Diseases, pests, and emerging issues affecting the health of Pacific madrone Marianne Elliott Plant Pathologist WSU Puyallup
American Forests Famous and Historic Tree at Magnolia Bluffs, Seattle, WA 1996 2004 2014
Factors affecting tree health Environmental Climate Management practices Fire suppression Urbanization Biological Fungi and oomycetes Insects Wildlife Introduced pests and pathogens
Climate Indices Pacific Decadal Oscillation (PDO) Northern Pacific Multivariate ENSO Index (MEI) Tropical Pacific
1975-1994 4 3 1982-83 1986-88 1992-94 Positive values warm, dry 2 1 1976-1977 Negative values cool, wet 0-1 197501 197507 197601 197607 197701 197707 197801 197807 197901 197907 198001 198007 198101 198107 198201 198207 198301 198307 198401 198407 198501 198507 198601 198607 198701 198707 198801 198807 198901 198907 199001 199007 199101 199107 199201 199207 199301 199307 199401 199407-2 -3-4 1975-76 PDO MEI 1988-1989 4 3 1997-98 1995-2016 PDO MEI 2014-2016 When both indices are in phase the effects are stronger 2 1 0-1 199501 199508 199603 199610 199705 199712 199807 199902 199909 200004 200011 200106 200201 200208 200303 200310 200405 200412 200507 200602 200609 200704 200711 200806 200901 200908 201003 201010 201105 201112 201207 201302 201309 201404 201411 201506 201601-2 -3 1998-2002 2007-2009 2010-2011 -4
Fungal diseases are affected by climate conditions Cold, wet winter/spring: Warm, wet spring: Warm, dry summer: Symptom expression cold damage, foliar blight Fungal sporulation, germination, infection Drought Symptom expression canker, dieback, root disease Temperature and precipitation are expected to increase in PNW. This will affect insect pollinators and diseases of Pacific madrone.
2011 Leaf Blight Severe leaf blight and some mortality Online survey Mapping of areas with severe and (rarely) healthy trees <Need photos> Foliage diseases rarely threaten the survival of the tree. Elliott, 1999
Foliar fungi Leaf spot Leaf spot Leaf blight Blister blight Rust Sooty mold Rust At least 19 different fungi are associated with leaf spots on madrone Byther, 1999 Exobasidium vaccinii on fruit
Identifying fungal organisms >WSUP5_6_2010 GTTGNANNCTTTGCCTACCATCTCTTACCCATGTCTTTTGAGTACCTTC GTTTCCTCGGCGGGTCCGCCCGCCGATTGGACAAACTTAAACCCTTTG TAATTGAAATCAGCGTCTGAAAAAACATAATAGTTACAACTTTCAACA ACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGA TAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACG CACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCGAGCGTCA TTTGTACCTTCAAGCTCTGCTTGGTGTTGGGTGTTTGTCTCGCCTTTGC GTGTAGACTCGCCTTAAAACAATTGGCAGCCGGCGTATTGATTTCGGA GCGCAGTACATCTCGCGCTTTGCACTCATAACGACGACTTCCAAAAAG TACTTTTTACACTCTTGACCTCGGATCAGGTAGGGATACCCGCTGAAC TTAAGCATATCAATAAGCGGAGGAAANCNGGGGCCTCCCAAANANC CCTTTTTTAAATGTGATCTGAATTCAGGCGGTATTTCCTGCTCATTTAAC CNTTCTTTTTNTNTGNCGAAAAA
Many names for the same fungus Search term: Phoma exigua Older records based on morphology, host Newer records include DNA sequence
Foliar blight Phacidiopycnis washingtonensis Phomopsis vaccinii P. washingtonensis symptom expression may be related to cold temperatures
Phacidiopycnis washingtonensis Large, dying branches appear to have a necrotic leading front similar to a cambial killing canker Limited isolations from such cankers have yielded a species of Phacidiopycnis. This fungus was not pathogenic in healthy madrone. Hunt, 1999. The fungus was also isolated from leaf spots on emerging foliage, lesions on green shoots, and the petiole and leaf blade of dead, attached leaves.
Shoot dieback fungi Neofusicoccum arbuti (Botryosphaeria spp.) Phomopsis vaccinii (Diaporthe eres) Phacidiopycnis washingtonensis
Madrone canker Older names: Hendersonula toruloidea = Neoscytalidium dimidiatum Nattrassia mangiferae = Neofusicoccum mangiferae Fusicoccum arbuti = Neofusicoccum arbuti Neither of these fungi causes madrone canker
Botryosphaeria spp. Shoot and branch dieback Pycnidia erupting through leaf cuticle Whole tree symptoms <Need photos>
Root disease Phytophthora (P. cactorum, P. cinnamomi) Armillaria (A. gallica, A. mellea) Heterobasidion occidentale Mushrooms of Armillaria spp. inside a madrone tree. Phytophthora root disease www.shroomery.org
Insects Fall webworm (Hyphantria cunea) Damage commonly seen in summer months in SW Oregon. Serpentine leaf miner (Marmara arbutiella) Wood boring beetle (probably Buprestidae)
Wildlife Chewing damage and undermining by rodents, probably mountain beaver Deer Rodents
Introduced pests and pathogens Phytophthora cinnamomi Phytophthora ramorum P. ramorum infecting madrone under bay laurel canopy in California P. cinnamomi on Pacific madrone, CA
Causes of decline in Pacific madrone Climate-related 1975-1998 warm phase drought, canker, dieback, Armillaria root disease, P. cinnamomi root disease 1999-2014 cool phase leaf blight, cold damage, Phytophthora root disease 2014 warm phase Anthropogenic Urbanization Fire suppression Exotic pests and pathogens (P. cinnamomi, P. ramorum, others)
Any questions? Website http://ppo.puyallup.wsu.edu/pmr/ melliott2@wsu.edu