Brssinosteroids Regulte Anthocynin Biosynthesis in the Ripening of Grpe Berries L.-Y. Lun 1, Z.-W. Zhng 1,2*, Z.-M. Xi 1,2*, S.-S. Huo 1 nd L.-N. M 1 (1) College of Enology, Northwest A&F University, Yngling, 7121, Chin (2) Shnxi Engineering Reserch Centre for Viti-Viniculture, Yngling, 7121, Chin Sumitted for puliction:jnury 213 Accepted for puliction:my 213 Key words: Grpe, nthocynin, plnt hormone, rssinosteroid, quntittive-pcr Anthocynins re importnt components in the skins of grpes nd in the development of wine colour. Vrious environmentl fctors cuse poor colortion in some res, even for the sme cultivrs plnted in different production res. The ojective of this study ws to evlute the effect of exogenous rssinosteroids () on the ccumultion of nthocynins nd gene expression of nthocynin iosynthesis in wine grpe erry skins. The results show tht totl nthocynin content in -treted grpes ws higher thn tht in the control () grpes, nd tht.4 mg/l ws the most effective tretment concentrtion. The effect of on downstrem genes ws more effective thn tht on upstrem genes. Full colortion of -treted grpes ws chieved seven dys erlier thn in the cse of. Moreover, enhnced the trnscript level of the downstrem genes of nthocynin iosynthesis, which cused the totl nthocynin content to increse. The induction of structurl nd regultory genes of the flvonoid pthwy suggests tht the interreltionships etween developmentl nd environmentl signlling pthwys were mgnified y tretment, which ctively promoted fruit colortion, nmely nthocynin iosynthesis. INTRODUION Skin colour is one of the most importnt qulities used s sis for selection in reeding progrmmes for wine grpes. As result of nturl hyridistion nd humn selection over millenni, the skin colour of grpes hs ecome gretly diversified, such s lck, red, pink, grey, white, etc. (This et l., 27). Berry colour results from the synthesis nd ccumultion of group of coloured secondry metolites clled nthocynins, nd is determined y the quntity nd composition of nthocynins. Cultivrs with coloured skins ccumulte nthocynins in their skins, wheres whiteskinned cultivrs do not (Boss et l., 1996). With regrd to the wine industry, colour is crucil for qulity in the production of premium red wines. The first sensoril contct with wine is usully mde y visul inspection, which strts uilding up the consumer s perceived qulity. This trnsltes wine colour into vlue of commercil nd economic relevnce (Cstellrin et l., 27). The presence of nthocynins in grpe erries is importnt for the fermenttive processes involved in wine production (Sprvoli et l., 1994), nd they cn interct with some rom sustnces nd influence wine flvour, though nthocynins re odourless nd nerly flvourless (Dufour & Suvitre, 2). As is known, the consumption of nthocynins nd other polyphenols hs helth enefits ssocited with the scvenging of free rdicls nd protective effects ginst crdiovsculr diseses nd so on (Liu, 21). Red grpes nd wines re prticulrly rich in ioville nthocynins, which re rpidly sored s intct molecules (Bitsch et l., 24) nd delivered into the rin within minutes of their ingestion (Pssmonti et l., 25). Therefore colortion is n importnt fctor in determining the qulity of wine grpes (Mori et l., 25). Anthocynins cn e modulted y vriety of environmentl stimuli, including developmentl signls, plnt hormones, nd environmentl stresses such s light, temperture, irrigtion nd so on (Boss & Dvies, 29). All of these things hve dul outcome: on the one hnd, vrious environmentl fctors cuse poor colortion in some res (Mori et l., 25), even for the sme cultivrs plnted in different grpe production res; nd on the other hnd, these environmentl stimuli cn e used to improve the grpe colortion. There hve een mny kinds of clssicl plnt hormones pplied to grpes to improve colortion, such s ethylene, nphthlene cetic cid, nd scisic cid, nd these hve lso een implicted in the control of ripening of grpe erries (Bn et l., 23; El-keremy et l., 23; Jeong et l., 24; Quirog et l., 29). However, very little *Corresponding uthors: E-mil: zhngzhw6@nwsuf.edu.cn; xizhumei@nwsuf.edu.cn Aknowledgements: This study ws supported y the Ntionl Technology System for Grpe Industry (CARS-3-zp-9), the Nturl Science Foundtion of Shnxi Province (211JM34) nd the Scientific Reserch Progrm of Northwest A&F University (QN2959). Our thnks lso go to the Key Lortory of Horticulturl Plnt Biology nd Germplsm Innovtion, Northwest Ministry of Agriculture, Chin 196
Brssinosteroids in the Ripening of Grpe Berries 197 is known out how rssinosteroids (s) regulte plnt growth, especilly in grpes. s, considered s the sixth group of hormones in plnts, re steroidl hormones, which re essentil for norml plnt growth nd development such s seed germintion, rhizogenesis, flowering, senescence nd scission, nd they re considered s plnt hormones nd hve pleiotropic effects (Vrdhini & Ro, 22). Symons et l. (26) showed tht the ppliction of to grpe erries evidently enhnced skin colortion nd the finl sugr level of the flesh, nd significntly promoted ripening; on the other hnd, rssinzole (Brz, n inhiitor of iosynthesis) significntly delyed fruit ripening. Peng et l. (211) found tht jsmonte-induced nthocynin ccumultion in Aridopsis seedlings ws reduced y tretment with Brz, wheres it ws enhnced y n ppliction of epirssinolide (epi-bl, the most ctive ). So s re the ltest plnt hormones implicted in the control of erry ripening nd nthocynin ccumultion. However, reports out s influencing the expression of nthocynin iosynthesis genes in grpes re few. In this experiment we therefore investigted the effect of s on nthocynin ccumultion in wine grpes. The pthwy leding to the production of nthocynins cn e divided into two prts, the generl phenylpropnoid pthwy nd the flvonoid pthwy (Fig. 1) (for review, see Boss et l., 1996c; Bogs et l., 26). This pthwy hs een chrcterised in different plnt species (Winkel, 26), especilly in Vitis vinifer (Vv), where the expression of genes involved in flvonoid synthesis (prticulrly nthocynins nd pronthocynidins) hs een well chrcterised in the erries nd seeds of oth red nd white cultivrs (Sprvoli et l., 1994; Boss et l., 1996, 1996; Bogs et l., 26; Cstellrin et l., 27). Recently, two clsses of genes ffecting nthocynin iosynthesis hve een descried. One clss includes the structurl genes of the pthwy, which is common to different species, nd the second clss includes genes tht regulte the ctivity of the iosynthetic genes, conditioning the sptil nd temporl ccumultion of pigments (Sprvoli et l., 1994). It hs een shown tht these regultory genes elong to two mjor groups of trnscription fctors, nmely the MYB nd HLH fmilies (Holton & Cornish, 1995; Sinz et l., 1997; Spelt et l., 2; Ozeki et l., 23; Rmsy et l., 23; Roins et l., 23; Borovsky et l., 24; Schwinn et l., 26). In grpes, My-relted trnscription-fctor genes (such s VlMYBA1-1, VlMYBA1-2 nd VlMYBA2) hve een isolted from mture erries, nd these My-relted genes re involved in the regultion of nthocynin iosynthesis in the grpe vi the expression of the UFGT gene (Koyshi et l., 22). In ddition, VvMYBA1, homolog of VlMYBA1-1 tht is found in mny V. vinifer cultivrs, ws shown to hve the sme function in nthocynin iosynthesis s VlMYBA1-1 (Koyshi et l., 24, 25). Wlker et l. (27) lso found tht the erry colour locus comprised two very similr genes, VvMYBA1 nd VvMYBA2, nd either gene could regulte colour in the grpe erry. Boss et l. (1996, 1996c) showed tht the expression of UFGT ws criticl for nthocynin iosynthesis in grpes. These results point out Generl Phenylpropnoid Pthwy Coumroyl-CoA CHS CHI F3H Chlcones Flvnones Dihydroflvonols DFR Leuconthocynidins LDOX Anthocynidins UFGT Anthocynins F3 H F3 5 H Flvonoid Pthwy FIGURE 1 Key steps in the flvonoid pthwy leding to the synthesis of nthocynins. The enzymes involved in the pthwy re s follows: CHS, chlcone synthse; CHI, chlcone isomerse; F3 H, flvonoid-3 -hydroxylse; F3 5 H, flvonoid- 3,5 -hydroxylse; F3H, flvnone-3β-hydroxylse; DFR, dihydroflvonol-4-reductse; LDOX, leuconthocynidin dioxygense; UFGT, UDP-Glc: flvonoid-3-o-glucosyltrnsferse. the key role of the VvMYBA1 nd VvMYBA2 trnscription fctors tht specificlly regulte the expression of UFGT, which encodes n enzyme responsile for the conversion of nthocynidins to nthocynins. Therefore, MYBA1 nd MYBA2 re essentil for the development of colortion in ripening grpe erries. The genes of nthocynin iosynthesis in grpes hve een cloned, nd detiled informtion cn e found t NCBI, which enled us to study the control mechnism of nthocynin iosynthesis t the mrna level. In this study, rel-time quntittive polymerse chin rection (Q-PCR) ws used to determine the mrna levels of eight structurl genes (CHS, CHI, F3H, F3 H, F3 5 H, DFR, LDOX nd UFGT) nd two regultory genes (MYBA1, MYBA2) of nthocynin iosynthesis precisely, which enled us to compre the mrna levels of ech exmined gene in control () nd erry skins. Thus, the ojective of this study ws to elucidte the effect of exogenous on nthocynin iosynthesis nd ccumultion in the skins of wine grpes during ripening, nd
198 Brssinosteroids in the Ripening of Grpe Berries to unrvel how regultes the nthocynin iosynthesis y compring the genes trnscript levels in nd fruit. The results will provide useful informtion for further reserch on the mechnism of regultion of nthocynin iosynthesis, s well s the effects of tretment on grpe nd wine qulities. MATERIALS AND METHODS Tretment with The experimentl vineyrd ws locted in Jingyng county, Xinyng city, in Shnxi Province in Chin. Six-yer-old own-rooted V. vinifer Cernet Suvignon grpevines of similr growth conditions nd crop lod were used in the study. The vines were spced.8 m within rows nd m etween rows, with the row oriented in north-south direction. Vines were trined on verticl shoot positioning system with pir of wires, nd shoots were trimmed mnully twice, etween loom nd vérison, to height of out m. Four tretments, nd three solutions (2,4-epirssinolide, Ruiio, Germny) of.1 mg/l (1),.4 mg/l (2) nd.8 mg/l (3), were pplied to ll clusters of ten vines in rndomised complete lock design with three replictes in seprte vine rows. The solutions were prepred y dissolving.1 mg,.4 mg nd.8 mg in 1 ml 98% ethnol (Snpu, Xin of Chin) nd ringing ech of the three solutions to 1 L with wter. Tween 8 (Bodi, Tinjin of Chin) ws dded s wetting gent t 1 ml/l. The solutions were spry-pplied t 1 ml per cluster with hnd-held spryer until run off, pre-vérison (211-7-2), ensuring tht ll erry surfces were covered. A wter/ethnol/tween 8 spry ws similrly pplied to the clusters on the vines. Bunches t similr stges of development nd t similr positions on the vine were tgged for tretment. Approximtely 1 erries from t lest 1 unches t similr positions were collected t out 12-dy intervls from 2 to 26 July. Once the grpes egn colouring, smpling ws more frequent (once week). The skin, pulp nd seeds were seprted y hnd immeditely, then frozen in liquid nitrogen nd stored t -8 C until use. Determintion of sugr nd nthocynin content Smples for solule sugr mesurements were pressed. The solule sugr ws determined in juice y the stndrd (GB/T 1538-26). The corresponding smple of 2 erries ws peeled, nd the skins were immeditely frozen in liquid nitrogen. After eing finely powdered, one liquot of g ws used for nthocynin nlyses, nd one liquot of.3 g ws used for RNA extrction. Totl nthocynins were extrcted ccording to the method of Meng et l. (212). Ech grpe extrct ws diluted with methnol solution nd sornce ws mesured t 53 nm. The nthocynin content (expressed in terms of cynidin-3-glucoside) ws clculted ccording to the method of Tng (29). RNA extrction nd quntifiction of mrna Totl RNA ws extrcted from the grpe skins following the procedure descried in Reid et l. (26). The qulity of RNA ws verified y demonstrtion of intct riosoml nds following grose gel electrophoresis in ddition to the sornce rtios (A26/28) of 1.8 to. For cdna synthesis, one microgrm of totl RNA ws reverse trnscried using the kit of TKR (Dlin, Chin), ccording to the mnufcturer s instructions. Q-PCR ws crried out using the kit of TKR (Dlin, Chin) in iq5 sequence detector (Bio-Rd, Americ), nd the primers were synthesised y Shnghi Sunny Biotechnology Co., Chin. Keeping the totl rection volume s 2 μl: 1 μl SY Premix Ex Tq TM II (2 ) (TKR, Dlin of Chin), 1 μl Forwrd Primer (1 μm), 1 μl Reverse Primer (1 μm), 1 μl cdna, 7 μl dh 2 O. The therml cycling conditions were 95 C for 3 min, followed y 95 C for 5 s nd 6 C for 3 s for 45 cycles, followed y melting cycle from 6 C to 95 C. GAPDH(m) ws chosen s the reference gene, since its expression levels remined constnt throughout the experiments (Reid et l., 26). All smples were mesured in triplicte, nd every run included the GAPDH control for ech smple. Reltive expression ws determined y normlising the vlues to tht of GAPDH. The difference etween the cycle threshold (Ct) of the trget gene nd tht of GAPDH ws used to otin the normlised expression of the trget genes (Bogs et l., 25). Primer pirs for Q-PCR were designed sed on the coding sequences ville in NCBI, nd some were retrieved from the literture. Primer pirs for CHS, F3 H, F3 5 H, DFR nd LDOX were from Sinill et l. (211); primers for F3H were from Cstellrin et l. (27); for UFGT were from Goto-Ymmoto et l. (22); nd for MYBA1 were from Jeong et l. (24). Primers for CHI nd MYBA2 were newly designed to mplify 1 to 2 p gene frgments (Tle 1). Sttisticl nlysis Sttisticl nlyses were conducted with the sttisticl softwre ANOVA (SPSS 16 for Windows), followed y Duncn multiple rnge test to determine significnt differences with regrd to ll prmeters. Vlues were considered sttisticlly significnt t P < 5. RESULTS AND DISCUSSION Accumultion of nthocynins under tretments In this study, the lst time-point efore n ccumultion of sugr is recorded ws tken s the working definition of vérison (Dvies & Böttcher, 29). The vérison of Cernet Suvignon in 211 commenced round 15 July, TABLE 1 Primers for genes of nthocynin iosynthesis newly designed in this work. Gene Sequence Forwrd primer Reverse primer CHI X75963 CACAGCCATCGGAGTGTA TGTGAATAGGCGAC MYBA2 AB97924 CGAGCAGGGTTGAATAGATG ACCCGCAATCAAGGAC
Brssinosteroids in the Ripening of Grpe Berries 199 nd ccording to the record of erry colortion in ripening mde y visul inspection, the grpes egn to colour on 26 July. Fig. 2 nd Tle 2 show the effects of the 1, 2 nd 3 tretments on the ccumultion of solule sugr in erry juices during the ripening stge. The ccumultion of sugr strted t vérison, nd it ws enhnced y ll tretments. The ptterns of sugr ccumultion were similr in ll tretments (except 1) (Fig. 2). Before the rpid ccumultion of nthocynins, the sugr content of these tretments ws 1 > 2 > 3; fter tht, the content ws 2 > 3 > 1. At hrvest, the highest sugr content ws 166.71 mg/l (2), nd the lowest ws 159.46 mg/l (). Fig. 3 nd Tle 3 show the effects of the 1, 2 nd 3 tretments on the nthocynin ccumultion in the skins of the grpes during the ripening stge. The ccumultion of nthocynins lgged significntly ehind tht of solule sugr; it ws lso enhnced y ll tretments. The ptterns of nthocynin ccumultion were similr in ll tretments, nd the content of these tretments ws 2 > 3 > 1 (Fig. 3). The highest nthocynin content ws 3.91 mg/g (2), nd the lowest ws 3.37 mg/g (). From vérison to 9 August, the speed of sugr ccumultion ws fst, except during the period when nthocynins ccumulted most rpidly (211-7-26 to 211-8-2). The rpid ccumultion of nthocynins lgged ehind tht of solule sugr y out 11 dys. From 9 August to hrvest, oth sugr nd nthocynins incresed more slowly. The grpes of were fully coloured red-purple on 29-8-9 (the full colortion period) nd fully coloured purple-lck t hrvest. The time when the nthocynins of the 2 nd 3 erries egn to improve significntly ws efore 9 August, wheres tht of 1 ws lter thn tht. So the full colortion period dvnced y seven dys under the 2 tretment, nd y three to four dys under the 3 tretment, s shown in Fig. 3. Dvies nd Böttcher (29) pointed out tht some metolic ctivities, such s the ccumultion of nthocynins in erry skins, commence t vérison, nd the nthocynin ccumultion studied y Cstellrin et l. (27) lso followed the ccumultion of solule solids. In this experiment, the pttern of nthocynin ccumultion ws different, lgging ehind solule sugr ccumultion (vérison) y out 11 dys ecuse of the cloudy nd riny wether during this period. Pigment ccumultion ws delyed when dequte sunlight ws lcking, nd then rpidly incresed when the sunlight ws dequte. Of ll the tretments, the effect of the 2 (.4 mg/l) tretment on the nthocynin content ws the most effective. Also, the 2 tretment not only enhnced the totl nthocynin content, ut full colortion ws chieved seven dys erlier thn in the. Next, the expression of the genes of nthocynin iosynthesis in the 2 nd grpes ws exmined y Q-PCR. 18 Solule sugr (mg/l) 15 12 9 6 1 2 3 3 Jul15 Jul26 Aug2 Aug9 Aug16 Aug23 Aug31 FIGURE 2 Solule sugr concentrtion in the juice of grpes from the nd tretments. Verticl rs represent stndrd devition. TABLE 2 Sttisticl nlysis of solule sugr concentrtion in the juice of grpes from the nd tretments. Jul 15 Jul 26 Aug 2 Aug 9 Aug 16 Aug 23 Aug 31 1 16.48±.46 112.81±5.37 99.13±1.72 c 147.92±2.41 158.75± 159.±5.59 16.29±6.26 cd 2 13.59±.36 1.67±.83 c 114.58±1.61 153.67±3 166.83±2.91 163.63±6.89 166.71±1.21 3 1.68±.45 d 95.6±2.88 d 11.75±2.38 156.17±1.75 157.67±4.52 c 165.4±3.15 163.92±7 c 1.72±.23 d 9±3.23 e 94.5±1.8 d 137.5±2.46 c 155.58±1.65 c 164±2.21 159.46±2.15 cd Notes: Dt re reported s men ± stndrd devition (SD) vlues; different letters ( nd ) within the sme column indicte significnt differences t the 5 level y Duncn s test.
2 Brssinosteroids in the Ripening of Grpe Berries 4.5 4 Anthocynins (mg/g) 3.5 3 2 1 2 3 1 Jul15 Jul26 Aug2 Aug9 Aug16 Aug23 Aug31 FIGURE 3 Anthocynin concentrtion (fresh weight) in the skins of grpes from the nd tretments. Verticl rs represent stndrd devition. TABLE 3 Sttisticl nlysis of nthocynin concentrtion in the skins of grpes from the nd tretments. Jul 15 Jul 26 Aug 2 Aug 9 Aug 16 Aug 23 Aug 31 1 15±2 23±2 d 2.239±6 2.833±83 3.241±66 c 3.478±36 3.549±.114 c 2 23±3 5±3 2.918±87 3.613±.16 3.674±.196 3.646±.122 3.913±99 3 22±1 34±4 c 2.355±5 3.578±.119 3.395±.188 c 3.511±.214 3.716±44 26±3 5±6 2.161±89 2.827±.153 2.923±.15 d 3.21±.137 c 3.369±45 d Notes: Dt were reported s men ± stndrd devition (SD) vlues; different letters ( nd ) within the sme column indicte significnt differences t the 5 level y Duncn s test. Response of structurl nd regultory genes of nthocynin iosynthesis to tretment The expression of eight structurl genes of the flvonoid iosynthesis pthwy (CHS, CHI, F3H, F3 H, F3 5 H, DFR, LDOX, UFGT), which ply role in nthocynin iosynthesis, nd two regultory genes (MYBA1, MYBA2) tht specificlly regulte UFGT expression, were investigted throughout ripening y Q-PCR. All of these genes were expressed t some time during erry development (Fig. 4). In the erries, CHS, CHI, F3 H, DFR nd ANS were ll expressed. F3H nd F3 5 H were expressed t low levels nd UFGT, MYBA1 nd MYBA2 exhiited no expression efore the colour-chnge period (211-7-26). On 26 July, n increse in trnscript level ws oserved for ll the exmined genes (except F3 H), which ws coincident with chnges in the colour of the grpe erries. All the genes were down-regulted fter full colortion (Fig. 4). The expression of genes for nthocynin iosynthesis ws induced y the 2 tretment (Fig. 4). In the erries, the expression of ll exmined genes ws triggered efore vérison. F3H, F3 H nd F3 5 H trnscript levels pprently were enhnced y tretment nd remined higher thn in the erries t ll stges. The expression peks of F3H, F3 H, F3 5 H, DFR, ANS, UFGT, MYBA1 nd MYBA2 dvnced y 14 dys in the erries compred to the erries. The rpid increse of CHI expression hppened on 26 July in, nd on 2 August in, so it ws thought to e rpidly expressed seven dys in dvnce, nd the time of high expression in ws seven dys longer thn in. Menwhile, the expression pek of CHS lso dvnced y seven dys (Fig. 4). The My-relted trnscription-fctor genes in grpes hve een seprted, nd those tht re involved in the regultion of nthocynin iosynthesis vi regulting the expression of UFGT (Koyshi et l., 22). Wlker et l. (27) found tht either MYBA1 or MYBA2 cn regulte colour in grpe erries. In this study, similr expression ptterns were oserved for UFGT, MYBA1 nd MYBA2. The three genes were not expressed efore the colour chnged nd were trnscried when colour ppered in the erries, nd they still hd similr ptterns (two peks) under tretment (Fig. 4). Thus, the two regultory genes hd close reltionship with UFGT. In the iosynthesis process from flvnones to dihydroflvonols, there re rnch pthwys regulted y F3H, F3 H nd F3 5 H (Fig. 1). The genes coding for the enzymes tht regulte the iosynthesis processes efore flvnones in the flvonoid pthwy re clled upstrem genes in this pper, nd genes fter tht re clled downstrem genes. Then, compred with, ll the expression peks of the genes dvnced in the -treted erries; those of the upstrem genes y seven dys, nd those of the downstrem genes y 14 dys, so the effect of on the downstrem genes ws more pronounced. The period of full colortion ws dvnced y out seven dys, similr to the rnge of the upstrem genes (CHI, CHS) in the -treted erries.
Brssinosteroids in the Ripening of Grpe Berries 21 Reltive gene expression 2 1 CHS CHI 3. F3H F3'H Reltive gene expression F3'5'H 2 DFR Reltive gene expression 1 ANS UFGT Reltive gene expression 2 1 Reltive gene expression MYBA1 MYBA2 FIGURE 4. Trnscript profiling of structurl genes nd regultory genes of nthocynin iosynthesis in the skins of erries nd treted erries. Verticl rs represent stndrd devition. Different letters ( nd ) indicte significnt differences t the 5 level y Duncn s test.
22 Brssinosteroids in the Ripening of Grpe Berries The expression of upstrem genes therefore is very importnt for nthocynin iosynthesis. The rnge of dvncement of full colortion my e limited y tht of the expression of upstrem genes (CHS nd CHI) in -treted erries. regultes nthocynin iosynthesis Peng et l. (211) showed tht ffected jsmonteinduced nthocynin ccumultion y regulting the lte nthocynin iosynthesis genes (DFR, LDOX nd UFGT). In our experiment, pprently lso incresed the expression of the downstrem nthocynin iosynthesis genes. Therefore, nthocynin ccumultion cn e enhnced y up-regulted expression of the downstrem nthocynin iosynthesis genes. CONCLUSIONS This study evluted the effect of exogenous pplied to Cernet Suvignon clusters on the ccumultion of nthocynins nd the gene expression of nthocynin iosynthesis. The 2 tretment (.4 mg/l) significntly incresed the content of solule sugr nd totl nthocynins, nd resulted in full colortion seven dys in dvnce. ffected different tissues of the erry: skin cells (nthocynin ccumultion is restricted to) nd erry flesh cells (sugr is ccumulted in). The effect of on the downstrem genes ws more effective thn on the upstrem genes. The rnges of dvncement of full colortion were limited to the expression of upstrem genes (CHI nd CHS). Moreover, 2 enhnced the trnscript level of the downstrem genes of nthocynin iosynthesis, which cused n increse in totl nthocynin content. Structurl nd regultory genes were induced under the tretment, which suggests tht mgnified the interreltionships etween the developmentl nd environmentl signlling pthwys, which promoted fruit colortion. The results from this study my help to gin n understnding of the control of fruit colortion nd provide informtion for further reserch on the regultion mechnism, s well s on grpe nd wine qulities under the regultion of s. LITERATURE CITED Bn, T., Ishimru, M., Koyshi, S., Shiozki, S., Goto-Ymmoto, N. & Horiuchi, S., 23. Ascisic cid nd 2,4-dichlorophenoxycetic cid ffect the expression of nthocynin iosynthetic pthwy genes in Kyoho grpe erries. J. Hortic. Sci. Biotechnol. 78, 586-589. Bitsch, R., Netzel, M., Frnk, T., Strss, G. & Bitsch, I., 24. Biovilility nd iokinetics of nthocynins from red grpe juice nd red wine. J. Biomed. Biotechnol. 293-298. Bogs, J., Downey, M., Hrvey, J., Ashton, A., Tnner, G. & Roinson, S., 25. Pronthocynidin synthesis nd expression of genes encoding leuconthocynidin reductse nd nthocynidin reductse in developing grpe erries nd grpevine leves. Plnt Physiol. 139, 652-663. Bogs, J., Edi, A., Mcdvid, D. & Roinson, S.P., 26. Identifiction of the flvonoid hydroxylses from grpevine nd their regultion during fruit development. Plnt Physiol. 14, 279-291. Borovsky, Y., Oren-Shmir, M., Ovdi, R., De Jong, W. & Prn, I., 24. The A locus tht controls nthocynin ccumultion in pepper encodes MYB trnscription fctor homologous to Anthocynin2 of Petuni. Theor. Appl. Genet. 19, 23-29. Boss, P.K. & Dvies, C., 29 (2 nd ed). Moleculr iology of nthocynin ccumultion in grpe erries. In: Rouelkis-Angelkis, K.A. (ed). Grpevine moleculr physiology & iotechnology. Springer-Verlg, Berlin. pp. 263 292. Boss, P.K., Dvies, C. & Roinson, S.P., 1996. Expression of nthocynin iosynthesis pthwy genes in red nd white grpes. Plnt Mol. Biol. 32, 565-569. Boss, P.K., Dvies, C. & Roinson, S.P., 1996. Anlysis of the expression of nthocynin pthwy genes in developing Vitis vinifer L cv Shirz grpe erries nd the implictions for pthwy regultion. Plnt Physiol. 111, 159-166. Boss, P.K., Dvies, C. & Roinson, S.P., 1996c. Anthocynin composition nd nthocynin pthwy gene expression in grpevine sports differing in erry skin colour. Aust. J. Grpe Wine Res. 2, 163-17. Cstellrin, S.D., Pfeiffer, A., Sivilotti, P., Degn, M., Peterlunger, E. & DI Gspero, G., 27. Trnscriptionl regultion of nthocynin iosynthesis in ripening fruits of grpevine under sesonl wter deficit. Plnt Cell Environ. 3, 1381-1399. Cstellrin, S.D., Mtthews, M.A., Di Gspero, G. & Gmett, G.A., 27. Wter deficits ccelerte ripening nd induce chnges in gene expression regulting flvonoid iosynthesis in grpe erries. Plnt 227, 11-112. Dvies, C. & Böttcher, C., 29 (2 nd ed). Hormonl control of grpe erry ripening. In: Rouelkis-Angelkis, K.A. (ed). Grpevine moleculr physiology & iotechnology. Springer-Verlg, Berlin. pp. 229 261. Dufour, C. & Suvitre, I., 2. Interctions etween nthocynins nd rom sustnces in model system. Effect on the flvor of grpe-derived everges. J. Agric. Food Chem. 48, 1784-1788. El-keremy, A., Chervin, C., Roustn, J.P., Cheynier, V., Souquet, J.M., Moutounet, M., Rynl, J., Ford, C., Ltche, A., Pech, J.C. & Bouzyen, M., 23. Exogenous ethylene stimultes the long-term expression of genes relted to nthocynin iosynthesis in grpe erries. Physiol. Plnt 119, 175-182. GB/T 1538-26, 26. Anlyticl methods of wine nd fruit wine. Stndrd Press, Beijing, Chin. Goto-Ymmoto, N., Wn, G.H., Mski, K. & Koyshi, S., 22. Structure nd trnscription of three chlcone synthse genes of grpevine (Vitis vinifer). Plnt Sci. 162, 867-872. Holton, T.A. & Cornish, E.C., 1995. Genetics nd iochemistry of nthocynin iosynthesis. The Plnt Cell 7, 171-183. Jeong, S.T., Goto-Ymmoto, N., Koyshi, S. & Esk, A., 24. Effects of plnt hormones nd shding on the ccumultion of nthocynins nd the expression of nthocynin iosynthetic genes in grpe erry skins. Plnt Sci. 167, 247-252. Koyshi, S., Goto-Ymmoto, N. & Hirochik, H., 24. Retrotrnsposoninduced muttions in grpe skin color. Science 34, 982. Koyshi, S., Goto-Ymmoto, N. & Hirochik, H., 25. Assocition of VvmyA1 gene expression with nthocynin production in grpe (Vitis vinifer) skin-color mutnts. J. Jpn. Soci. Hortic. Sci. 74, 196-23. Koyshi, S., Ishimru, M., Hirok, K. & Hond, C., 22. Myrelted genes of the Kyoho grpe (Vitis lruscn) regulte nthocynin iosynthesis. Plnt 215, 924-933. Liu, H.F., 21. Cloning nd expression of nthocynin iosynthesis relted structure genes in Vitis murensis (in Chinese). Thesis, Northest Forestry University, 26 Hexing Rd, Xingfng, Hrin, Heilongjing, Chin. Meng, J.F., Fng, Y.L., Qin, M.Y., Zhung, X.F. & Zhng, Z.W., 212. Vrietl differences mong the phenolic profiles nd ntioxidnt properties of four cultivrs of spine grpe (Vitis dvidii Foex) in Chongyi County (Chin). Food Chem. 134, 249-256.
Brssinosteroids in the Ripening of Grpe Berries 23 Mori, K., Sugy, S. & Gemm, H., 25. Decresed nthocynin iosynthesis in grpe erries grown under elevted night temperture condition. Sci Hortic-Amsterdm. 15, 319-33. Ozeki, Y., Chikgw, Y., Kimur, S., Soh, H.C., Med, K., Pornsiriwong, W., Kto, M., Akimoto, H., Oyngi, M., Fukud, T., Kod, T., Itoh, Y., Ymd, A., Dvies, E., Ueno, H. & Tked, J., 23. Puttive cis-elements in the promoter region of the crrot phenyllnine mmoni-lyse gene induced during nthocynin synthesis. J. Plnt Res. 116, 155-159. Pssmonti, S., Vrhovsek, U., Vnzo, A. & Mttivi, F., 25. Fst ccess of some grpe pigments to the rin. J. Agr. Food Chem. 53, 729-734. Peng, Z.H., Hn, C.Y., Yun, L.B., Zhng, K., Hung, H.M. & Ren, C.M., 211. Brssinosteroid enhnces jsmonte-induced nthocynin ccumultion in Aridopsis seedlings. J. Integr. Plnt Biol. 53, 632-64. Quirog, A.M., Berli, F.J., Moreno, D., Cvgnro, J.B. & Bottini, R., 29. Ascisic cid sprys significntly increse yield per plnt in vineyrdgrown wine grpe (Vitis vinifer L.) cv. Cernet Suvignon through incresed erry set with no negtive effects on nthocynin content nd totl polyphenol index of oth juice nd wine. J. Plnt Growth Regul. 28, 28-35. Rmsy, N., Wlker, A., Mooney, M. & Gry, J., 23. Two sic-helixloop-helix genes (MYC-146 nd GL3) from Aridopsis cn ctivte nthocynin iosynthesis in white-flowered Mtthiol incn mutnt. Plnt Mol. Biol. 52, 679-688. Reid, K.E., Olsson, N., Schlosser, J., Peng, F. & Lund, S.T., 26. An optimized grpevine RNA isoltion procedure nd sttisticl determintion of reference genes for rel-time RT-PCR during erry development. BMC Plnt Biol. 6, 27. Roins, M., Polocci, F., Hughes, J., Turchetti, V., Allison, G., Arcioni, S., Morris, P. & Dmini, F., 23. Sn, mize HLH gene, modultes nthocynin nd condensed tnnin pthwys in Lotus cornicultus. J. Exp. Bot. 54, 239-248. Sinz, M., Grotewold, E. & Chndler, V., 1997. Evidence for direct ctivtion of n nthocynin promoter y the mize C1 protein nd comprison of DNA inding y relted My domin proteins. Plnt Cell 9, 611-625. Schwinn, K., Venil, J., Shng, Y., Mcky, S., Alm, V., Butelli, E., Oym, R., Biley, P., Dvies, K. & Mrtin, C., 26. A smll fmily of MYBregultory genes controls florl pigmenttion intensity nd ptterning in the genus Antirrhinum. Plnt Cell 18, 831-851. Sinill, B., Ovdi, R., Nissim-Levi, A., Perl, A., Crmeli-Weisserg, M. & Oren-Shmir, M., 211. Incresed ccumultion nd decresed ctolism of nthocynins in red grpe cell suspension culture following mgnesium tretment. Plnt 234, 61-71. Sprvoli, F., Mrtin, C., Scienz, A., Gvzzi, G. & Tonelli, C., 1994. Cloning nd moleculr nlysis of structurl genes involved in flvonoid nd stilene iosynthesis in grpe (Vitis vinifer L.). Plnt Mol. Biol. 24, 743-755. Spelt, C., Quttrocchio, F., Mol, J. & Koes, R., 2. Anthocynin1 of petuni encodes sic helix-loop-helix protein tht directly ctivtes trnscription of structurl nthocynin genes. Plnt Cell 12, 1619-1631. Symons, G.M., Dvies, C., Shvrukov, Y., Dry, I.B., Reid, J.B. & Thoms, M.R., 26. Grpes on steroids. Brssinosteroids re involved in grpe erry ripening. Plnt Physiol. 14, 15-158. Tng, H.L., 29. The qulity nlyzed grpe & wine from origin producing re in MNSi county of XinJing province (in Chinese). Thesis, Northwest A&F University, 26 Hexing Rd, Xingfng, Hrin, Heilongjing, Chin. This, P., Lcome, T., Cdle-Dvidson, M. & Owens, C.L., 27. Wine grpe (Vitis vinifer L.) color ssocites with llelic vrition in the domestiction gene VvmyA1. Theor. Appl. Genet. 114, 723-73. Vrdhini, B.V. & Ro, S.S.R., 22. Accelertion of ripening of tomto pericrp discs y rssinosteroids. Phytochem. 61, 843-847. Wlker, A.R., Lee, E., Bogs, J., Mcdvid, D.A., Thoms, M.R. & Roinson, S.P., 27. White grpes rose through the muttion of two similr nd djcent regultory genes. Plnt J. 49, 772-785. Winkel, B.S.J., 26. The iosynthesis of flvonoids. In: Grotewold, E. (ed). The science of flvonoids. Springer-Verlg, Berlin. pp. 71 95.