Fragaria (Strawberry) Post-Entry Quarantine Testing Manual

Fragaria (Strawberry) Post-Entry Quarantine Testing Manual May 2016

Disclaimer The information in this document is intended by way of general guidance only. It is not intended to take the place of, or represent the law of New Zealand. It is not intended as legal advice and should not be relied upon as such. Considerable effort has been made to ensure that the information provided in this document is accurate, up to date, and otherwise adequate in all respects. However, the Ministry for Primary Industries New Zealand, its employees, agents, and all other persons associated with the compilation, writing, editing, approval or publication of, or any other kind of work in connection with, the information: 1. disclaim any and all responsibility for any inaccuracy, error, omission, lateness or any other kind of inadequacy, deficiency, or flaw in, or in relation to, the information; and 2. without limiting (1) above, fully exclude any and all liability of any kind, on the part of any and all of them, to any person or entity that chooses to rely upon the information. This document may change from time to time. Crown Copyright - Ministry for Primary Industries

Contents Page 1 Scope 1 2 Introduction 1 3 Import requirements 2 3.1 Nursery stock 2 3.2 Seeds for sowing 3 3.3 Regulated pests and diseases 3 4 Testing methods 5 4.1 Sampling and time of testing 5 4.2 Graft indexing 5 4.3 Herbaceous indexing 7 4.4 Enzyme-linked immunosorbent assay (ELISA) 8 4.5 Polymerase chain reaction (PCR) 9 4.6 Microscopic inspection for mites 11 5 Contact point 12 6 Acknowledgements 12 7 References 13 8 Appendices 15 Appendix 1: Symptoms of significant regulated diseases in Fragaria 16 A1.1 Candidatus Phlomobacter fragariae 16 A1.2 Xanthomonas arboricola pv. fragariae 16 A1.3 Xanthomonas fragariae 17 A1.4 Aster yellows phytoplasma 17 A1.5 Strawberry green petal phytoplasma 18 A1.6 Strawberry multiplier phytoplasma 18 A1.7 Strawberry yellows phytoplasma 18 A1.8 Strawberry latent C virus 18 A1.9 Strawberry pallidosis-associated virus 19 A1.10 Strawberry pseudo mild yellow edge virus 19 A1.11 Strawberry vein banding virus 19 A1.12 Tobacco necrosis virus 19 A1.13 Tomato ringspot virus 20 A1.14 Strawberry lethal decline disease 20 Appendix 2: Symptoms of nutrient deficiencies in Fragaria 21 A2.1 Nitrogen deficiency 21 A2.2 Magnesium deficiency 21 A2.3 Phosphorus deficiency 21 A2.4 Potassium deficiency 21 A2.5 Manganese deficiency 22 A2.6 Iron deficiency 22 A2.7 Zinc deficiency 22 Appendix 3: Graft indexing protocol 23 Appendix 4: Herbaceous indexing protocol 24 Appendix 5: Nucleic acid extraction protocols for PCR 25 i

Appendix 6: PCR protocols 26 A6.1 PCR protocol for plant DNA as an internal control conventional PCR 27 A6.2 PCR protocol for plant DNA as an internal control qpcr 28 A6.3 PCR protocol for plant RNA as an internal control conventional PCR 29 A6.4 PCR protocol for plant RNA as an internal control qpcr 30 A6.5 PCR protocol for Candidatus Phlomobacter fragariae 31 A6.6 PCR protocol for Erwinia pyrifoliae 32 A6.7 PCR protocol for Xanthomonas arboricola pv. fragariae 33 A6.8 PCR protocol for Xanthomonas fragariae 34 A6.9 PCR protocol for Xylella fastidiosa 35 A6.10 PCR protocol for phytoplasmas conventional nested-pcr 36 A6.11 PCR protocol for phytoplasmas qpcr 38 A6.12 PCR protocol for Raspberry ringspot virus 39 A6.13 PCR protocol for Strawberry latent ringspot virus 40 A6.14 PCR protocol for Strawberry vein banding virus 41 A6.15 PCR protocol for Tobacco necrosis virus 42 A6.16 PCR protocol for Tomato ringspot virus 43 ii

1 Scope The scope of this manual is limited to nursery stock (cuttings [runner tips, stem cuttings] and plants in tissue culture only) and seed for sowing of Fragaria species permitted entry into New Zealand as listed in the Ministry for Primary Industries (MPI) Plants Biosecurity Index (see: https://www1.maf.govt.nz/cgi-bin/bioindex/bioindex.pl). At the date of publication of this manual, these species were as follows: Fragaria chiloensis Fragaria moschata Fragaria vesca Fragaria virginiana Fragaria ananassa This manual describes the testing protocols specified in the import health standards for these commodities and also provides an introduction to the crop. 2 Introduction The strawberry is a member of the Rosaceae family and belongs to the genus Fragaria (derived from the Latin, fragare, meaning pleasant aroma). While there are over 20 named species, most cultivated strawberries have originated from six main species from Europe, North America and Chile. The main Fragaria species include vesca (with 4 subspecies), viridis, moschata, virginiana (4 subspecies) and chiloensis (4 subspecies). Most cultivated strawberries are descendents of F. chiloensis and F. virginiana (F. ananassa) and are octoploids (2n=56). F. vesca, the woodland strawberry used as a virus indicator, is diploid (2n=14). Tetraploids and hexaploids are also known (Staudt, 1962). Up until the late 1700s, most strawberries were selections of individual species with fruit around 10 mm or smaller in diameter. By 1759, hybridisation between F. chiloensis and F. virginiana resulted in increased fruit size and quality. Most modern strawberries are categorised as Fragaria ananassa, this name reflecting the mix of multiple species. The strawberry is a perennial herb. The crown of the plant is a very short stem, with leaves and axillary buds borne in a restricted area of the apex. Leaves are usually trifoliate but vary in number from 1 to 5. Buds formed in the axils of the leaves may develop into branch crowns (leafy shoots) or stolons (runners). The distal end of the runner normally develops into a runner plant, or daughter plant, with roots on the underside and leaves at the tip. The strawberry is not a true fruit. It is actually an enlarged fleshy receptacle upon which many hard single-seeded achenes are borne. The size of the fruit is a reflection of the number of achenes (Dana, 1980). Strawberries are probably the most popular berryfruit grown worldwide. They are mostly eaten fresh but there is a substantial international trade in frozen fruit, with the fruit used in a wide range of products including jams, dairy food and bakery products. Strawberries are cultivated in most places throughout the world from the Arctic Circle to the tropics. World production is estimated at 2.8 million tonnes per year. The USA, China and Spain are the biggest producers worldwide, with New Zealand producing very small quantities in world terms, about 6000 tonnes per year (Strawberry Growers NZ estimates). This is grown on Ministry for Primary Industries Fragaria Post-Entry Quarantine Testing Manual 1

about 200 ha producing about 30 t/ha. The major production sites are based in the Auckland and Waikato regions but there are strawberry growers located in most areas of New Zealand. There has been recent interest in the tetraploid musk strawberry F. moschata, reported to be the most aromatic strawberry of all. Known as hautbois in France, and hautboy in England, the musk strawberry has mottled brownish-red or rose-violet skin and tender white flesh. The fruit has a spicy floral aroma and the flavour is complex with hints of honey, musk and wine. There are also decorative types grown for their ornamental value as well as ground cover types. Pink-flowered ornamental types grown from seed with edible fruit are also now available (Bentvelsen & Bouw, 2006). Duchesnea indica (formerly Fragaria indica) is a species with golden-yellow flowers and round, red insipid fruit with hard seeds. This species is seen in New Zealand gardens where it is used as a ground cover but is also considered a weed by some gardeners. There are two main strawberry types cultivated for fruit production in New Zealand, short-day (June-bearing) and day-neutral (ever-bearing). The terms relate to the conditions required for flower initiation, with short-day types initiating flowers during periods of short days (autumn to spring), while day-neutrals initiate flowers at any time when temperatures allow growth. Up until 2006, most cultivars present in New Zealand came from the University of California breeding programme. Camarosa was the most popular with Gaviota, Pajaro and Ventana, also important. These are all short-day types. In the South Island, day-neutral types dominate with Seascape, Aromas and Sunset being the most popular. There is no breeding programme currently underway in New Zealand. Importation is primarily targeted at potential cultivars for direct commercial use. Characteristics of importance are flavour, shelf life, fruit size, pest and disease resistance, weather tolerance, and yield. 3 Import requirements 3.1 NURSERY STOCK The import requirements for nursery stock (cuttings and plants in tissue culture) of Fragaria are set out in MPI s import health standard 155.02.06 Importation of Nursery Stock (https://www.mpi.govt.nz/importing/plants/nursery-stock/requirements/). Imported nursery stock must meet the general requirements (Section 2) and the specific requirements detailed in the Fragaria schedule (Section 3). In summary, an import permit is required and a phytosanitary certificate must accompany all consignments certifying that the seed has been inspected in accordance with appropriate procedures and found to be free of any visibly detectable regulated pests, and conforms to New Zealand s current import requirements. Upon arrival in the post-entry quarantine facility, cuttings must be dipped in 1% sodium hypochlorite for 2 minutes. Nursery stock must be grown for a minimum period of 16 months in a Level 3 post-entry quarantine facility where it will be inspected, treated and/or tested for regulated pests. 2 Fragaria Post-Entry Quarantine Testing Manual Ministry for Primary Industries

3.2 SEEDS FOR SOWING The import requirements for Fragaria seeds for sowing are set out in MPI s import health standard 155.02.05 Seeds for Sowing (http://mpi.govt.nz/importing/plants/seeds-forsowing/requirements/). Imported seed for sowing must meet the general requirements in Part 1 (e.g. cleanliness, labelling and a phytosanitary certificate). Upon arrival in New Zealand, each line of seed will be inspected to verify that the seed and associated documentation is compliant with the requirements of this import health standard. Seedlings grown from imported Fragaria seed must be in active growth for a minimum period of 6 months in a Level 3 post-entry quarantine facility where they will be inspected, treated and/or tested for regulated pests as listed in the specific requirements (Part 2). 3.3 REGULATED PESTS AND DISEASES A complete list of regulated pests and diseases of Fragaria can be found in the nursery stock and seeds for sowing import health standards. The import health standards describe the measures required for each regulated organism. These measures can be generic (i.e. growing season inspection) and/or specific (e.g. PCR, ELISA). This manual describes only the specific testing requirements which are listed in Table 1A (nursery stock) and Table 1B (seeds for sowing). Refer to the import health standard for the list of organisms requiring generic inspection. Photographs of symptoms caused by significant regulated diseases can be found in Appendix 1. It is important to be aware that pot-grown plants can be prone to nutrient deficiencies if not adequately fertilised and nutrient deficiencies can resemble virus infection e.g. chlorosis and necrosis. Photographs of the common nutrient deficiencies of Fragaria can be found in Appendix 2. Ministry for Primary Industries Fragaria Post-Entry Quarantine Testing Manual 3

Table 1A: Regulated pests and diseases of Fragaria nursery stock for which specific tests are required ( ) or alternative ( ) Organism type Graft indexing Herbaceous indexing ELISA 1 PCR 2 Microscope inspection Mites (Plants in tissue culture only) Refer to import health standard Bacteria or bacteria-like organisms Candidatus Phlomobacter fragariae (Strawberry marginal chlorosis) Erwinia pyrifoliae Xanthomonas arboricola pv. fragariae Xanthomonas fragariae Xylella fastidiosa 3 Phytoplasmas Refer to import health standard Viruses Fragaria chiloensis latent virus 4 Raspberry ringspot virus Strawberry chlorotic fleck virus Strawberry latent C virus Strawberry latent ringspot virus 4 Strawberry mild yellow edge-associated virus Strawberry pallidosis-associated virus Strawberry pseudo mild yellow edge virus Strawberry vein banding virus Tobacco necrosis virus 4 Tobacco streak virus 4 Tomato bushy stunt virus Tomato ringspot virus 4 Diseases of unknown aetiology Strawberry feather leaf disease Strawberry lethal decline disease 1ELISA = Enzyme-linked immunosorbent assay 2PCR = Polymerase chain reaction 3PCR testing is only required for Fragaria vesca 4Strains not in New Zealand Table 1B: Regulated diseases of Fragaria seeds for sowing for which specific tests are required ( ) or alternative ( ) Organism type Herbaceous ELISA 1 PCR 2 indexing Viruses Fragaria chiloensis latent virus Raspberry ringspot virus Strawberry latent ringspot virus 3 Tobacco streak virus 3 Tomato ringspot virus 3 1ELISA = Enzyme-linked immunosorbent assay 2PCR = Polymerase chain reaction 3Strains not in New Zealand 4 Fragaria Post-Entry Quarantine Testing Manual Ministry for Primary Industries

4 Testing methods 4.1 SAMPLING AND TIME OF TESTING The import permit will be written specifically for each consignment, and will be agreed between the MPI Plant & Plant Product Imports team, the Containment Verifier, the diagnostic facility and importer prior to permit issue. The import permit will specify how plants may be bulked for testing and other details such as what plants are eligible for biosecurity clearance. Each of the specific tests required in the import health standard (as summarised in Tables 1A and 1B) and listed in the import permit must be done irrespective of whether plants exhibit symptoms. This testing is required to detect latent infections. Imported tissue culture plantlets must be deflasked and grown in sterile growing media under glasshouse conditions prior to testing. Binocular examination of leaves for mites should be carried out while the plants are in active growth within 2 months after deflasking. Tissue culture plantlets must go through a period of dormancy before biological indexing and laboratory tests for viruses to increase the virus titre. Graft and herbaceous indexing must be done in the early spring using young, vigorous indicator plants for graft assays. Laboratory tests for viruses (ELISA and RT-PCR) must be carried out on new growth while the plants are growing under spring-like glasshouse environmental conditions. Laboratory tests for phytoplasmas and bacteria (PCR) must be carried out while the plants are growing under summer-like glasshouse environmental conditions. For each Fragaria plant, at least two young fully-expanded leaves must be sampled from the apical crown region. The sampled leaves from each plant must be tested as soon as possible after removal from the host plant. If samples have to be stored before testing, the leaves must be kept whole, all surface water must be removed, and they must be stored in a plastic bag at 4 o C for no more than 7 days. Samples that become partially decayed or mouldy must not be tested but further samples must be collected. 4.2 GRAFT INDEXING Each Fragaria plant must be tested by leaf-grafting onto two replicate indicator cultivars as listed in Table 2. The minimum number of indicators can be achieved by using the following cultivars: Fragaria vesca EMB or EMK, UC-5, Alpine and Fragaria virginiana UC- 10 or UC-11. The recommended protocol for graft indexing can be found in Appendix 3. Controls required (a) Negative control: ungrafted plants of each indicator cultivar or indicator plants that have been grafted with its own scion material, i.e. self-grafted (b) Positive control (optional): non-regulated virus grafted onto appropriate indicator cultivar Source of positive control Strawberry mottle virus is a non-regulated virus which produces symptoms on Fragaria vesca EMK and UC-4 and Fragaria virginiana UC-12. Ministry for Primary Industries Fragaria Post-Entry Quarantine Testing Manual 5

Interpretation of results The expected symptoms induced by the regulated viruses and diseases of unknown aetiology are described in Table 3. The graft indexing results will only be considered valid if no symptoms are produced on the negative controls (ungrafted or self-grafted plants). If the optional positive control (non-regulated virus) was used, then the correct symptoms must be produced on the indicator cultivar (Table 3). Table 2: Fragaria indicator cultivars required for graft indexing Target organism Viruses Strawberry chlorotic fleck virus Strawberry latent C virus Strawberry mild yellow edge-associated virus Strawberry pallidosis-associated virus Strawberry pseudo mild yellow edge virus Strawberry vein banding virus Diseases of unknown aetiology Strawberry feather leaf disease Strawberry lethal decline disease Fragaria indicator cultivar Fragaria vesca EMB or EMK Fragaria vesca EMC or UC-5 Two of the following indicators: Fragaria vesca UC-4 or UC-5 or Alpine Fragaria virginiana UC-10 or UC-11 Fragaria vesca UC-4 or Alpine or Fragaria virginiana UC-12 Two of the following indicators: Fragaria vesca UC-5 or UC-6 or Alpine or Fragaria virginiana UC-12 Fragaria vesca UC-1 or UC-4 or Alpine Fragaria vesca Alpine Table 3: Symptoms produced by each of the regulated graft transmissible pathogens by graft indexing Pathogen Indicator species Symptoms on indicator Viruses Strawberry chlorotic fleck virus Fragaria vesca EMB and EMK Distortion and down-curling of the young leaves. Vein clearing followed by the appearance of small chlorotic spots is sometimes evident. Strawberry latent C virus Fragaria vesca EMC and UC-5 Severe epinasty of young leaflets followed by moderate to severe dwarfing without epinasty, mottling or distortion (Figure A1.8). Strawberry mild Fragaria vesca UC-4, yellow edgeassociated virus UC-5 and Alpine Leaflets cupped, chlorotic margins and vigour reduced. Strawberry pallidosisassociated virus Strawberry pseudo mild yellow edge virus Strawberry vein banding virus Diseases of unknown aetiology Strawberry feather leaf disease Fragaria virginiana UC- 10 and UC-11 Fragaria vesca UC-4 and Alpine Fragaria virginiana UC- 12 Fragaria vesca UC-5, UC-6 and Alpine and F. virginiana UC-12 Fragaria vesca UC-1, UC-4 and Alpine Strawberry lethal Fragaria vesca Alpine decline disease Positive control virus Fragaria vesca EMK, Strawberry mottle UC-4 and F. virginiana virus UC-12 Small chlorotic leaves; runners may be shortened; severe strains can be lethal (Figure A1.9). Mottled discolouration (yellow to red) followed by premature necrosis (Figure A1.10). Yellow to reddish colouration with necrotic areas in older leaves. Vein banding, leaf curl or necrosis depending on the virus isolate (Figure A1.11). Vein banding symptoms, seen as chlorotic banding along the primary and secondary veins, are most intense in the first few leaves that develop after grafting. Leaves that develop later may show discontinuous streaks or mild chlorosis along the veins, or no symptoms. Symptoms of necrosis may develop on mature leaves. The net veins may become necrotic, followed by necrosis of the interveinal tissues. Feather-leaf symptoms including dwarfing, leaves narrowed, strap-like, somewhat rugose, with deeply serrated margins, and leaflets that may be fused at the base. Other symptoms include vein clearing or fasciation and translucent spots on young leaves. Development of bronzed, wilted leaves (Figure A1.14). Leaf mottle. 6 Fragaria Post-Entry Quarantine Testing Manual Ministry for Primary Industries

4.3 HERBACEOUS INDEXING The herbaceous indicator species required are shown in Table 4. The recommended protocol for herbaceous indexing can be found in Appendix 4. Controls required (a) Negative control: inoculation buffer only (b) Positive control: non-regulated virus Source of positive control Arabis mosaic virus is an effective virus to use for the positive control as it produces clear symptoms on all of the required indicator species. Arabis mosaic virus may be purchased from DSMZ (https://www.dsmz.de/) or other commercial suppliers. Interpretation of results The expected symptoms induced by the regulated viruses are described in Table 5. The herbaceous indexing results will only be considered valid if: (a) the positive control (non-regulated virus) produces the correct symptoms on the indicator hosts (Table 6); and (b) no symptoms are produced on the indicator hosts with the inoculation buffer negative control. Table 4: Herbaceous indicators required for the detection of regulated viruses Indicator species No. of plants Plant stage for inoculation Chenopodium quinoa (Cq) 2 4-6 fully expanded true leaves Cucumis sativus (Cs) 2 Expanded cotyledons, first true leaves 1-2 mm Table 5: Symptoms produced by each of the regulated viruses on herbaceous indicators Virus Test viruses Fragaria chiloensis latent virus Indicator species Symptoms on indicator Cq Systemic mottle, chlorotic patches and stunting. Cs Systemic mottle, chlorotic patches and stunting. Raspberry ringspot virus Cq Chlorotic or necrotic local lesions, systemic chlorotic mottle or apical necrosis. Chlorotic or necrotic local lesions, systemic chlorosis and deformation, necrosis Cq or faint chlorotic mottle. Strawberry latent ringspot virus Tobacco necrosis virus Tobacco streak virus Tomato bushy stunt virus Tomato ringspot virus Positive control virus Arabis mosaic virus Cs Cq Cs Cq Cs Cq Cq Cs Cq Cs Chlorotic local lesions or none, systemic interveinal chlorosis or necrosis, recovery in summer, in winter symptoms may persist. Some isolates induce enations. Necrotic local lesions, usually no systemic spread. Necrotic local lesions, usually no systemic spread. Necrotic local lesions, systemic necrosis. Chlorotic local lesions. Chlorotic local lesions, rarely systemic. Chlorotic local lesions on inoculated leaves followed by systemic apical necrosis. Yellow local lesions on inoculated cotyledons followed by necrosis and withering of cotyledons, mosaic, distortion, necrosis, and stunting of the leaves. Local lesions, systemic chlorotic mottling. Chlorotic local lesions, systemic yellow spots or vein banding, subsequently fading. Ministry for Primary Industries Fragaria Post-Entry Quarantine Testing Manual 7

4.4 ENZYME-LINKED IMMUNOSORBENT ASSAY (ELISA) ELISA is an alternative test along with PCR for some viruses listed in the import health standard for Fragaria (Tables 1A and 1B). At the MPI Plant Health and Environment Laboratory (PHEL), PCR tests are used rather than ELISA when possible because PCR is generally more sensitive, reliable and faster than ELISA. The antisera listed in Table 6 have been tested by the MPI Plant Health and Environment Laboratory. Alternative antisera and positive controls are available from other manufacturers. Further information on the suppliers listed in Table 6 can be found on their websites: Agdia Incorporated, USA (http://www.agdia.com). Bioreba AG, Switzerland (http://www.bioreba.com). Loewe Biochemica GmbH, Germany (http://www.loewe-info.com). The ELISA is performed according to the manufacturer s instructions. Each of the samples and controls are added to duplicate wells of the ELISA plate. Controls required (a) Positive control: infected leaf tissue or equivalent (Table 6) (b) Negative control: Fragaria leaf tissue that is known to be healthy (c) Buffer control: extraction buffer only Source of controls Positive and negative controls may be obtained from the commercial suppliers listed in Table 6 or from other commercial suppliers. Interpretation of results A result is considered positive if the mean absorbance of the two replicate wells is greater than 2 times the mean absorbance of the negative control. The test will only be considered valid if: (a) the absorbance for the positive and negative controls are within the acceptable range specified by the manufacturer; and (b) the coefficient of variation (standard deviation / mean 100), between the duplicate wells is less than 20%. If the test is invalid, it must be repeated with freshly-extracted sample. Samples that are close to the cut-off must be retested at a later date. Table 6: Source of antisera and positive controls for ELISA Virus Antisera 1 Positive control 2 Raspberry ringspot virus Loewe Cat. No. 07141C Loewe Cat. No. 07144PC Strawberry latent ringspot virus Agdia Cat. No. SRA 14000 Agdia Cat. No. LMC 14000 Loewe Cat. No. 07115C Loewe Cat. No. 07115PC Tobacco necrosis virus Bioreba Cat. No. 152465 Bioreba Cat. No. 152453 Loewe Cat. No. 07036C Loewe Cat. No. 07046PC Tomato ringspot virus Agdia Cat. No. SRA 22000 Agdia Cat. No. LPC 22000 1Catalogue numbers for the complete reagent sets are given, the antisera and reagents can also be purchased separately. 2The positive control is included if the complete reagent set is purchased. 8 Fragaria Post-Entry Quarantine Testing Manual Ministry for Primary Industries

4.5 POLYMERASE CHAIN REACTION (PCR) PCR primers and probes used to detect regulated pathogens of Fragaria are listed in Table 7A and the internal control primers and probes for RNA and DNA are listed in Table 7B. The inclusion of an internal control assay is recommended to eliminate the possibility of PCR false negatives due to extraction failure, nucleic acid degradation or the presence of PCR inhibitors. Conventional and qpcr assays are provided for phytoplasmas and the DNA and RNA internal controls, however, only one assay is required for testing. The internal control assay can be multiplexed in the same tube as the pathogen-specific assay if the primer (and probe) concentrations have been optimised to prevent low pathogen levels being outcompeted by high levels of plant DNA used as the internal control. For qpcr the probe will need to be labelled with a different reporter dye than that used for the pathogen-specific assay. The nucleic acid extraction protocols are described in Appendix 5. The PCR protocol for each of the regulated pathogens and the internal controls is described in Appendix 6. The PCR reagents used in Appendix 6 have been tested by the MPI Plant Health and Environment Laboratory. Alternative reagents may give similar results but will require validation. Controls required (a) Positive control: nucleic acid or a cloned fragment from the appropriate pathogen (b) No template control: water is added instead of nucleic acid template When setting up the test initially, it is advised that a negative control (nucleic acid extracted from healthy Fragaria leaf tissue) is included. The Nad5 internal control PCR primers do not reliably amplify a product from RNA extracted from freeze-dried material. It is therefore recommended to mix fresh healthy Fragaria leaf material with freeze-dried positive control material (~3:1 w/w) prior to carrying out the extraction. Source of positive controls Agdia Incorporated, USA (http://www.agdia.com) DSMZ GmbH, Germany (http://www.dsmz.de) Landcare Research International Collection of Micro-Organisms from Plants ICMP; (http://nzfungi.landcareresearch.co.nz/icmp/search_cultures.asp) Neogen Europe Ltd (http://www.neogeneurope.com) Other commercial suppliers Scientific community PCR analysis Analyse the conventional PCR products by agarose gel electrophoresis. Analyse qpcr data according to the thermocycler manufacturer s instructions. Ministry for Primary Industries Fragaria Post-Entry Quarantine Testing Manual 9

Table 7A: PCR primers and probes used for the detection of regulated pathogens of Fragaria Target organism Bacteria Candidatus Phlomobacter fragariae Erwinia pyrifoliae Xanthomonas arboricola pv. fragariae Xanthomonas fragariae Xylella fastidiosa Phytoplasmas Universal phytoplasma Viruses Raspberry ringspot virus Strawberry latent ringspot virus Strawberry vein banding virus Tobacco necrosis virus Tomato ringspot virus PCR type 1 Primer name Sequence (5-3 ) Reference Conventional PCR qpcr TaqMan qpcr TaqMan qpcr TaqMan qpcr TaqMan Conventional nested-pcr qpcr TaqMan Fra4b CTCCTCTATCTCTAAAGG Danet et al. Fra5b AGCAATTGACRTTAGCGA 2003 Ep-hrpwF CGCTAACCCGACTGTGCT Lehman et al. Ep-hrpwR TGAAGGTTTGCCCTTTGC 2008 Ep-hrpwP FAM ATGACACCATCATCGTAAAGGCGG NFQ 2 Xaf pep-f GCGTGCCGCAGCCGC Weller et al. Xaf pep-r CCGGTGGGCTTGGCGCCG 2007 Xaf pep-p FAM CCGGAAACCGGCAAGAAGGCA NFQ 2 Xf gyrb-f CCGCAGCGACGCTGATC Weller et al. Xf gyrb-r ACGCCCATTGGCAACACTTGA 2007 Xf gyrb-p FAM TCCGCAGGCACATGGGCGAAGAATTC NFQ 2 XF-F CACGGCTGGTAACGGAAGA Harper et al. XF-R GGGTTGCGTGGTGAAATCAAG 2010 XF-P FAM-TCGCATCCCGTGGCTCAGTCC-NFQ 2 P1 AAGAGTTTGATCCTGGCTCAGGATT Deng & Hiruki 1991 P7 CGTCCTTCATCGGCTCTT Schneider et al. 1995 R16F2 ACGACTGCTAAGACTGG R16R2 TGACGGGCGGTGTGTACAAACCCCG Lee et al. 1995 Phyto-F CGTACGCAAGTATGAAACTTAAAGGA Christensen et Phyto-R TCTTCGAATTAAACAACATGATCCA al. 2004 UPH-P FAM-TGACGGGACTCCGCACA-NFQ 2 -MGB 3 Malandraki et al. 2015 Conventional RpRSV-942F CAGAGTATGGGTGATTTCTGG Tang 2011 RT-PCR RpRSV-1741R TCCTTCTCCCAGGTCTGCAC (unpublished) SLRSV-7406F GCTCTTTGCTTTCTTTTGTGTT RT-qPCR Tang 2016 SLRSV-7487R TCTAAGTGCCAGAACTAAACC TaqMan (unpublished) SLRSV-P FAM-CTGGGAGGATGCCTGGTTAATCCTTT-NFQ 2 Conventional SVBVdeta AGTAAGACTGTTGGTAATGCCA Thompson et al. PCR SVBVdetb TTTCTCCATGTAGGCTTTGA 2004 Conventional TNV3 AAGAYWCAAYACATTWCDATCG PCR TNV2 TGGTTCAATGAACTCAATCWCGTA Xi et al. 2008 ToRSV-UTRf GAATGGTTCCCAGCCACT RT-qPCR ToRSV-UTRr AGTCTCAACTTAACATACCAC TaqMan Tang et al. 2014 ToRSV-UTRp FAM-AGGATCGCTACTCCTCCGTCAAC-NFQ 2 1qPCR = Real-time quantitative PCR; RT-PCR = Reverse transcription PCR 2NFQ = Non-fluorescent quencher 3MGB = Minor groove binder 10 Fragaria Post-Entry Quarantine Testing Manual Ministry for Primary Industries

Table 7B: PCR primers and probes used for plant internal controls Target PCR type 1 Primer name Sequence (5-3 ) Reference Conventional 28Sf CCCTGTTGAGCTTGACTCTAGTCTGGC Werren et al. PCR 28Sr AAGAGCCGACATCGAAGGATC 1995 Plant DNA COX-F CGTCGCATTCCAGATTATCCA qpcr Weller et al. COX-R CAACTACGGATATATAAGAGCCAAAACTG TaqMan 2000 COX-P FAM-TGCTTACGCTGGATGGAATGCCCT-NFQ 2 Conventional Nad5-s GATGCTTCTTGGGGCTTCTTGTT Menzel et al. RT-PCR Nad5-as CTCCAGTCACCAACATTGGCATAA 2002 NAD-TM-F GCTTCTTGGGGCTTCTTGTT Plant RNA Khan et al. 2015 qpcr NAD-TM-R CCAGTCACCAACATTGGCATAA TaqMan Botermans et al. NAD5-P FAM-AGGATCCGCATAGCCCTCGATTTATGTG-NFQ 2 2013 1qPCR = Real-time quantitative PCR; RT-PCR = Reverse transcription PCR 2NFQ = Non-fluorescent quencher Interpretation of results for conventional PCR The pathogen-specific PCR will only be considered valid if: (a) the positive control produces the correct size product; and (b) no bands are produced in the negative control (if used) and in the no template control. The internal control PCR test will only be considered valid if: (a) each of the test samples, the negative control (if used) and the positive control produces the correct size product; and (b) no bands are produced in the no template control. Failure of the samples to amplify with the internal control primers suggests that the nucleic acid extraction has failed, compounds inhibitory to PCR are present in the extract or the extract has degraded, and so the extraction should be repeated. Interpretation of results for qpcr The pathogen-specific qpcr will only be considered valid if: (a) the positive control produces an amplification curve; and (b) no amplification curve is seen (i.e. cycle threshold [CT] value is 40) with the negative control (if used) and the no template control. The internal control qpcr test will only be considered valid if: (a) each of the test samples, the negative control (if used) and the positive control produces an amplification curve; and (b) no amplification curve is seen (i.e. cycle threshold [CT] value is 40) with the no template control. Failure of the samples to produce an amplification curve with the internal control primers suggests that the nucleic acid extraction has failed, compounds inhibitory to PCR are present in the extract or the extract has degraded, and so the extraction should be repeated. 4.6 MICROSCOPIC INSPECTION FOR MITES Recommended method 1. For each plant, use a hand lens to inspect the underside of the 2-3 youngest leaves for mite eggs, nymphs, adults and symptoms of mite presence. If mites are observed or mite damage is suspected, collect infested leaves for further examination using a binocular microscope. 2. For species identification, adults of both sexes must be slide mounted and examined under a microscope. Adult males are smaller than the females for all Diptacus and Tetranychus Ministry for Primary Industries Fragaria Post-Entry Quarantine Testing Manual 11

species. Male mites should be mounted laterally onto a microscope slide and female mites should be mounted dorsally to expose the diagnostic characters. To improve transparency, the mites can be cleared in lactic acid under a table lamp prior to mounting. 3. Identify the specimens using one or more of the following methods: (a) expertise/experience (b) keys and detailed morphological descriptions (c) comparison with diagnostic images (d) comparison with reference specimens Interpretation of results If mites are present the following symptoms may be observed on the underside of leaves: webbing, distinct small yellow spots (which get larger over time), leaf browning and heavily infested leaves may shrivel up and die. Overall, plant vigour and growth may be affected. Mites of the Diptacus genus are usually vagrant on the underside of leaves, form only small populations and cause no apparent damage to host plants. 5 Contact point This protocol was developed by: Virology & Post-Entry Quarantine Team Plant Health & Environment Laboratory Ministry for Primary Industries 231 Morrin Road, St Johns PO Box 2095, Auckland 1140 New Zealand Tel: +64 9 909 3015 Fax: +64 9 909 5739 Email: peqtesting@mpi.govt.nz Website: http://www.biosecurity.govt.nz/regs/imports/plants/high-value-crops 6 Acknowledgements We would like to acknowledge the following people who contributed to the preparation of this manual: Mr Geoff Langford, Berryworld, Lincoln, New Zealand, for developing drafts of the Introduction section under contract to MPI and also for valuable discussions. Mr Mark Andersen, Plant and Food Research, Mt Albert, New Zealand, for validating the experiments for phytoplasmas and Candidatus Phlomobacter fragariae under contract to MPI. Dr Joel Vanneste, Plant and Food Research, Ruakura, New Zealand, for validating the experiments for Xanthomonas fragariae and Xylella fastidiosa under contract to MPI. Dr Adib Rohani and Ms Lori Leong, Foundation Plant Services, Davis, California, USA, for providing virus-positive control material. Dr Xavier Foissac, UMR Génomique Diversité et Pouvoir Pathogène, INRA Centre de Bordeaux, France, for providing DNA and images of Candidatus Phlomobacter fragariae. Dr Claudio Ratti, Università di Bologne, Dipartimento di Scienze e Tecnologie Agroambientali, Bologna, Italy, for providing positive controls for Strawberry mild yellow edge virus, Strawberry crinkle virus and Stolbur phytoplasma. 12 Fragaria Post-Entry Quarantine Testing Manual Ministry for Primary Industries

Dr Ioannis Tzanetakis, Department of Plant Pathology, University of Arkansas, Fayetteville, Arkansas, USA, for helpful discussions. The American Phytopathological Society (APS) for permission to use images from the Diseases of Small Fruits CD-Rom, 2000, St Paul, Minnesota, USA. Mr Brian Prechtel, United States Department of Agriculture - Agriculture Research Service (http://www.ars.usda.gov/is/graphics/photos/), for providing the cover photograph of strawberry. 7 References Bentvelsen, G; Bouw, B (2006) Breeding ornamental strawberries. Acta Horticulturae 708 ISHS: 455-470. Botermans, M.; van de Vossenberg, B T L H; Verhoeven, J Th J; Roenhorst, J W; Hooftman, M; Dekter, R; Meekes, E T M (2013) Development and validation of a real-time RT-PCR assay for generic detection of pospiviroids. Journal of Virological Methods 187: 43-50. Christensen, N M; Nicolaisen, M; Hansen, M; Schulz, A (2004) Distribution of phytoplasmas in infected plants as revealed by real-time PCR and bioimaging. Molecular Plant Microbe Interactions 17: 1175-1184. Dana, M (1980) The strawberry plant and its environment. In: Childers, N F (ed) The Strawberry Cultivars to Marketing. Proceedings of the National Strawberry Conference, Saint Louis, MO, USA; pp 33-44. Danet, J -L; Foissac, X; Zreik, L; Salar, P; Verdin, E; Nourrisseau, J -G; Garnier, M (2003) Candidatus Phlomobacter fragariae is the prevalent agent of marginal chlorosis of strawberry in French production fields and is transmitted by the planthopper Cixius wagneri (China). Phytopathology 93: 644-649. Deng, S; Hiruki, D (1991) Amplification of 16S rrna genes from culturable and nonculturable mollicutes. Journal of Microbiological Methods 14: 53-61. Green, M J; Thompson, D A; MacKenzie, D (1999) Easy and efficient DNA extraction from woody plants for the detection of phytoplasmas by polymerase chain reaction. Plant Disease 83: 482-485. Harper, S J; Ward, L I; Clover, G R G (2010) Development of LAMP and real-time PCR methods for the rapid detection of Xylella fastidiosa for quarantine and field applications. Phytopathology 100: 1282-1288. Khan, S; Mackay, J; Liefting, L; Ward, L (2015) Development of a duplex one-step RT-qPCR assay for the simultaneous detection of Apple scar skin viroid and plant RNA internal control. Journal of Virological Methods 221: 100-105. Lee, I M; Bertaccini, A; Vibio, M; Gundersen, D E (1995) Detection of multiple phytoplasmas in perennial fruit trees with decline symptoms in Italy. Phytopathology 85: 728-735. Ministry for Primary Industries Fragaria Post-Entry Quarantine Testing Manual 13

Lehman, S M; Kim, W S; Castle, A J; Svircev, A M (2008) Duplex real-time polymerase chain reaction reveals competition between Erwinia amylovora and E. pyrifoliae on pear blossoms. Phytopathology 98: 673-679. MacKenzie, D J; McLean, M A; Mukerji, S; Green, M (1997) Improved RNA extraction from woody plants for the detection of viral pathogens by reverse transcription-polymerase chain reaction. Plant Disease 81: 222-226. Malandraki, I; Varveri, C; Olmos, A; Vassilakos, N (2015) One-step multiplex quantitative RT-PCR for the simultaneous detection of viroids and phytoplasmas of pome fruit trees Journal of Virological Methods 213: 12-17. Menzel, W; Jelkmann, W; Maiss, E (2002) Detection of four apple viruses by multiplex RT- PCR assays with coamplification of plant mrna as internal control. Journal of Virological Methods 99: 81-92. Schneider, B; Seemüller, E; Smart, C D; Kirkpatrick, B C (1995) Phylogenetic classification of plant pathogenic mycoplasma-like organisms or phytoplasmas. In Razin, S & Tully, J G (eds) Molecular and Diagnostic Procedures in Mycoplasmology, Vol. 1. Academic Press, San Diego, CA; pp 369-380. Staudt, G (1962) Taxonomic studies in the genus Fragaria. Typification of Fragaria species known at the time of Linnaeus. Canadian Journal of Botany 40: 869-886. Tang, J; Khan, S; Delmiglio, C; Ward, L I (2014) Sensitive detection of Tomato ringspot virus by real-time TaqMan RT-PCR targeting the highly conserved 3 -UTR region. Journal of Virological Methods 201: 38-43. Thompson, J R; Wetzel, S; Jelkmann, W (2004) Pentaplex RT-PCR for the simultaneous detection of four aphid-borne viruses in combination with a plant mrna specific internal control in Fragaria spp. Acta Horticulturae 656 ISHS: 51-56. Weller, S A; Beresford-Jones, N J; Hall, J; Thwaites, R; Parkinson, N; Elphinstone, J G (2007) Detection of Xanthomonas fragariae and presumptive detection of Xanthomonas arboricola pv. fragariae, from strawberry leaves, by real-time PCR. Journal of Microbiological Methods 70: 379-383. Weller, S A; Elphinstone, J G; Smith, N C; Boonham, N; Stead, D E (2000) Detection of Ralstonia solanacearum strains with a quantitative multiplex real-time, fluorogenic PCR (TaqMan) assay. Applied and Environmental Microbiology 66: 2853-2858. Werren, JH; Windsor, D; Guo, LR (1995) Distribution of Wolbachia among neotropical arthropods. Proceedings of the Royal Society London Series B 262: 197-204. Xi, D; Li, J; Han, C; Li, D; Yu, J; Zhou, X (2008) Complete nucleotide sequence of a new strain of Tobacco necrosis virus A infecting soybean in China and infectivity of its fulllength cdna clone. Virus Genes 36: 259-266. 14 Fragaria Post-Entry Quarantine Testing Manual Ministry for Primary Industries

8 Appendices 1. Symptoms of significant regulated diseases in Fragaria 16 2. Symptoms of nutrient deficiencies in Fragaria 21 3. Graft indexing protocol 23 4. Herbaceous indexing protocol 24 5. Nucleic acid extraction protocols for PCR 25 6. PCR protocols 26 Ministry for Primary Industries Fragaria Post-Entry Quarantine Testing Manual 15

APPENDIX 1: SYMPTOMS OF SIGNIFICANT REGULATED DISEASES IN FRAGARIA A1.1 Candidatus Phlomobacter fragariae Small, cup-shaped leaves with chlorotic margins caused by marginal chlorosis disease. In nursery plants symptoms also include red discolouration of leaftets (right photo). (Left image courtesy of J.G. Nourrisseau; reproduced, with permission, from the Diseases of Small Fruits CD-Rom, 2000, APS, St Paul, MN, USA. Right image courtesy of X. Foissac) A1.2 Xanthomonas arboricola pv. fragariae Large, brown, V-shaped lesions surrounded by a yellow halo on the upper side of strawberry leaves (left photo) and small, reddish-brown lesions on the lower side of strawberry leaves (right photo) caused by the bacterial leaf blight pathogen, Xanthomonas arboricola pv. fragariae. (Both images courtesy of M. Scortichini; www.atlasplantpathogenicbacteria.it) 16 Fragaria Post-Entry Quarantine Testing Manual Ministry for Primary Industries

A1.3 Xanthomonas fragariae Initial symptoms of small angular water soaked spots (left photo) that progress along the main veins of the leaf (right photo) caused by the bacterial angular leaf spot of strawberry, Xanthomonas fragariae. (Both images courtesy of R. Gozzi; www.atlasplantpathogenicbacteria.it) A1.4 Aster yellows phytoplasma Phyllody of achenes (left photo) and fruit distortion (right photo) in Marmolada, associated with Strawberry aster yellows phytoplasma. (Both images courtesy of S. Guerrini; reproduced, with permission, from the Diseases of Small Fruits CD-Rom, 2000, APS, St Paul, MN, USA) Ministry for Primary Industries Fragaria Post-Entry Quarantine Testing Manual 17

A1.5 Strawberry green petal phytoplasma A1.6 Strawberry multiplier phytoplasma Green flower petals, small, hard, green fruit and dwarfed, cupped, chlorotic leaves associated with Strawberry green petal phytoplasma. (Courtesy USDA; reproduced from the Diseases of Small Fruits CD-Rom, 2000, APS, St Paul, MN, USA) Symptoms of multiplier disease (left plant) with numerous crowns produced along the runners; the plant on the right is healthy. (Courtesy M. F. Clark; reproduced, with permission, from the Diseases of Small Fruits CD-Rom, 2000, APS, St Paul, MN, USA) A1.7 Strawberry yellows phytoplasma A1.8 Strawberry latent C virus General chlorosis and stunting of leaves in Redlands Crimson, associated with phytoplasma yellows. (Courtesy USDA; reproduced from the Diseases of Small Fruits CD-Rom, 2000, APS, St Paul, MN, USA) Severe epinasty of young leaves of Fragaria vesca EMK, caused by Strawberry latent C virus. (Courtesy USDA; reproduced from the Diseases of Small Fruits CD-Rom, 2000, APS, St Paul, MN, USA) 18 Fragaria Post-Entry Quarantine Testing Manual Ministry for Primary Industries

A1.9 Strawberry pallidosis-associated virus A1.10 Strawberry pseudo mild yellow edge virus Leaves of Fragaria virginiana UC-10 infected with Strawberry pallidosis-associated virus (left and centre) and a healthy leaf (right). (Courtesy USDA; reproduced from the Diseases of Small Fruits CD-Rom, 2000, APS, St Paul, MN, USA) Stipple pattern of discolouration on an older leaf of Fragaria vesca Alpine, caused by Strawberry pseudo mild yellow edge virus. (Courtesy USDA; reproduced from the Diseases of Small Fruits CD-Rom, 2000, APS, St Paul, MN, USA) A1.11 Strawberry vein banding virus A1.12 Tobacco necrosis virus Chlorosis along veins in Fragaria vesca UC-5, a diagnostic symptom of Strawberry vein banding virus. (Courtesy R. R. Martin & S. Spiegel; reproduced, with permission, from the Diseases of Small Fruits CD-Rom, 2000, APS, St Paul, MN, USA) Necrosis of older leaves of Fragaria vesca Alpine infected with Tobacco necrosis virus. (Courtesy USDA; reproduced from the Diseases of Small Fruits CD-Rom, 2000, APS, St Paul, MN, USA) Ministry for Primary Industries Fragaria Post-Entry Quarantine Testing Manual 19

A1.13 Tomato ringspot virus A1.14 Strawberry lethal decline disease Red, necrotic lesions on Fragaria virginiana UC-11 graft-inoculated with Tomato ringspot virus. (Courtesy R. R. Martin & S. Spiegel; reproduced, with permission, from the Diseases of Small Fruits CD-Rom, 2000, APS, St Paul, MN, USA) Bronzing of older leaves and cupping of younger leaves in Fragaria ananassa Hood due to Strawberry lethal decline. (Courtesy USDA; reproduced from the Diseases of Small Fruits CD-Rom, 2000, APS, St Paul, MN, USA) 20 Fragaria Post-Entry Quarantine Testing Manual Ministry for Primary Industries

APPENDIX 2: SYMPTOMS OF NUTRIENT DEFICIENCIES IN FRAGARIA A2.1 Nitrogen deficiency A2.2 Magnesium deficiency Red colouration of a strawberry leaf caused by severe nitrogen deficiency. (Courtesy G. May & M. P. Pritts; reproduced, with permission, from the Diseases of Small Fruits CD-Rom, 2000, APS, St Paul, MN, USA) Progression of magnesium deficiency symptoms in strawberry leaves starting with initial chlorosis (left leaf) eventually becoming necrotic (middle and right leaves). (Courtesy G. May & M. P. Pritts; reproduced, with permission, from the Diseases of Small Fruits CD-Rom, 2000, APS, St Paul, MN, USA) A2.3 Phosphorus deficiency A2.4 Potassium deficiency Reddish-purple tint on an older strawberry leaf due to phosphorus deficiency. (Courtesy G. May & M. P. Pritts; reproduced, with permission, from the Diseases of Small Fruits CD-Rom, 2000, APS, St Paul, MN, USA) Dark, dehydrated mid-veins and leaf blades of strawberry leaves caused by potassium deficiency. (Courtesy G. May & M. P. Pritts; reproduced, with permission, from the Diseases of Small Fruits CD-Rom, 2000, APS, St Paul, MN, USA) Ministry for Primary Industries Fragaria Post-Entry Quarantine Testing Manual 21

A2.5 Manganese deficiency A2.6 Iron deficiency Severe manganese deficiency symptoms of interveinal chlorosis in strawberry leaves (upper right). (Courtesy F. Johanson; reproduced, with permission, from the Diseases of Small Fruits CD-Rom, 2000, APS, St Paul, MN, USA) Yellowing and green-veining of young mature strawberry leaves caused by iron deficiency. (Courtesy G. May & M. P. Pritts; reproduced, with permission, from the Diseases of Small Fruits CD-Rom, 2000, APS, St Paul, MN, USA) A2.7 Zinc deficiency Basal narrowing of leaflets, greening of veins and green halo around the serrated leaf margins of strawberry caused by zinc deficiency. (Courtesy F. Johanson; reproduced, with permission, from the Diseases of Small Fruits CD-Rom, 2000, APS, St Paul, MN, USA) 22 Fragaria Post-Entry Quarantine Testing Manual Ministry for Primary Industries

APPENDIX 3: GRAFT INDEXING PROTOCOL It is best to grow the indicator plants from young cuttings as seeds of most strawberry cultivars do not breed true to type. Non-runner forms such as Fragaria vesca Alpine will need to be propagated from seed or by crown division. The indicator plants are ready for grafting when they have two or more fully expanded leaves. The indicator plants must be maintained in a vigorous state of growth before and after grafting and must be grown under moderate temperatures and light intensities. To avoid cross-contamination of plants during the grafting process, use a sterile scalpel for each Fragaria plant to be tested. Recommended method 1. Prune the indicator plants to two young actively growing trifoliate leaves (Figure 1). 2. Using a scalpel blade, remove the centre leaflet of each leaf and make a 1-2 cm vertical split down the middle of the petiole (Figure 1). 3. Remove young actively growing trifoliate leaves from the imported plant to be tested and trim away the two outside leaflets, leaving only the centre leaflet and the petiole (Figure 1). Cut the petiole into a wedge shape, trim away about half of the leaflet blade and insert in the split of the indicator plant petiole (Figure 1). Bind the graft firmly with selfadhesive medical tape (e.g. stericrepe) or other suitable grafting tape. 4. A single plant of each indicator cultivar must be left ungrafted as a negative control each day that grafting is performed. Alternatively, the negative control can be an indicator that has been grafted with its own scion material, i.e. self-grafted. These plants must be subjected to the same horticultural practices and environmental conditions as the inoculated plants. 5. Optional: Each indicator cultivar may be graft-inoculated with a positive control. The positive control is a non-regulated virus of Fragaria. 6. Hold the grafted plants in a mist bed or create a humid atmosphere by covering with a plastic bag or tub for about 1-2 weeks until a graft union has formed. 7. Approximately two weeks after grafting, check that the graft union has successfully healed and that the inoculum is still alive. All graft inoculations must have survived for the full two weeks; if not the graft inoculation must be repeated. 8. Examine grafted plants regularly for symptoms over a 3 month period. Figure 1: Preparation of the test plants (green) and the indicator plants (white) for Fragaria leaf grafting Ministry for Primary Industries Fragaria Post-Entry Quarantine Testing Manual 23