Approaches to Determine the Origin of European Plum (Prunus domestica) Based on DNA Nucleotide Sequences

Approaches to Determine the Origin of European Plum (Prunus domestica) Based on DNA Nucleotide Sequences H. Xuan and D. Spann Kompetenzzentrum Obstbau-Bodensee (KOB) Schuhmacherhof 6, D-88213 Ravensburg Germany P. Schlottmann Stiftung Herzogtum Lauenburg Hauptstraße 150, D-23879 Moelln Germany M. Neumüller Technische Universität München (TUM) Duernast 2, D-85354 Freising Germany Keywords: chloroplast SSR, cpssr, microsatellites, Kompetenzzentrum Obstbau-Bodensee (KOB), simple sequence repeats Abstract 7 nuclear SSRs and 10 chloroplast SSRs (cpssrs) from 4 non-coding regions were chosen for DNA and cpdna analysis from a total of about 30 individuals of P. domestica, P. spinosa, P. cerasifera, P. salicina and interspecific crosses of P. domestica P. cerasifera, P. domestica P. spinosa and P. cerasifera P. salicina and used for molecular phylogenetic approaches to help clarify the origin of European plums. Primers were labelled with Cy5 and Cy5.5 and the PCR products were detected and analysed by capillary electrophoresis using a Beckman CEQ 8000 DNA sequencer (Beckman Coulter, Inc.) by comparison with internal size standards. Cluster analysis was performed with GelCluster V1.0 (BioSci-software), to obtain dendrogram grouping output. Using the 7 SSRs and 9 cpssrs successfully separated the 30 individuals of P. domestica, P. spinosa, P. cerasifera, P. salicina and interspecific crosses of P. domestica P. cerasifera, P. domestica P. spinosa, P. domestica P. armeniaca and P. cerasifera P. salicina. Tatjana, formerly described as a P. cerasifera genotype, is likely to be a hybrid between P. salicina and P. cerasifera. 69 KO from Lauenburg is probably not a pure P. ceracifera genotype, but has P. salicina ancestors. INTRODUCTION The genus Prunus consists of about 400 species of trees and shrubs (Maynard et al., 1991). Many species are cultivated for their edible fruit and/or for ornamental purposes (Rehder, 1940; Tutin et al., 1968). Plums, damsons, greengages and mirabelle plums (prune) are useful fruit species which grow on all continents and have been collectively summarized under Prunus domestica (European plum) according to Hegi (1923). The hexaploid European plum (P. domestica) has overlapping native ranges with other Prunus species in Europe. P. domestica is considered by several authors as an addition bastard (hybrid) between blackthorn (2n=4x=32, P. spinosa L.) and cherry plum (2n=2x=16, P. cerasifera Ehrh.) (Crane and Lawrence, 1934; Okie and Weinberger, 1996). However, wild types of P. domestica are unknown. Hybrids of P. cerasifera and P. spinosa made by Endlich and Murawski (1962) resulted in plants which were similar to those from P. domestica. Beridze and Kvatchadze (1981) postulated the direct formation of several forms of P. domestica by increasing the ploidy of P. divaricata, which now belongs to P. cerasifera. At the same time, the morphological traits and biochemical indices (presence of phenol compounds analyzed by thin layer chromatography) were also referred to in these studies. Zohary (1992) went a further step and regarded all P. domestica as an autopolyploid of P. cerasifera. He stated a reason that mirabelle, damson and greengage show no similarities to P. spinosa. However, this should be questioned, because damson shows complete similarities to P. spinosa. P. spinosa is tetraploid. Salesses and Bonnet (1994) assumed that P. spinosa is an allotetraploid species Proc. XXVIII th IHC III rd IS on Plant Genetic Resources Ed.: K.E. Hummer Acta Hort. 918, ISHS 2011 261

with two different genomes with regard to cytogenetic studies on P. spinosa. They noted a homology to P. cerasifera, which was verified by Reynders-Aloisi and Grellet (1994) through the use of heterologous ribosomal DNA probes. According to Eryomine (1991), P. spinosa is a hybrid of P. cerasifera and P. microcarpa. However, the origin of European plum is still disputed. Molecular biological techniques allow differentiation of genotypes at the genome level. RAPD (Gregory et al., 1994), RFLP (Casas et al., 1999) and microsatellite markers (Decroocq et al., 2004) have been used successfully for the identification of P. domestica genotypes. Microsatellites (SSRs) are abundant and well established in the nuclear genomes of both animals and plants. Recently, microsatellites in chloroplast genomes have been found and shown to be highly useful markers for phylogenetic and molecular genetic studies in several plants (Morgan et al., 1994; Lee and Wen, 2001; Bortiri et al., 2002; Ohta et al., 2007). In this study, a set of 9 chloroplast SSRs (cpssrs) from 4 non-coding regions and 7 genomic SSRs were chosen for cpdna- and DNA analysis from a total of about 30 individuals of P. domestica, P. spinosa, P. cerasifera, P. salicina and interspecific crosses of P. domestica P. cerasifera, P. domestica P. spinosa and P. cerasifera P. salicina and used for molecular phylogenetic approaches to try to help clarify the origin of European plums. MATERIALS AND METHODS Samples and DNA Isolation Healthy young fresh leaf samples were taken from trees in the plum breeding program and plum gene bank at the Technische Universität München (TUM) and trees from the fruit preservation orchards in the Staatliche Lehr- und Versuchsanstalt für Weinund Obstbau Weinsberg (LVWO Weinsberg), the Foundation of Herzogtum Lauenburg and the Zhengzhou Fruit Tree Institute in China (Table 1). Three samples taken from three separate trees of each cultivar per location were collected and delivered to the genetic laboratory at the Kompetenzzentrum Obstbau-Bodensee (KOB). The samples were immediately processed or freeze-dried and stored at -32 C. Total genomic DNA was extracted from the freeze-dried samples according to the modified method of Neumüller (2004) by a CTAB (cetyl trimethyl ammonium bromide)- based extraction (Koller et al., 1993). DNA was quantified by the SERVA Digital Imaging and Analysis System DIAS-I, and subsequently diluted to 15 ng/µl for analysis. PCR and Fragment Analysis Seven nuclear SSR markers, EMPaS11, EMPaS02, EMPaS06, EMPaS12, EMPaS14, EMPaS01 and UCD-CH17 (Xuan et al., 2011) and 10 cpssr markers were chosen from Ohta et al. (2005) (their sequences and location are listed in Table 2). EMPaS02 and EMPaS14 were labelled with Cy5.5; EMPaS11, EMPaS06, EMPaS12, EMPaS01, UCD-CH17 and all cpssrs with Cy5. PCR reactions for nuclear SSR were performed the same as Xuan et al. (2009): 94 C for 2 min, followed by 37 cycles of 30 s at 94 C, 1 min at 56 C, 2 min at 72 C, and a final extension step for 10 min at 72 C. PCR reactions for cpssrs were performed as suggested by Ohta et al. (2005) with 35 cycles at 94 C for 1 min, 55 C for 1 min and 72 C for 2 min. Microsatellite fragments were detected and analysed by capillary electrophoresis using the Beckman CEQ 8000 (Beckman Coulter, Inc.) by comparison with internal size standards. Cluster analyses were performed with the GelCluster V1.0 (available from the author upon request). RESULTS AND DISCUSSION Chloroplast DNA sequences and nucleotide sequences have been effectively used for phylogenetic analysis in Prunus. Lee and Wen (2001) performed a phylogenetic analysis using ITS sequences. Bortiri et al. (2002) used the nucleotide sequences of ITS, 262

trnl-trnf spacer and sorbitol-6-phosphat dehydrogenase. These studies revealed that subg. Amygdalus, Prunus and sect. Microcerasus are monophyletic. Shaw and Small (2004) analyzed the phylogeny of North American plums (Prunus subg. Prunus sect. Prunocerasus) using noncoding cpdna regions. They revealed that Prunocerasus is a monophyletic assemblage. Ohta et al. (2005, 2007) investigated the the phylogenetic relationships among Japanese flowering cherries (Prunus subg. Cerasus) based on nucleotide sequences and concluded from their study that Japanese flowering cherries have experienced complicated speciation arising from hybridization. In this study, the cpssrs as well as the SSRs successfully separated the 30 individuals of P. domestica, P. spinosa, P. cerasifera, P. salicina and interspecific crosses of P. domestica P. cerasifera, P. domestica P. spinosa, P. domestica P. armeniaca, and P. cerasifera P. salicina. The dendrograms of SSRs (Fig. 1) and cpssrs (Fig. 2) were conducted by cluster analysis using Ward s method linkage type and Euclid Square distance measure with GelCluster V1.0. Figure 1 shows the European plums Mirabelle de Nancy, Valjevka and Wangenheims are clustered in one group with the crosses of Wei 235, Wei 243, Wei 260, Wei 266, Wei 1889 and Sämling 48-10. The rest of the studied samples are clustered in another group. 69KO is clustered in the group of P. salicina. The questionable cultivar Tatjana is sorted into the group of Myrobalane and P. salicina. And the questionable cultivar Wei 4709 is sorted in the group of Sämling 44-10. Figure 2 shows the European plums Mirabelle de Nancy, Valjevka and Wangenheims are clustered in one group with the crosses of Wei 235, Wei 243, Wei 260, Wei 266, Wei 1889 and Sämling 48-10 as well as P. spinosa and P. cerasifera. 69KO is clustered in the group of P. salicina. The questionable cultivar Tatjana is sorted into the group of P. salicina. And the questionable cultivar Wei 4709 is sorted into one group with European plums and the crosses of Wei 1866, Wei 1889 and Sämling 48-10. From these results, Wei 4709 is a cross of P. domestica and P. armeniaca. And Tatjana, formerly described as a P. cerasifera genotype, is likely to be a hybrid between P. salicina and P. cerasifera. 69 KO from Lauenburg is probably not a pure P. ceracifera genotype, but has P. salicina ancestors. ACKNOWLEDGEMENTS This research was supported by INTERREG IV Preservation of traditional fruit cultivars in the region of Oberrhein. We thank R. McCormick from the KOB for kindly correcting this manuscript. Literature Cited Beridze, R.K. and Kvatchadze, M.V. 1981. Origin and evaluation of cultivated plums in Georgia. Kulturpflanze 29:147-150. Bortiri, E., Oh, S.H., Gao, F.Y. and Potter, D. 2002. The phylogenetic utility of nucleotide sequences of sorbitol 6-phosphate dehydrogenase in Prunus (Rosaceae). American J. Bot. 89:1697-1708. Casas, A.M., Igartua, E., Balaguer, G. and Moreno, M.A. 1999. Genetic diversity of Prunus rootstocks analyzed by RAPD markers. Euphytica 110:139-149. Crane, M. and Lawrence, W. 1934. The genetic of garden plants Mac Millan, London. Decroocq, V., Hagen, L.S., Favé, M.G., Eyquard, J.P. and Pierronnet, A. 2004. Microsatellite markers in the hexaploid Prunus domestica species and parentage lineage of three European plum cultivars using nuclear and chloroplast simple-sequence repeats. Molecular Breeding 13(2):135-142. Endlich, J.V. and Murawski, H. 1962. Contribution to breeding research on plum. III. Investigation on interspecific hybrids of P. spinosa L. Züchter 32:121-133. Eryomine, G.V. 1991. New data on origin of Prunus domestica L. Acta Hort. 283:27-29. Gregor, D., Hartmann, W and Stösser, R. 1994. Cultivar identification in Prunus domestica using random amplified polymorphic DNA markers. Acta Hort. 359:33-40. 263

Hegi, G. 1923. Illustrierte Flora von Mitteleuropa Carl Hanser Verlag, München. Koller, B., Lehmann, A., McDermott, J.M. and Gessler, C. 1993. Identification of apple cultivars using RAPD markers. Theor. Appl. Genet. 85:901-904. Lee, S. and Wen, J. 2001. A phylogenetic analysis of Prunus and the Amygdaloideae (Rosaceae) using ITS sequences of nuclear ribosomal DNA. American J. Bot. 88:150-160. Maynard, C.K., Havanagh, K., Fuernkranz, H. and Draw, A. 1991. Black cherry (Prunus serotina Ehrh.). Biotechnol. Agr. For. 16:3-22. Morgan, D.R., Soltis, D.E. and Robertson, K.R. 1994. Systematic and evolutionary implications of rbcl sequence variation in Rosaceae. American J. Bot. 81:890-903. Neumüller, M. 2004. Die Hypersensibilität der Europäischen Pflaume (Prunus domestica L.) gegenüber dem Scharkavirus (Plum pox virus). Dissertation. Hohenheim University, Germany. 163p. Ohta, S., Nishitani, C. and Yamamoto, T. 2005. Chloroplast microsatellites in Prunus, Rosaceae. Molecular Ecology Notes 5:837-840. Ohta, S., Yamamoto, T., Nishitani, C., Katsuki, T., Iketani, H. and Omura, M. 2007. Phylogenetic relationships among Japanese flowering cherries (Prunus subgenus Cerasus) based on nucleotide sequences of chloroplast DNA. Plant Systematics and Evolution 263:209-225. Okie, W.R. and Weinberger, J.H. 1996. Plums. p.559-607. In: J. Janick and J.N. Moore (eds.), Fruit Breeding: Volume I: Tree and Tropical Fruits. John Wiley & Sons, New York. Rehder, A. 1940. Prunus. p.452-481. In: A. Rehder (ed.), Manual of cultivated trees and shrubs. 2 nd ed. McMillan Press, New York. Reynders-Aloisi, S. and Grellet, F. 1994. Characterization of the ribosomal DNA units in two related Prunus species (P. cerasifera and P. spinosa). Plant Cell Reports 13:641-646. Salesses, G. and Bonnet, A. 1994. Cytological studies of tetra- and octoploid interspecific hybrids between P. cerasifera, P. spinosa and P. domestica. Acta Hort. 359:26-32. Shaw, J. and Small, R. 2004. Addressing the hardest puzzle in American pomology : phylogeny of Prunus sect. Prunocerasus (Rosaceae) based on seven noncoding chloroplast DNA regions. American J. Bot. 91(6):985-996. Tutin, T.G., Heywood, V.H., Burges, N.A., Moore, D.M., Valentine, D.H., Walters, S.M. and Webb, D. 1968. Flora Europaea (Rosaceae to Umbelliferae). Cambridge Univ. Press. London. Xuan, H., Wang, R., Möller, O., Büchele, M. and Hartmann, W. 2009. Microsatellite markers (SSR) as a tool to assist in identification of sweet (Prunus avium) and sour cherry (Prunus cerasus) cultivars. Acta Hort. 839:507-514. Xuan, H., Ding, Y., Spann, D., Möller, O., Büchele, M. and Neumüller, M. 2011. Microsatellite markers (SSR) as a tool to assist in identification of European plum (Prunus domestica). 28 th IHC Lisboa 2010. Acta Hort. 918:689-692. Zohary, D. 1992: Is the European plum, Prunus domestica L., a P. cerasifera Ehrh. P. spinosa L. allo-polyploid? Euphytica 60:75-77. 264

Tables Table 1. Information about the samples investigated in this study. Species Name of cultivar TUM Weinsberg Lauenberg China P. salicina Anna Gold, Songold, Wei1475, Qiuji, Huangganli 3 0 0 2 P. cerasifera 1 KZ (16.04.08), 69 KO, Myobalane Q.A., Späte 2 0 2 0 Myobalane P. armeniaca Kompakta, Kuresia 2 0 0 0 P. spinosa Schlehe Q.A. west, Schlehe Q.A. ost, 1 SO, 9 SW 2 0 2 0 P. s. ssp. Megalocarpa P. s. ssp. Megalocarpa 0 0 1 0 P. domestica P. cerasifera Wei 260, Wei 266 2 0 1 0 P. domestica P. spinosa Wei 235, Wei 243 2 0 0 0 P. domestica P. armeniaca Sämling 44-10, Sämling 48-10 2 0 0 0 P. salicina P. armeniaca Wei 1687 1 0 0 0 (P. domestica P. cerasifera) Wei 1866 1 0 0 0 P. salicina (P. domestica P. cerasifera) P. cerasifera Wei 1889 1 0 0 0 P. domestica Wangenheims, Valjevka, Nancymirabelle 0 3 0 0 P. cerasifera P. salicina? Tatjana 1 0 0 0 P. domestica P. ameniaca? Wei 4709 1 0 0 0 Table 2. Sequences and location of 9 chloroplast microsatellites developed by Ohta et al. (2005). Marker Forward primer sequence (5-3 ) Reverse primer sequence (5-3 ) Location TPScp1 TTGAAAACGAATCCTAATG ATTTTCTTTTTCCTTTGTATTATC rpl16 intron TPScp2 AAATAGAAGACGTGTTTAAT GGTGAATAATATACGGAATC rpl16 intron TPScp3 ACTCTTTCACAAACGGATCTG CAGGCCCTGTATAGAATTT trnl-trnf TPScp4 TTTCGTTTTTCTAATTGACA ATTTGAACTGGTGACACGAG trnl-trnf TPScp5 TTTCTATCTCATTGGTCCTT ATTCGCTCTTGACAGTGAT atpb-rbcl TPScp7 CAACATAAAATAAACTGAAA ACTTAACTTTACTATATTGTTCT trnh-psba TPScp8 AGAACAATATAGTAAAGTTAAGT TGAAAGTAAAGGAGCAATAATA trnh-psba TPScp9 CTCAAGGGCAAGAATCTAAGGT CCGTTTTTTGTGATTTCTTTCT rps16 intron TPScp10 GGTTTCTTTTGAGTTATTTGAG CTTTTTTCTTATTCTTCCCCAAC rps16 intron TPScp11 TATAATTTTCTTGAGCCGTA CAATTGCAAGGATTCGATAA rps16 intron 265

266 Figurese Wei235 (domestica x spinonsa) Wei243 (domestica x spinonsa) Wei260 (domestica x cerasifera) SSR Sämling 48-10 (domestica x armeniaca) Wangenheims (domestica) Valjevka (domestica) Wei266 (domestica X cerasifera) Wei1889 ((domestica X cerasifera) X cerasifera) Nancymirabelle (domestica) 1 KZ 16.04.08 (cerasifera) Myobalane Q.A. Tatjana (prob. cerasifera x salicina) Späte Myobalane Wei1475 (salicina) Kompakta (armeniaca) Kuresia (armeniaca) Wei1687 (salicina x armeniaca.) 69 KO (cerasifera) Huangganli (salicina) Qiuji (salicina) Anna Gold (salicina) Songold (salicina) 9SW (spinosa) Wei1866 ((domestica x cerasifera) x salicina) Schlehe Q.A. west (spinosa) P.s. ssp. Megalocarpa 2 SO (spinosa) Schlehe Q.A. ost (spinosa) Sämling 44-10 (domestica x armeniaca) Wei4709 (domestica x armeniaca?) Fig. 1. Dendrogram of 7 SSRs for 30 plum samples, obtained by cluster analysis with Linkage Type Ward s Method and Distance Measure Euclid Square using GelCluster V1.0 (BioSci-software, available from the author upon request). 266

1 KZ 16.04.08 (cerasifera) Myobalane Q.A. Späte Myobalane 2 SO (spinosa) P.s. ssp. Megalocarpa 9SW (spinosa) Schlehe Q.A. ost (spinosa) Wei235 (domestica x spinonsa) Sämling 44-10 (domestica x armeniaca) Valjevka (domestica) Wei260 (domestica x cerasifera) Wei266 (domestica X cerasifera) Wei243 (domestica x spinonsa) Wangenheims (domestica) Nancymirabelle (domestica) cpssr Sämling 48-10 (domestica x armeniaca) Wei1866 ((domestica x cerasifera) x salicina) Wei1889 ((domestica X cerasifera) X cerasifera) Wei4709 (domestica x armeniaca?) Schlehe Q.A. west (spinosa) Kompakta (armeniaca) Kuresia (armeniaca) 69 KO (cerasifera) Qiuji (salicina) Huangganli (salicina) Tatjana (prob. cerasifera x salicina) Anna Gold (salicina) Songold (salicina) Wei1475 (salicina) Wei1687 (salicina x armeniaca.) 267 Fig. 2. Dendrogram of 9 cpssrs for 30 plum samples, obtained by cluster analysis with Linkage Type Ward s Method and Distance Measure Euclid Square using GelCluster V1.0 (BioSci-software, available from the author upon request). 267

268