol. Lett. 161: 97 106. doi:10.1111/j.1574-6968.1998.tb12934. x. PMID:9561736. Bhowmik, T., and Marth, E.H. 1990. Role of Micrococcus and Pediococcus species in cheese ripening: a review. J. Dairy Sci. 73: 859 866. Callon, C., Duthoit, F., Dèlbes, C., Ferrand, M., Le Frileux, Y., De Crémoux, R., and Montel, M.C. 2007. Stability of microbial communities in goat milk during a lactation year: molecular approaches. Syst. Appl. Microbiol., In press. doi:10.1016/j.syapm. 2007.05.004. PMID:17604934. Coeuret, V., Dubernet, S., Bernardeau, M., Guéguen, M., and Vernoux, J.P. 2003. Isolation, characterization and identification of lactobacilli focusing mainly on cheeses and other dairy products. Lait, 83: 269 306. doi:10.1051/lait:2003019. Coeuret, V., Guéguen, M., and Vernoux, J.P. 2004. In vitro screening of potential probiotic activities of selected lactobacilli isolated from unpasteurized milk products for incorporation into soft cheese. J. Dairy Res. 71: 451 460. doi:10.1017/ S0022029904000469. PMID:15605712. Coppola, R., Nanni, M., Iorizzo, M., Sorrentino, A., Sorrentino, E., and Grazia, L. 1997. Survey of lactic acid bacteria during the advanced stages of the ripening of Parmigiano Reggiano cheese. J. Dairy Res. 64: 305 310. doi:10.1017/s0022029996002038. Coppola, R., Nanni, M., Succi, M., Sorrentino, A., Iorizzo, M., Chiavari, C., and Grazia, L. 2001. Enumeration of thermophilic lactic acid bacteria in ripened cheeses manufactured from raw milk. Milchwissenschaft, 56: 140 142. Coppola, R., Succi, M., Sorrentino, E., Iorizzo, M., and Grazia, L. 2003. Survey of lactic acid bacteria during the ripening of Caciocavallo cheese produced in Molise. Lait, 83: 211 222. doi:10.1051/lait:2003011. Dasen, A., Berthier, F., Grappin, R., Williams, A.G., and Banks, J. 2003. Genotypic and phenotypic characterization of the dynamics of the lactic acid bacterial population of adjunct-containing cheddar cheese manufactured from raw and microfiltered pasteurized milk. J. Appl. Microbiol. 94: 595 607. doi:10.1046/j. 1365-2672.2003.01878.x. PMID:12631195. Dèlbes, C., and Montel, M.C. 2005. Design and application of a Staphylococcus-specific single strand conformation polymorphism-pcr analysis to monitor Staphylococcus populations diversity and dynamics during production of raw milk cheese. Lett. Appl. Microbiol. 41: 169 174. doi:10.1111/j. 1472-765X.2005.01732.x. PMID:16033516. Demarigny, Y., Beuvier, E., Dasen, A., and Duboz, G. 1996. Influence of raw milk microflora on the characteristics of Swiss-type cheeses. I. Evolution of microflora during ripening and characterization of facultatively heterofermentative lactobacilli. Lait, 76: 371 387. doi:10.1051/lait:1996428. Depouilly, A., Dufrene, F., Beuvier, E., and Berthier, F. 2004. Genotypic characterization of the dynamics of the lactic acid bacterial population of Comté cheese. Lait, 84: 155 167. doi:10.1051/ lait:2003036. Dubernet, S., Desmasures, N., and Guéguen, M. 2002. A PCRbased method for identification of lactobacilli at the genus level. FEMS Microbiol. Lett. 214: 271 275. doi:10.1111/j.1574-6968. 2002.tb11358.x. PMID:12351242. Duthoit, F., Godon, J.J., and Montel, M.C. 2003. Bacterial community dynamics during production of registered designation of origin Salers cheese as evaluated by 16S rrna gene single-strand conformation polymorphism analysis. Appl. Environ. Microbiol. 69: 3840 3848. doi:10.1128/aem.69.7.3840-3848.2003. PMID: 12839752. Duthoit, F., Tessier, L., and Montel, M.C. 2005. Diversity, dynamics and activity of bacterial populations in Registered Designation of Origin Salers cheese by single-strand conformation polymorphism analysis of 16S rrna genes. J. Appl. Microbiol. 98: 1198 1208. doi:10.1111/j.1365-2672.2005.02575.x. PMID: 15836490. Ercolini, D., Moschetti, G., Blaiotta, G., and Coppola, S. 2001. The potential of a polyphasic PCR-DGGE approach in evaluating microbial diversity of natural whey cultures for water-buffalo Mozzarella cheese production: bias of culture-dependent and culture-independent analyses. Syst. Appl. Microbiol. 24: 610 617. doi:10.1078/0723-2020-00076. PMID:11876368. Ercolini, D., Hill, P.J., and Dodd, C.E.R. 2003. Bacterial community structure and location in Stilton cheese. Appl. Environ. Microbiol. 69: 3540 3548. doi:10.1128/aem.69.6.3540-3548.2003. PMID:12788761. Ercolini, D. 2004. PCR DGGE fingerprinting: novel strategies for detection of microbes in food. J. Microbiol. Methods, 56: 297 314. doi:10.1016/j.mimet.2003.11.006. PMID:14967221. Ercolini, D., Mauriello, G., Blaiotta, G., Moschetti, G., and Coppola, S. 2004. PCR DGGE fingerprints of microbial succession during a manufacture of traditional water buffalo mozzarella cheese. J. Appl. Microbiol. 96: 263 270. doi:10.1046/j. 1365-2672.2003.02146.x. PMID:14723687. Fitzsimons, N.A., Cogan, T.M., Condon, S., and Beresford, T. 1999. Phenotypic and genotypic characterization of non-starter lactic acid bacteria in mature Cheddar cheese. Appl. Environ. Microbiol. 65: 3418 3426. PMID:10427029. Hartemink, R., Domenech, V.R., and Rombouts, F.M. 1997. LAMVAB a new selective medium for the isolation of lactobacilli from faeces. J. Microbiol. Methods, 29: 77 84. doi:10. 1016/S0167-7012(97)00025-0. Henri-Dubernet, S., Desmasures, N., and Guéguen, M. 2004. Culture-dependent and culture-independent methods for molecular analysis of the diversity of lactobacilli in Camembert de Normandie cheese. Lait, 84: 179 189. doi:10.1051/ lait:2003037.

228 Can. J. Microbiol. Vol. 54, 2008 Irlinger, F., Morvan, A., El Solh, N., and Bergère, J.L. 1997. Taxonomic characterization of coagulase-negative staphylococci in ripening flora from traditional french cheeses. Syst. Appl. Microbiol. 20: 319 328. Lafarge, V., Ogier, J.C., Girard, V., Maladen, V., Leveau, J.Y., Gruss, A., and Delacroix-Buchet, A. 2004. Raw cow milk bacterial population shifts attribuable to refrigeration. Appl. Environ. Microbiol. 70: 5644 5650. doi:10.1128/aem.70.9.5644-5650.2004. PMID:15345453. Lazzi, C., Rossetti, L., Zago, M., Neviani, E., and Giraffa, G. 2004. Evaluation of bacterial communities belonging to natural whey starters for Grana Padano cheese by length heterogeneity-pcr. J. Appl. Microbiol. 96: 481 490. doi:10.1111/j.1365-2672.2004. 02180.x. PMID:14962128. Le Bourhis, A.G., Saunier, K., Doré, J., Carlier, J.P., Chamba, J.F., Popoff, M.R., and Tholozan, J.L. 2005. Development and validation of PCR primers to assess the diversity of Clostridium spp. in cheese by temporal temperature gradient gel electrophoresis. Appl. Environ. Microbiol. 71: 29 38. doi:10.1128/aem.71. 1.29-38.2005. PMID:15640166. Lee, J.S., Heo, G.Y., Lee, J.W., Oh, Y.J., Park, J.A., Park, Y.H., Pyun, Y.R., and Ahn, J.S. 2005. Analysis of kimchi microflora using denaturing gradient gel electrophoresis. Int. J. Food Microbiol. 102: 143 150. doi:10.1016/j.ijfoodmicro.2004.12.010. PMID:15992614. Lucore, L.A., Cullison, M.A., and Jaykus, L.A. 2000. Immobilization with metal hydroxides as a means to concentrate food-borne bacteria for detection by cultural and molecular methods. Appl. Environ. Microbiol. 66: 1769 1776. doi:10.1128/aem.66.5. 1769-1776.2000. PMID:10788338. Mannu, L., Communian, R., and Scintu, M.F. 2000. Mesophilic lactobacilli in Fiore Sardo cheese: PCR-identification and evolution during cheese ripening. Int. Dairy J. 10: 383 389. doi:10. 1016/S0958-6946(00)00074-1. Mas, M., Tabla, R., Moriche, J., Roa, I., Gonzalez, J., Rebollo, J.E., and Caceres, P. 2002. Ibores goat s milk cheese: microbiological and physicochemical changes throughout ripening. Lait, 82: 579 587. doi:10.1051/lait:2002034. Mathara, J.M., Schillinger, U., Kutima, P.M., Mbugua, S.K., and Holzapfel, W.H. 2004. Isolation, identification and characterization of the dominant microorganisms of kule naoto: the traditional fermented milk in Kenya. Int. J. Food Microbiol. 94: 269 278. doi:10.1016/j.ijfoodmicro.2004.01.008. PMID: 15246238. Muyzer, G. 1999. DGGE/TGGE a method for identifying genes from natural ecosystems. Curr. Opin. Microbiol. 2: 317 322. doi:10.1016/s1369-5274(99)80055-1. PMID:10383868. Nakagawa, T., Shimada, M., Mukai, H., Asada, K., Kato, I., Fujino, K., and Sato, T. 1994. Detection of alcohol-tolerant hiochi bacteria by PCR. Appl. Environ. Microbiol. 60: 637 640. PMID:7510942. Ogier, J.C., Son, O., Gruss, A., Tailliez, P., and Delacroix-Buchet, A. 2002. Identification of bacterial microflora in dairy products by temporal temperature gradient gel electrophoresis. Appl. Environ. Microbiol. 68: 3691 3701. doi:10.1128/aem.68.8.3691-3701.2002. PMID:12147461. Oneca, M., Irigoyen, A., Ortigosa, M., and Torre, P. 2003. PCR and RAPD identification of L. plantarum strains isolated from ovine milk and cheese. Geographical distribution of strains. FEMS Microbiol. Lett. 227: 271 277. doi:10.1016/s0378-1097(03)00691-8. PMID:14592719. Ostlie, H.M., Eliassen, L., Florvaag, A., and Skeie, S. 2004. Phenotypic and PCR-based characterization of the microflora in Norvegia cheese during ripening. Int. J. Food Microbiol. 94: 287 299. doi:10.1016/j.ijfoodmicro.2004.01.012. PMID:15246240. Poznanski, E., Cavazza, A., Cappa, F., and Cocconceli, P.S. 2004. Indigenous raw milk microbiota influences the bacterial development in traditional cheese from alpine natural park. Int. J. Food Microbiol. 92: 141 151. doi:10.1016/j.ijfoodmicro.2003. 09.006. PMID:15109791. Randazzo, C.L., Torriani, S., Akkermans, A.D.L., de Vos, W.M., and Vaughan, E.E. 2002. Diversity, dynamics, and activity of bacterial communities during production of an artisanal Sicilian cheese as evaluated by 16S rrna analysis. Appl. Environ. Microbiol. 68: 1882 1892. doi:10.1128/aem.68.4.1882-1892.2002. PMID:11916708. Sambrook, J., Fritsch, E.F., and Maniatis, T. 1989. Molecular cloning: a laboratory manual. 2nd ed. Cold Spring Harbour Laboratory, Cold Spring Harbour, N.Y. Schwenninger, S.M., von Ah, U., Niederer, B., Teuber, M., and Meile, L. 2005. Detection of antifungal properties in Lactobacillus paracasei subsp. paracasei SM20, SM29, and SM63 and molecular typing of the strains. J. Food Prot. 68: 111 119. PMID:15690811. Ugarte, M.B., Guglielmotti, D., Giraffa, G., Reinheimer, J., and Hynes, E. 2006. Nonstarter lactobacilli isolated from soft and semihard Argentinean cheeses: genetic characterization and resistance to biological barriers. J. Food Prot. 69: 2983 2991. PMID:17186668. Walter, J., Tannock, G.W., Tilsala-Timisjarvi, A., Rodtong, S., Loach, D.M., Munro, K., and Alatossava, T. 2000. Detection and identification of gastrointestinal Lactobacillus species by using denaturing gradient gel electrophoresis and species-specific PCR primers. Appl. Environ. Microbiol. 66: 297 303. PMID:10618239. Walter, J., Hertel, C., Tannock, G.W., Lis, C.M., Munro, K., and Hammes, W.P. 2001. Detection of Lactobacillus, Pediococcus, Leuconostoc, and Weissella species in human feces by using group-specific PCR primers and denaturing gradient gel electrophoresis. Appl. Environ. Microbiol. 67: 2578 2585. doi:10.1128/ AEM.67.6.2578-2585.2001. PMID:11375166. Ward, L.J., and Timmins, M.J. 1999. Differentiation of Lactobacillus casei, Lactobacillus paracasei and Lactobacillus rhamnosus by polymerase chain reaction. Lett. Appl. Microbiol. 29: 90 92. doi:10.1046/j.1365-2672.1999.00586.x. PMID:10499296. Weinrichter, B., Luginbühl, W., Rohm, H., and Jimeno, J. 2001. Differentiation of facultatively heterofermentative lactobacilli from plants, milk, and hard type cheeses by SDS-PAGE, RAPD, FTIR, energy source utilisation and autolysis type. Lebensmittel-Wissenschaft und-technologie 34: 556 566. Wouters, J.T.M., Ayad, E.H.E., Hugenholtz, J., and Smit, G. 2002. Microbes from raw milk for fermented dairy products. Int. Dairy J. 12: 91 109. doi:10.1016/s0958-6946(01)00151-0.