Barley Research at Aberdeen Gongshe Hu USDA-ARS Aberdeen, Idaho
USDA-ARS Research Facilities at Aberdeen
Overview of Malting Barley Research at Aberdeen The genetic program: beta-glucan and malting quality. The breeding program: 1. Scale: 10000-12000 plots/year. 2. Malting barley vs. food barley: 80% to 20% 3. 2-row vs. 6-row: 80% to 20% 4. Spring vs. winter: 60% to 40%
Barley Breeding Nurseries Ashton- 1598m Tetonia-1764m Idaho Falls-1380m Aberdeen- 1338m Soda Springs-1764m Filer-1064m grangeville-973m Grangeville Ashton Idaho Falls Tetonia Aberdeen Soda Springs Filer
Objectives of Barley Research at Aberdeen Genetic Research: To Identify genetic materials and DNA markers with for better qualities of barley improvements. Breeding program: To develop the best cultivars of winter and spring barley: Good quality high yield.
Identification and characterization of Barley Low BG mutant Mutant of M351 derived from chemical mutagenized Harrington cultivar A Genotype BG (%) M351 1.5% Harrington 5.1 Wild-type M351 B Wild-type M351
Table 1. Grain chemical compositions of M351 mutant and the corresponding wildtype plants Components Wild-type M351 P value Moisture % 8.4 8.4 0.3534 Protein % 18.3 17.4 0.2931 Starch % 61.1 62.0 0.6860 Oil % 2.3 2.4 0.1218 MLG % 5.1 1.5 <0.001** Amylose % 21.0 20.2 0.3052 Crude Fiber % 3.5 5.7 <0.001** Soluble Glucose % 0.09 0.09 1.0000 Fructans % 1.1 2.1 <0.001** Ash % 2.3 2.3 0.3235
Table 2. Physical characteristics of M351 and the wild-type grains from 2009. Material 100 Kernel hardness index (HI) 100 Kernel weight(g) Grain broken rate in threshing Wild-type 61.20 65.80 4.8 4.5 0.5% 0.6% M351 mutant 44.80 52.30 4.7 5.1 2.4% 2.6%
Pilot scale malting test (Malteurop North America, Inc) Crop Year 2011 Variety 2011 METCALF 2011 MERIT M351 Test weight 37.98 36.80 36.64 On 7 81.4 82.6 71.8 On 6 15.6 15.6 26.4 On 5 3.0 1.8 1.8 Thru 0.0 0.0 0.0 FG dry 83.1 83.8 82.8 CG dry 83.1 83.7 82.0 Wort ph 5.83 5.83 5.67 Viscosity 1.41 1.43 1.39 DP 155 147 129 Alpha-amylase 62.2 60.1 61.5 Total protein db 10.6 9.8 11.1 Soluble protein 5.75 5.58 5.39 S / T 54.2 56.9 48.6 Beta-glucan 61 80 69 FAN 235 232 205
M351 and Its Near isogenic wildtype lines in malting and fermentation Genotype Grain beta-glucan Beta-glucan in Wort(ppm) M351 1.5% 69 Wildtype 5.1% 251 Conclusions from the Bio-ethanol fermentation Experiment (National Corn-to-Ethanol Research Center) : The mash of the wild type barley had a much higher viscosity than the mutant. After liquefaction, the wild-type was the thickest and visually different than the mutant.
DNA markers available to track the mutant gene in M351 7H Bmag564 M351/CslF6 Bmag369 DArT marker bpb-8051 bpb-1039 bpb-8117 bpb-1050 bpb-2920 bpb-5599 bpb-4692 bpb-4623 bpb-9753 bpb-8956 bpb-2097 bpb-1770 bpb-2379 bpb-7437 bpb-7603 bpb-2188 bpb-1476 cdna AA cdna AA 32-52 105-125 134-154 2566 2586 ATC GGA TCC GCC GTG GCC TTC I G S A V A F ATC GGA TCC ACC GTG GCC TTC I G S T V A F Wildtype M351 1 947 N C Cellulose Synthase domain 118 919 710-730 742-760 779-799 833-853 859-881 896-916 849A-T in M351
Using a SNP functional marker of M351 to track the allele M351F1 G/A M351F1 M351R1 CTTCGCCAAGGTTCTCGAC AGGGGTAGAGGTGGAAGAGC M351R1
QTL mapping for the malting quality traits Population of 01Ab8219 x Stellar: 6-row. F5:7 families: 175 Years: 2009, 2010 Locations: Tetonia, Aberdeen Kernel on Barley Malt Wort Wort Barley Wort S/T DP Alphaamylasglucan (ppm) Beta FAN Weight 6/64 Color Extract Color Clarity Protein Protein (%) ( ASBC) (mg) (%) (Agtron) (%) (%) (%) (20 DU) (ppm) 38.7 94.8 71.1 82.9 2.3 1.0 10.4 5.2 52.1 120.5 97.1 151.9 207.3 37.9 98.2 77.9 80.4 2.2 1.3 11.8 5.0 44.8 151.7 71.1 103.3 192.4 Yellow colored values=01ab8219; White colored values = Stellar
QTLs FOR Malting Quality Traits 0.0 4.9 5.3 3H B_2018 B_4022-3H B_4472-3H B_3179-3H B_5555-3H Protein, Wort Protein, and FAM AB 0.0 6.8 8.3 11.0 11.7 28.0 31.0 60.3 65.3 79.4 81.3 85.5 86.2 87.4 90.9 91.3 92.1 1H 2572-986 5555-438 B_9552-1H B_6065-1H ABC00875-1-3-43 4393-1078 677-411 4978-1030 10360-563 4625-1413 4005-530 B_7949-1H B_8983-1H B-5584-1H B_9611-1H B_1922-1H B_5292-1H 409-1643 2314-1412 2151-1310 6238-243 B_2087-1H/5H B_8662-1H B_1586-1H B_5672-1H B_1535-1H B_1398-1H 596-1035 3751-1136 1906-429 4226-570 B_0851-1H B_0760-1H B_9288-1H B_0301-1H B_9415-1H 0.0 1.5 1.9 3.4 3.7 6.1 7.6 9.1 10.6 25.0 25.7 28.7 0.0 17.9 22.5 22.9 25.2 2H ~100 cm B_4293 B_7557-2H B_5519-2H B_7024-2H B_4704-2H B_0615-2H B_5688-2H 3453-1974 B_7445 B_3186-2H B_8399-2H 12224-363 B_6128-2H 12100-378 791-1113 8787-1459 7747-1056 B_5326 B_4877-2H 864-594 1283-332 B_3023 1486-908 ConsensusGBS037 ABC01791-1-1-11 9291-1322 3271-1422 9701-925 3108-232 8817-798 B_9458-2H Alpha Amylase TE Kernel wt. AB/TE 0.0 4.4 14.7 18.4 21.6 0.0 5.3 8.1 8.8 10.0 17.3 30.9 32.4 36.7 37.1 38.6 42.4 45.1 46.6 54.7 ~140 cm 4H B_5568 10982-896 B_6631-3H ConsensusGBS003 13750-348 B_3899-3H B_8030 7772-223 4270-184 5692-310 6519-812 3652-872 41-695 3282-555 299-163 1241-1649 B_1509 7550-562 4919-1051 2574-410 4133-601 4986-1214 B_7719-4H B_3739-4H B_6096-4H B_8701-4H 3704-1947 8653-475 9149-1316 3416-692 424-423 5273-894 ABC09662-1-3-35 4139-888 B_6145 bpt-6067-4h B_8896-4H
Kernel wt. TE 0.0 0.7 4.3 5.8 8.1 10.8 19.4 24.3 26.9 28.1 28.8 29.9 30.7 Malt ext. AB/TE Protein AB/TE DP TE Protein AB, S/T AB, FAN AB, AA TE 31.8 33.0 36.2 38.1 40.0 47.4 53.1 55.0 61.5 0.0 11.0 16.9 5H ~70c M ABC14689-1-9-39 3056-1317 2947-1245 5440-455 11944-542 3685-894 6833-658 ABC06144-pHv86-11931-389 264-571 ABC10441-1-4-20 65-778 4234-1944 7839-633 2906-1177 ABC11529-1-1-29 ABC07010-1-2-15 1910-1343 1732-491 3218-1094 1215-862 8852-318 5565-1908 8201-86 8631-469 4166-1090 4930-1604 9766-787 152-329 1286-990 5850-2347 ABC10705-1-1-26 7276-942 3012-1125 4517-217 7681-229 5732-1104 9100-978 4977-567 421-528 3997-796 B_6183-5H 6184-200 4753-1091 ABC17471-1-3-78 B_9896-6H 552-188 585-342 ConsensusGBS039 B_2006-5H B_1420-5H B_9733 B_4318-5H B_4970-5H Protein AB/TE Malt ext., Protein, w_ protein, and DP AB/TE FAN AB/TE 0.0 3.9 6.2 9.6 11.5 12.7 14.6 16.5 17.2 18.3 19.1 20.2 21.7 22.7 23.5 25.4 26.2 28.1 29.1 47.7 50.7 51.8 54.1 55.2 55.9 59.9 61.9 64.7 67.9 72.3 0.0 1.2 1.9 6H ~65c M 5684-601 8504-785 578-587 4641-266 2968-1066 ABC06682-1-1-31 9251-852 1899-739 2607-2929 ABC10265-sfp25-3147-440 2294-573 5656-1012 ABC14687-1-4-34 3436-354 ABC13717-1-1-32 4235-1617 1565-514 2026-302 3348-395 ConsensusGBS036 8048-952 8220-1223 4313-482 11016-603 1490-959 4721-1335 ABC04676-1-1-59 4258-1498 3378-619 ABC08769-1-1-20 4070-386 ABC04725-1-1-25 B_6023-6H B_0922 B_0481-6H B_9841-6H B_6990-6H B_3141-6H 5448-298 B_9807-6H B_2058-6H B_8170 B_5211 2188-425 1628-410 B_9749-6H B_8278 B_9840 B_6669 B_7467-6H B_9651-6H B_0572-6H B_4778-6H B_5498-6H B_3433-6H 5993-2383 4547-1677 B_3070 B_0403-6H B_2137-6H B_2304-6H B_1621-6H B_7146-6H 5074-1135 B_2863-6H FAN AB Protein AB/TE 0.0 0.8 1.1 1.9 2.6 5.3 23.2 24.0 52.2 55.0 60.4 64.8 65.9 67.0 68.6 73.0 78.3 113.9 115.1 115.8 119.1 123.8 124.6 125.3 126.9 127.6 128.7 129.5 133.9 139.9 7H B_5935-7H B_6054 B_2595-7H B_7769-7H B_8043-7H B_7863-7H 6394-944 4503-246 4275-1288 1511-545 B_8939-7H B_0678-7H B_2533-7H B_5074-7H B_5732 B_5852-7H B_8140 B_6156-7H B_3589-7H B_8568-7H ABC04803-1-1-39 B_8051-7H B_9457-7H 7712-674 5138-265 6290-574 9347-437 2462-971 4589-131 11619-618 3140-491 B_4441-7H B_7517-7H B_7583 B_3703-7H B_1591-7H 977-1377 B_6301 B_4856-7H B_3419-7H B_0182-7H B_8867-2H 7H 7397-854 7216-297 6628-1302 13008-352 B_8778-7H B_2328-7H B_6166-7H B_5923-7H B_0917-7H B_1645 B_0889-7H 4991-1028 8758-564 7180-778
Cultivars Released recently in the Breeding Program Winter barley malt cultivars: Charles (2006). Endeavor (2009) Both cultivars have been planted in Idaho for more than 10000 Acres Spring malt Cultivars: Sublette (2006) Spring food barley cultivars: Tetonia (2009) Julie (2012)
Charles Winter barley Cultivar Cultivar Grain yield Bu/Acre Extract Charles (2-row) 161 81.3 Eight-Twelve (Feed) 178 88AB536-B (6-row) 147 68.9
Endeavor Winter Barley Cultivar Cultivar Grain Yield (Bu/A irrigated) Height (cm) BG (g/kg) DP Endeavor 145.8 90.5 170 137* Charles 145.0 81.5 193 119 88AB536-B 134.0 97.3 Endeavor has better winter hardiness than Charles
Sublette Spring Malting Cultivar Cultivar Grain Yield (Bu/A. In 40 yearlocations) % Plump Kernel AA BG (ppm) Sublette 121.9 95 62 255 144 Harrington 117.3 85 68 407 108 Merit 124.7 88 52 201 159 DP
Elite Lines of 2-row winter Barley Name Year/ locations Mean Yield (Bu/A) Yield mean% Extract% DP AA Endeavor 27 129.6 99.3 78.5 125.5 101.2 Charles 24 135.0 100.0 79.6 132.9 93.7 Maja 14 145.6 99.8 78.4 124.9 43.9 02Ab339 22 144.7 110.5 80.4 131.0 97.6 02Ab431 22 145.7 109.1 80.9 141.2 86.8 02Ab170 22 140.8 107.3 79.9 106.3 100.2 02Ab597 20 147.2 111.0 80.9 103.9 78.2 02Ab948 22 137.7 104.9 80.2 119.2 90.1 02Ab641 17 135.4 109.6 81.5 107.2 94.8 02Ab669 24 147.8 109.5 81.7 111.0 104.7 02Ab348 22 140.8 107.2 81.2 92.9 97.1 02Ab671 22 142.3 108.4 80.8 94.4 96.2 02Ab712 22 142.2 108.4 81.4 116.8 104.3 02Ab710 22 139.1 106.0 81.4 126.5 53.3 4Ab08-X03W044-11 7 163.0 116.9 76.8 104.7 82.4 4Ab08-X03W044-9 7 143.9 103.2 78.8 98.7 96.1
Winter Hardiness Screening in Soda Spring Line Barley Type %Spring Stand 02Ab170 2-M 85/100/90 4Ab08-X03W044-11 6-M 95/100/100 02Ab645 2-M 100/95/40 02Ab339 2-M 100/95/60 02Ab710 2-M 100/70/85 4Ab08-X03W044-9 6-M 100/98/95 2Ab09-X05W048-100HL 2-Food 100/95/90 2Ab09-X05W048-85 2-Food 100/85/95 2Ab09-X05W048-318HL 2-Food 100/70/80 2Ab09-X05W049HL-15 2-Food 100/95/90 Schuyler 6-F 100/100/100 Charles 2-M 80/80/75 Endeavor 2-M 95/95/90 8-12 6-F 95/95/90 Finess 2-F 100/85/85 SunStar pride 6-F 100/98/95 Lewjain (WW) Winter wheat 98/98/95
Winter hardiness of the lines in pilot test (Soda Spring) Genotype Yield (2011-2012 dryland) Spring Stand% (Soda Spring) 02Ab431 71 85/80/60 02Ab671 72 100/85/100 02Ab669 75 95/80/85 Charles 76 80/80/75 Endeavor 80 95/90/95
Malting barley lines in the UI extension Winter Nursery (Aberdeen and Rupert) Cultivar Type Average Yield (Bu/A) Spring Stand (% AB/Rupert) Alba 6-M 180 98/95 93Ab669 6-M 178 98/88 02Ab431 2-M 163 97/95 OR92 6-M 171 97/98 OR91 6-M 172 99/94 02Ab671 2-M 148 96/90 Maja 6-M 154 97/98 Charles 2-M 149 98/95 Endeavor 2-M 162 96/98 OR818 6-M 145 95/99 Mathias 6-M 128 98/98
Winter Hardiness Screening in 2012-2013 To repeat the screening process on our elite materials. To expand to some materials from germplasm collections. To look for an additional nursery location in Idaho Falls area.
Elite Spring barley Lines 02Ab17271 (Spring 2-row): Under plant scale Evaluation. 02Ab04-X01084-27 (Spring 2- row): Passed the 2nd year of pilot scale evaluation 01AB9663 (Spring 6-row): Passed the 2 nd year of pilot test.
Yield Potential of the Spring Elite lines Variety or Selection Yield (% of control) (Yr/location) Kernel Weight (mg) on 6/64" (%) Malt Extract (%) 2Ab04-X01084-27 108.8 (39) 43.2 98.4 82.5 02Ab17271 105.7 (52) 44.8 97.2 83.5 CDC Copeland 100.5 (10) 46.0 99.2 82.4 M69 99.6 (30) 42.4 96.7 81.7 HARRINGTON 100.0 (52) 39.3 96.4 82.6 6-row 01Ab9663 122.5 (44) 39.9 98.1 82.7 Tradition 118.3 (46) 37.3 98.5 80.3 Morex 100.0 (44) 37.3 97.9 83.0
Summary for the Aberdeen Barley Program Genetic research provided good materials and markers for better barley cultivar development. Breeding program developed barley cultivars used in production. Winter malting lines with better winter hardiness and yield potential developed and are under pilot scale tests.
Future studies Look for molecular marker-assistant selection in special traits. Focus on 2-row malting barley for better malting quality and high yield. Enhance the winter malting barley cultivars: focusing on better winter hardiness and malting quality. Look for new technologies for speed up the winter cultivar development such as DH.
AMBA Acknowledgements Idaho Barley Commission Collaborators: BARI, Eric Jackson, Emir Islamovic, Pat Hayes, Juliet Marshal, USDA-ARS, Madison, WI. Cooperator Growers: Dave Bodine, Evan Hayes, Clark Kauffman, Craig Ozburn, Sid Cellan Genetics/Breeding program Gongshe Hu Chris Evans Kathy Satterfield Sherry Ellberg Natalie Klassen