Etiology of housand Cankers Disease in the Eastern US A Disease Complex Becomes More Complex Melanie Moore, USDA Forest Service Northern Research Station
Partners Dr. Jenny Juzwik, Research Plant Pathologist USDA Forest Service, NRS-16 Indiana Dept. of Natural Resouces Purdue University/ HIRC MetroParks of Butler County (Ohio)
housand Cankers Disease (CD) is a complex involving Pityophthorus juglandis (walnut twig beetle), Geosmithia morbida, and a susceptible host, e.g. Juglans nigra. WB + GM + JN = CD
housand Cankers Disease (CD) Black walnut mortality throughout the Western US, now spreading to the East. Walnut twig beetle (WB) attacks a tree, spreading a fungus under the bark. Multiple small cankers lead to death of tree.
he Disease riangle Polygon Host Vector Environment Pathogen
housand Cankers Disease in the USA as of Mid-2016 WA CA OR NV ID U CO MI OH IN PA MD VA AZ NM N NC State with CD confirmed State without CD Most recent finds (WB; Gm only) Source: G. Ruhl, Purdue University
Specialty Walnut Wood Products
West to East trade in walnut wood products Live-edge lumber Burls Salvaged yard and orchard trees Claro Walnut (Juglans hindsii, Northern California walnut) English Walnut (Juglans regia) Bastogne Walnut (Paradox hybrid) Some Eastern Black Walnut (Juglans nigra) Internet Live bark, and live small business organisms sales Eastern specialty wood products CD
West WA Black walnuts in mostly urban OR settings ID Detection easy NV U CAMortality usually rapid CO Little recovery seen AZ NM Other walnut species in the mix, esp. in CA Predominantly 1 insect, 1 fungus East Black walnut in forest and urban settings IN MI Detection difficult OH PA Mortality slower VA MD Recovery NC N possible Other walnut species minimal Complex of multiple insects and fungi
Ohio CD ree Study, 2015 Purpose: Observe the kinds of damage on CD-affected trees, analyze other possible fungi involved. 4 CD-confirmed trees, cut up in sections. Bark carefully removed and cankers examined. Fungal isolations made from cankers. Most common fungal types ID d via PCR and sequencing. Insects emerged, ID d and analyzed for Gm.
Ohio CD ree Study, 2015 Number of cankers 160 140 120 100 80 60 40 GM-like Eliptical Long narrow Buprestid Weevil Branches 20 0 160 140 Main stems Number of cankers 120 100 80 60 40 20 Most damage was typical Gm-like cankers, but plenty of other types, too. 0 138 139 140 145 ree
Ohio CD ree Study, 2015 Number of cankers yielding: Number Gm + Gm + Damage ype assayed Gm Fs Bs Fs Bs Geosmithiatypical 232 86 26 41 11 6 Elipse 114 32 7 8 4 1 Long-narrow 61 35 12 10 4 3 Buprestid 50 4 5 18 3 0 Weevil 43 9 1 13 1 1
Ohio CD ree Study, 2015 Geosmithia morbida is a weak pathogen of walnut. Botryosphaeria dothidea is a stress-related pathogen of walnut and considered an endophyte. Diplodia seriata/botryosphaeria obtusa is a pathogen on several woody hosts, but pathogenicity on walnut has not been proven. Fusarium solani is a species complex. Can cause cankers on walnut, particularly following abiotic injury. Hypothesis: At least two other canker-causing fungi contribute to CD symptom development in J. nigra in eastern USA.
he Disease riangle Polygon
Inoculation Studies Purpose: Observe Gm canker development in a controlled setting, and then compare it to other fungi. Study 1, 2014-2015: Branches of walnut in a 37-year-old Indiana plantation were inoculated with Gm and observed for 2 years. Study 2, 2015-present: Branches in Indiana and Ohio were inoculated with Gm, Fs, and Bs, observe over 2 years.
Inoculation Studies Size of necrotic/cankered area 3 and 15 months after inoculation (50 points/branch) 3.5 3.0 Sterile control G. morbida A G. morbida B Canker area (cm 2 ) 2.5 2.0 1.5 1.0 0.5 0.0 C14 C15 GMA14 GMA15 GMB14 GMB15 Year evaluated Size of cankers did not increase over time: Gm is probably only an annual canker
Inoculation Studies Frequency of G. morbida recovery from inoculated branches of black walnut after 15 months 90 80 70 Percent recovery 60 50 40 30 20 10 0 1a 1b 2a 2b 3a 3b 4a 4b 5a 5b ree and Branch Recovery of Gm was variable by isolate and tree
New Inoculation Study Study 2, 2015-present: Branches in Indiana (plantation) and Ohio (parks) were inoculated with Gm, Fs, and Bs, observe over 2 years. First batch of branches being analyzed.
PCR Assay for Detection of Geosmithia morbida Culturing is slow. Needed a rapid test to assay large numbers of insects. Species-specific PCR primer assays are available for a number of tree diseases. Example: LaMarche et al. (2007) but did not quite fit our conditions. Ohio CD study (dual) Bark beetles and weevils emerged and collected. Serial dilution plating to culture Gm. PCR assay done to detect Gm. State Insect rapping Surveys
PCR Assay for Detection of Geosmithia morbida CAGGAGAACCGCGGCC GGCGGAAGGACACCAGGA AGCAGACACAGAAGACACGG CAGCAGACGAACGACAG GCAAAAGAGGCGAAC GGCAGCGGCAGAACA GACCAGGCGGGCCGCCACG
Growing List of Insects Carrying Gm* Stenoscelis brevis Bark Beetles Pityophthorus juglandis Stenomimus pallidus Conotrachelus retentus Himatium errans Weevils Xylosandrus crassiusculus *Note: Does not necessarily mean they can transmit Gm Detection Method: Cultured PCR Both Xyleborinus saxeseni Ambrosia Beetles Xylosandrus germanus
he Disease riangle Polygon
Other Ongoing Projects Vacuum-Contained Steam reatment We need a method of decontaminating both WB and Gm from walnut logs, while still maintaining wood quality. VCS takes less time and uses less energy than conventional heat treatment. No toxic chemicals used. Cooperative study: Marshall White and Zhangjing Chen, Virginia ech, Ron Mack, USDA APHIS. Pilot study in PA underway with inoculated branches.
Microbiome Study Purpose: Collect WB s from their native environment and catalog associated fungi. Gives baseline data for comparisons as they spread to non-native environments. WB s were collected in NF s of New Mexico (3 sites), analyzed in 2 ways: Serial dilution plating. Grew out representative fungi from macerated beetles, then ID d via PCR and sequencing. In process Next-gen sequencing to discover fungi we were not able to culture.
Acknowledgements Mag McDermott Paul Castillo yler Stewart Matt Ginzel James Jacobs