Xanthomonas arboricola pv. juglandis
|
|
- Vanessa Osborne
- 5 years ago
- Views:
Transcription
1 023_COST(Moreagra)_S155_COL :24 Pagina 155 Journal of Plant Pathology (2012), 94 (1, Supplement), S1.155-S1.159 Edizioni ETS Pisa, 2012 S1.155 DETECTION AND IDENTIFICATION METHODS AND NEW TESTS AS DEVELOPED AND USED IN THE FRAMEWORK OF COST 873 FOR BACTERIA PATHOGENIC TO STONE FRUITS AND NUTS Xanthomonas arboricola pv. juglandis C. Moragrega INTEA, Institute of Food and Agricultural Technology, University of Girona. C/ Maria Aurèlia Capmany 61, Girona, Spain INTRODUCTION Xanthomonas arboricola pv. juglandis (Pierce) Vauterin et al. (1995) is the causal agent of walnut bacterial blight, the major nut and foliage disease of Persian (English) walnut (Juglans regia). The disease limits walnut production in most regions of the world. All new walnut tissues are susceptible to infection and necrosis can occur in catkins, female flowers, leaves, fruit and green shoots (Miller and Bollen, 1946). Over time, the bacterium has been classified into different genera under different names, i.e. Pseudomonas juglandis Pierce (1901); Bacterium juglandis (Pierce) Smith (1905); Phytomonas juglandis (Pierce) Bergey et al. (1930); Xanthomonas juglandis (Pierce) Dowson (1939) and Xanthomonas campestris pv. juglandis (Pierce) Dye (1978), which is officially accepted in the International standards for naming pathovars of phytopathogenic bacteria (Dye et al., 1980). Recently, however, it was re-classified by Vauterin et al. (1995) as Xanthomonas arboricola pv. juglandis (Xaj). Xaj is the causal agent of two new emerging diseases of Persian (English) walnut (J. regia) known as vertical oozing canker (VOC) (Hajri et al., 2010), and apical necrosis (Moragrega and Ozaktan, 2010; Moragrega et al., 2011). According to molecular studies based on fluorescent amplified fragment length polymorphism (F- AFLP), in France VOC is caused by a distinct genetic lineage of the bacterium which is also able to induce blight symptoms on leaves and fruits (Hajri et al., 2010). Bacterial strains isolated from apical necrosis lesions in Spain are also able to infect walnut leaves, causing typical blight lesions (Moragrega et al., 2011). HOST RANGE Among Juglans species, only J. regia is currently known as being naturally susceptible to Xaj. Most of its commercial cultivars are susceptible (Woeste et al., Corresponding author: C. Moragrega Fax: concepcio.moragrega@udg.edu 1992), as ascertained under laboratory and field conditions (Aletà et al., 2001; Moragrega et al., 2008). In the Mediterranean area, where rains are usually concentrated in early spring, late vegetating cultivars, such as Franquette, are often less susceptible to the disease than in wetter and less warm regions. DETECTION AND IDENTIFICATION Media for bacterial growth and detection. Differential and semi-selective media have been described and should be used for isolating xanthomonads from plant tissues. Media that are widely used for isolation from walnut tissues, also recommended in EPPO protocols, are YPGA (yeast peptone glucose agar) and YDC (yeast extract dextrose calcium carbonate) (Schaad, 2001). YDC is a differential medium in which xanthomonads produce large, smooth, mucoid, domed and typically yellow-pigmented colonies. Semi-selective media for differentiating Xaj colonies include modified Tween or mtween (Schaad, 2001), where the bacterium produces small, round, yellow colonies surrounded by a small milky and a large clear area (Fig. 1A) and Brilliant cresyl blue-starch or BS medium (Mulrean and Scroth, 1981; Schaad, 2001) on which colonies are small, round, pale blue, opalescent with entire margins and surrounded by an opaque zone (Mulrean and Scroth, 1981). Recently, a new selective medium based on yeast extract peptone glucose agar supplemented with 30 mg l -1 cephalexin and 100 mg l -1 cycloeximid (YPGAc) has been developed and presented under the COST Action 873 ( On YPGAc, Xaj forms yellow colonies that are clearly visible 4-5 days after incubation at 27-28ºC and grow slower than those of to other Xanthomonads. ISOLATION METHODS The following methods were adapted or developed and used under the COST Action 873 frame (see also Mulrean and Scroth, 1980; Ninot et al., 2002; Schaad et al., 2001).
2 023_COST(Moreagra)_S155_COL :24 Pagina 156 S1.156 X. arboricola pv. juglandis detection and identification methods Journal of Plant Pathology (2012), 94 (1, Supplement), S1.155-S1.159 Isolation can be done from all infected organs (leaves, fruit, catkins, twigs). New infections in young tissues are preferable to old infections which can give problems due to colonization by secondary parasites and/or saprophytes (mainly fungi). Leaf, fruit and twig lesions: disinfect the entire organs or a piece thereof by immersion for 1 min in 1% solution of commercial sodium hypochlorite followed by three rinses of at least 1 min each in sterile distilled water (SDW). For fruit and twig lesions remove the epidermis until clear progressive lesions are observed in the internal tissues. Excise 3-5 mm tissue fragments at the margin of the lesions and crush in a droplet of SDW on the lid of a sterile disposable Petri dish using a sterile scalpel or razor blade. Incubate the resulting suspension for 15 min at room temperature and streak onto differential media YDC or semi-selective mtween or BS media (Schaad, 2001). Incubate agar plates at 27ºC for 4-5 days. Infected catkins and buds: homogenize 0.5 g fresh material in 5 ml SDW with a Polytron (Brinkmann Homogenizer Model PT 10/35, Brinkmann Instruments, USA) or a similar tissue grinder. Dilute the sample and plate 100 µl of the adequate dilution on differential or semi-selective media as indicated above, and incubate at 27ºC for 4-5 days. Assessment of epiphytic populations of Xanthomonas arboricola pv. juglandis from walnut organs. Detection and quantification of epiphytic bacterial levels on walnut organs has widely been used in walnut blight epidemiological studies. The methodology was standardized under the COST 873 frame and successfully adopted by research groups ( as described below. Fruit and leaf populations: place 5 g fresh tissue in flasks with 50 ml SDW with 0.001% Tween 20, and shake at 150 rpm in an orbital shaker for 1 h in the cold (4ºC) to avoid bacterial multiplication. Spread a 100 µl aliquot from selected dilutions onto the surface of mtween agar plates (BS and YPGAc media can also be used). After 4 days of incubation in the dark at 25 C, the colonies displaying characteristic color and morphology described for X. a. pv. juglandis are counted and bacterial populations are expressed as CFU per gram of fresh weight of fruit or leaf. Catkins and buds: homogenize 0.5 g fresh material in 5 ml SDW and proceed as described above for bacterial isolation from fruit and leaves. Dilute the sample and plate 100 µl of the appropriate dilution on semi-selective media described above, and incubate at 27ºC for 4-5 days. Count bacterial colonies resembling Xaj and express bacterial populations as CFU per gram of fresh weight of buds or catkins. Pollen: pollen should be collected from catkins that have completed development, at the beginning of anther dehiscence, as follows: spread catkins over filter paper and allow the anthers to dehisce overnight, then pass released pollen through a 100 µm mesh screen to remove debris. Transfer 0.10 g pollen to an Eppendorf with 1 ml SDW. Agitate intermittently the sample on a vortex mixer for 10 min. Dilute the sample and plate 100 µl of the appropriate dilutions on semi-selective media described above. Incubate at 27ºC for 5-7 days and count the CFU per gram of fresh weight. Storage of isolates/strains and control strains. Isolates obtained should be stored frozen (-80ºC) as soon as possible. For freezing, two loopfuls of bacteria collected from a fresh culture are suspended in sterile cryovials containing 1 ml sterile yeast peptone glucose broth (YPGB) supplemented with 15% glycerol. Suspensions are vortexed and incubated for 15 min at room temperature before transferring to a -80ºC in a freezer. Working cultures can be maintained on YDC or YPGA slants at 4ºC. Reference strains can be used as positive controls in the tests. The type strain isolated in 1956 by D.W. Dye from J. regia in New Zealand is frequently used. Collection accession numbers for this strain are CFBP 2528, ICMP 35, ATCC 49083, LMG 747, NCPPB 411. IDENTIFICATION METHODS Phenotypic description. Xaj is a Gram-negative aerobic rod with a single polar flagellum. As most xanthomonads, the species produces the unique yellow membrane-bound non-water soluble pigments xanthomonadins, soluble in benzene, methanol and petroleum ether (Starr et al., 1977). Xanthomonads can be readily differentiated from other yellow pigmented phytopathogenic bacteria when growing on YDC agar, since they produce mucoid, convex and yellow colonies. The genus can be clearly differentiated from other Gram-negative rods causing plant diseases on the basis of phenotypic characters as reported by Schaad (2001). Identification of xanthomonadin pigment. Xanthomonadins are useful chemotaxonomic markers for Xanthomonads. They are classified into 15 groups according to the number of bromine atoms, the absorption maxima and mass spectrometric M + value, and methylation (Chun, 2002). Absorption maxima (mµ) of xanthomonadins of Xaj are 437 and 463 on petroleum ether extracts; 454 and 481 on benzene ether extracts; and 441 on methanol ether extracts (Starr et al., 1964). Several protocols have been described for pigment extraction and identification (Lelliott and Stead, 1987). The following one is summarized from Schaad (2001): scrape the bacteria from the surface of colonies grown for 48 h on nutrient agar (NA) and add to 3 ml of spectrophotometry grade methanol in a test tube with a screw cap (suspension turbidity must be equivalent to
3 023_COST(Moreagra)_S155_COL :24 Pagina 157 Journal of Plant Pathology (2012), 94 (1, Supplement), S1.155-S1.159 C. Moragrega S1.157 near CFU/ml). Place the capped tube in water bath with boiling water until the solution becomes yellow. Centrifuge at 1,000 g for 15 min, decant supernatant and evaporate in a water bath at 50-60ºC until the optical density of the pigment extract reaches ca. 0.4 at 443 nm (it occurs when solution becomes intense yellow). Spot five 5 µl aliquots (allowing each 5 µl to dry before applying the next) on a 0.2 mm thick thin-layer chromatography sheet of silica gel 60 (Merck, Germany) and place in developing apparatus with anhydrous spectrophotometry grade methanol as solvent. Allow the solvent front to move approximately 10 cm and outline the yellow spots with a pencil when the silica gel is still wet. A yellow spot with an average Rf value of 0.45 (range of 0.42 to 0.49) is positive for xanthomonadins. Always use reference strains as positive and strains of other genera as negative controls. Biochemical tests. Phenotypic traits and biochemical test have been described for differentiating Xanthomonas from other plant pathogenic bacteria and species within the genus Xanthomonas (Schaad et al., 2001). However, no information is available on specific biochemical tests for distinguishing among pathovars of X. arboricola species. Xaj biochemical traits are: oxidase-negative, oxidative glucose metabolism, growth at 35 C, ability to hydrolyze aesculin and starch, and protein digestion test-positive. Substrate utilization kits from Biolog and API can be used for biochemichal tests. The use of a reference strain as positive control and other genera as negative controls is recommended. Serological techniques. Immunofluorescence tests using polyclonal antisera are generally specific at the species level only. Identification at the pathovar level is not possible for the juglandis pathovar, since monoclonal antibodies are only available for a reduced number of X. campestris pathovars. DNA-based techniques PCR primers are available for the identification of X. campestris at species level (XV; 5 TTCGGCAACGGCAGTGACCACC3 ) (Schaad, 2001). A specific PCR for Xaj has been developed by Gironde and Manceau (INRA Angers-Nantes, France) and presented in the COST Action 873 to be adopted as a molecular detection technique. Their specific primers Xaj F and XajR have also been succesfully used in a Bio- PCR detection method, an easy to use and rapid trechnique that permits detection of viable bacteria. A protocol for Xaj detection in plant samples by the Bio-PCR technique was presented in the COST873-EPPO Diagnostics Conference that took place at York in May 2009 ( D=23) and in the Xanthomonas Diagnosis and Biodiversity Training Workshop held in Angers (France) in September 2009 ( Finally, a protocol for Xaj ientification in samples from symptomatic plants by Real-time PCR was developed and tested in COST873 activities. Protocols are available at Pathogenicity tests. Inoculations can be made either on healthy vigorously growing walnut potted plants of a susceptible cultivar or on detached immature walnut fruits. Inoculation on detached walnut leaves are not recommended due to the release of phenolic compounds on detached leaves during manipulations that can modify the results. Inoculation methods are exhaustively described by Schaad (2001). Inoculation of whole plants (developed by C. Moragrega, Institute of Food and Agricultural Technology and used under the COST Action 873 frame): 1 to 2- year-old potted plants of a cultivar susceptible to walnut blight should be used. Bacterial infections require young leaves, which are more susceptible than the mature and old ones. Inoculum suspensions are prepared from 4 to 5-day-old Xaj cultures grown on NA (nutrient agar) medium at 27ºC. Suspensions on SDW are adjusted to CFU ml -1 with a spectrometer (A 600nm = 0.2) and serial dilutions are plated on YDC medium and counted for confirmation of inoculum concentration. Inoculum suspensions must be prepared on the same day of inoculation and maintained at 4ºC until use. To facilitate infection diatomaceous earth (0.2 g l -1 ) can be added to the inoculum. Bacterial suspensions are sprayed under pressure (1-2 bar) on both faces of walnut leaves until runoff. Inoculated plants are immediately covered with plastic bags which are internally sprayed with sterile water and incubated for h at 25ºC in a climatic chamber. Then, plastic bags are removed and plants are re-introduced into the climatic chamber at 25ºC, 70-80% RH, 16 h photoperiod for 7-10 days for symptom development. Pathogenic bacterial strains produce brown spots often surrounded by a yellowish halo (Fig. 1B). Inoculation of fruits: (summarized from the protocol reported in Immature fruits aged under Gf+45 should be used. Puncture the equatorial zone of the fruit (from external face to mesocarp) with a needle impregnated with bacterial colony (from a fresh culture grown on NA). Incubate inoculated fruits in plastic boxes for days at 25ºC and RH higher than 90% (high RH is assured if fruits are placed onto wet filter paper in the boxes) and a 16 h light photoperiod. Pathogenic strains produce progressive necrotic lesions through walnut fruit tissues. Inoculation methods for screening assays [developed and used as standard protocols under the COST Action 873 frame (C. Moragrega, 2009 posted in see also Aletà
4 023_COST(Moreagra)_S155_COL :24 Pagina 158 S1.158 X. arboricola pv. juglandis detection and identification methods Journal of Plant Pathology (2012), 94 (1, Supplement), S1.155-S1.159 Fig. 1. A. Colonies of Xanthomonas arboricola pv. juglandis growing on modified Tween medium, B. Symptoms induced by X. a. pv. juglandis infections 15 days post inoculation on leaves of potted walnut plants. et al. (2001) and Moragrega et al. (2008)]. To evaluate walnut susceptibility or resistance to bacterial blight a detached immature fruit inoculation test has been developed and widely used in cultivar susceptibility evaluation assays, assessment of strain virulence or determination of the efficacy of chemicals in walnut blight control. The method consists of artificial inoculation of bacterial suspensions on immature fruits (Gf+30) and incubation under controlled environment conditions as follows: (i) Immature fruits are collected, transported to the laboratory in cool boxes avoiding direct contact among them (lesions or blackening can occur if fruits are not carefully packed) and kept at 4ºC. Fruits can be stored for several days under these conditions before inoculation. (ii) Fruits are disinfected in a sodium hypochlorite solution (3-5 % i.a.) for 5 min followed by three rinses in sterile distilled water are placed on sterile wet filter paper into transparent plastic boxes to assure high RH during incubation and avoid fruit dehydration. A virulent strain of the bacterium must be used. (iii) Inoculate by injection a 30 µl drop of ca CFU ml -1 (A600 = 0.2) bacterial suspension on the equatorial zone of the fruits. Bacterial suspensions in sterile distilled water are obtained from cultures grown on NA medium at 27ºC for 3-4 days. Three inoculations are made per fruit. Bacterial suspension should be inoculated in the mesocarp (just at the end of the green tissue at the limit with the white tissue) with a syringe. It is very important to make all inoculations on the same fruit tissue (do not reach the endocarp nor the seed). (iv) Incubate inoculated fruits at 25ºC, >90% RH (high RH is assured if fruits are placed onto sterile wet filter paper into boxes) and 16 h light photoperiod, for days at 25 C. (v) Control fruits are inoculated with sterile distilled water instead of bacteria. The number of fruits per replicate can vary according to experimental design or availability. (vi) After days incubation (when disease progression in a susceptible cultivar is clearly observed through all walnut tissues and they become necrotic) the incidence and severity of the symptoms on inoculated fruits is determined. Each fruit is transversally cut and disease progression in the fruit is assessed. Disease incidence is determined by the presence of symptoms (necrosis surrounding the inoculation point and extending to other tissues) on each inoculation in a fruit. Disease severity is determined according to Infection Severity Indexes (I): 0, no infection; 1, necrosis located to the inoculation point; 2, necrosis extending from the inoculation point through the green tissue; 3, necrosis extending through the mesocarp and reaching the endocarp; and 4, necrosis affecting the seed. Disease severity per replicate (S) is calculated from disease severity indexes. REFERENCES Aletà N., Ninot A., Moragrega C., Llorente I., Montesinos E., Blight sensitivity of Spanish selections of Juglans regia. Acta Horticulturae 544: Bergey s Manual of Determinative Bacteriology (1930): Phytomonas juglandis (Pierce) Bergey et al. 3rd Ed. William and Wilkins, Baltimore, MD, USA. Chun W.W.C., Xanthomonadins, unique yellow pigments of the genus Xanthomonas. The Plant Health Instructor. DOI: /PHI-A Dowson W.J., On the systematic position and generic names of the Gram negative bacterial pathogens. Zentralblatt für Bakteriologie und Parasitenkunde 100:
5 023_COST(Moreagra)_S155_COL :24 Pagina 159 Journal of Plant Pathology (2012), 94 (1, Supplement), S1.155-S1.159 C. Moragrega S1.159 Dye D.W., 1978., Genus Xanthomonas Dowson New Zealand Journal of Agricultural Research 21: Dye D.W., Bradbury J.F., Goto M., Hayward A.C., Lelliott R.A., Scroth M.N., International standards for naming pathovars of phytopathogenic bacteria and a list of pathovar names and pathotypes. Review of Plant Patholology 59: Hajri A., Meyer D., Delort F., Guillaume J., Brin C., Manceau C., Identification of a genetic lineage within Xanthomonas arboricola pv. juglandis as the causal agent of vertical oozing canker of Persian (English) walnut in France. Plant Pathology 59: Lelliott R.A., Stead D.E., Methods for the Diagnosis of Bacterial Diseases of Plants.: British Society for Plant Pathology Blackwell Scientific Publications, Oxford, UK. Miller P.W., Bollen W.B., Walnut bacteriosis and its control. Oregon Agricutural. Experimental Station Technical Bulletin No. 9. Moragrega C., Llorente I., Montesinos E., Rovira M., Aletà N., Susceptibility of walnut cultivars and Spanish selections to bacterial blight (Xanthomonas arboricola pv. juglandis). Journal of Plant Pathology 90: S Moragrega C., Ozaktan H., Apical necrosis of Persian (English) walnut (Juglans regia): An update. Journal Pant Pathology 92: S167-S171. Moragrega C., Matias J., Aletà N., Montesinos E., Rovira M., Apical necrosis and premature drop of Persian (English) walnut fruit caused by Xanthomonas arboricola pv. juglandis. Plant Disease 95: Mulrean E.N., Schroth M.N., A semiselective agar medium for the isolation of Xanthomonas campestris pv. juglandis from walnut buds and catkins. Phytopathology 71: Ninot A., Aletà N., Moragrega C., Montesinos E., Evaluation of a reduced copper spraying program to control bacterial blight of walnut. Plant Disease 86: Pierce N.B., Walnut bacteriosis. Botanical Gazette 31: Schaad N.W, Jones J.B., Chum W., Laboratory Guide for Identification of Plant Pathogenic Bacteria. 3rd Ed. APS Press, St. Paul, MN, USA. Smith E.F., Bacterium juglandis (Pierce) E.F. Smith. In: Smith E.F. (ed.). Bacteria in Relation to Plant Diseases. Carnegie Institute, Whashington DC, USA. Starr M.P., Jenkins C.L., Bussey L.B., Andrews A.G., Chemotaxonomic significance of the xanthomonadins, novel brominated arylpolyene pigments produced by bacteria of the genus Xanthomonas. Archives of Microbiology 113: 1-9. Starr M.P., Stephens W.L., Pigmentation and taxonomy of the genus Xanthomonas. Journal of Bacteriology 87: Vauterin L., Hoste B., Kerster K., Swings J., 1995 Reclassification of Xanthomonas. International Journal of Systematic Bacteriology 45: Woeste K.E, McGranahan G.H., Schroth M.N., Variation among Persian walnuts in response to inoculation with Xanthomonas campestris pv. juglandis. Journal of the American Society of Horticultural Science 117:
6 023_COST(Moreagra)_S155_COL :24 Pagina 160
Study of Xanthomonas arboricola pv. juglandis Population Dynamics in French Walnut Orchards over Three Years
Study of Xanthomonas arboricola pv. juglandis Population Dynamics in French Walnut Orchards over Three Years M. Giraud 1,a, J.P. Prunet 2, A. Chevallier 2, S. Ramain 3, V. Thiriaud 4, I. Santrac 5 and
More informationInterpretation Guide. Yeast and Mold Count Plate
Interpretation Guide The 3M Petrifilm Yeast and Mold Count Plate is a sample-ready culture medium system which contains nutrients supplemented with antibiotics, a cold-water-soluble gelling agent, and
More informationScreening the susceptibility of some sweet cherry cultivars to Pseudomonas syringae pv. syringae isolates by immature fruitlet test
COST FA1104 Screening the susceptibility of some sweet cherry cultivars to Pseudomonas syringae pv. syringae isolates by immature fruitlet test Hatice Ozaktan Mustafa Akbaba University of Ege, Faculty
More informationXanthomonas arboricola pv. pruni
Blackwell Publishing Ltd European and Mediterranean Plant Protection Organization PM 7/64 (1) Organisation Européenne et Méditerranéenne pour la Protection des Plantes Diagnostics 1 Diagnostic Xanthomonas
More informationYeast nuclei isolation kit. For fast and easy purification of nuclei from yeast cells.
ab206997 Yeast nuclei isolation kit Instructions for use: For fast and easy purification of nuclei from yeast cells. This product is for research use only and is not intended for diagnostic use. Version
More informationph and Low Level (10 ppm) Effects of HB2 Against Campylobacter jejuni
ph and Low Level (10 ppm) Effects of HB2 Against Campylobacter jejuni Background/Purpose The contamination of food products by pathogenic organisms such as Salmonella or Campylobacter is an on-going problem
More informationMathur Agar This medium is made up of the following reagents: dextrose, magnesium sulfate, potassium phosphate, neopeptone, yeast extract, and agar.
Inoculum inoculation and media preparation of anthracnose, caused by Colletotrichum lindemuthuianum Halima E. Awale, Michigan State University, EL, MI 48824 Depending on the race of anthracnose you are
More informationAnalytical Method for Coumaphos (Targeted to agricultural, animal and fishery products)
Analytical Method for Coumaphos (Targeted to agricultural, animal and fishery products) The target compound to be determined is coumaphos. 1. Instruments Gas chromatograph-flame thermionic detector (GC-FTD)
More informationPROFICIENCY TESTS NO 19 AND EURL-Campylobacter National Veterinary Institute
PROFICIENCY TESTS NO 19 AND 20 2017 EURL-Campylobacter National Veterinary Institute NO OF NRLS PARTICIPATING IN THE PROFICIENCY TESTS 2017 PT 19 2016 PT 17 2015 PT 15 2014 PT 13 2013 PT 11 2012 PT 9 2011
More informationA. Hajri a, D. Meyer a, F. Delort b, J. Guillaumès a, C. Brin a and C. Manceau a * Introduction
Doi: 10.1111/j.1365-3059.2010.02362.x Identification of a genetic lineage within Xanthomonas arboricola pv. juglandis as the causal agent of vertical oozing canker of Persian (English) walnut in France
More information"Xanthomonas axonopodis pv. citrumelo"
Prepared by CABI and EPPO for the EU under Contract 90/399003 Data Sheets on Quarantine Pests "Xanthomonas axonopodis pv. citrumelo" IDENTITY Name: "Xanthomonas axonopodis pv. citrumelo" (Vauterin et al.
More informationWalnut Blight. Luke K. Milliron UC Cooperative Extension Farm Advisor Butte, Tehama, and Glenn Counties. November 7, 2018 UC Walnut Short Course
Walnut Blight Luke K. Milliron UC Cooperative Extension Farm Advisor Butte, Tehama, and Glenn Counties November 7, 2018 UC Walnut Short Course For the latest from UCCE orchard farm advisors Newsletters:
More informationION FORCE DNA EXTRACTOR FAST Cat. N. EXD001
ION FORCE DNA EXTRACTOR FAST Cat. N. EXD001 User Manual Via San Geminiano, 4 41030 San Prospero (MO) Italy : +39 059 8637161 : +39 059 7353024 : laboratorio@generon.it : www.generon.it [1] User Manual
More informationEffect of a protectant copper application on Psa infection of kiwifruit trap plants
310 Effect of a protectant copper application on Psa infection of kiwifruit trap plants J.L. Tyson 1, S.J. Dobson 2 and M.A. Manning 1 1 The New Zealand Institute for Plant & Food Research Limited, Private
More informationStudies on Bacterial Canker (Clavibacter michiganensis subsp. michiganensis) of Tomato (Solanum lycopersicum)
International Journal of Current Microbiology and Applied Sciences ISSN: 2319-7706 Volume 6 Number 9 (2017) pp. 317-323 Journal homepage: http://www.ijcmas.com Original Research Article https://doi.org/10.20546/ijcmas.2017.609.040
More informationDNA extraction method as per QIAamp DNA mini kit (Qiagen, Germany)
APPENDIX 3 (MOLECULAR TECHNIQUES) 3.2.2a) DNA extraction method as per QIAamp DNA mini kit (Qiagen, Germany) Two hundred microliters (200 µl) of the EDTA blood was added to 200 µl of Buffer AL and 20 µl
More informationProduction, Optimization and Characterization of Wine from Pineapple (Ananas comosus Linn.)
Production, Optimization and Characterization of Wine from Pineapple (Ananas comosus Linn.) S.RAJKUMAR IMMANUEL ASSOCIATE PROFESSOR DEPARTMENT OF BOTANY THE AMERICAN COLLEGE MADURAI 625002(TN) INDIA WINE
More informationCitrus Canker. Nian Wang 11/20/2017
Citrus Canker Nian Wang 11/20/2017 Citrus canker disease and pathogen Xanthomonas citri subsp. citri fruit drop, defoliation, yield losses 5-30%, fruit marketability quarantine restrictions Gottwald 2002
More informationAdvanced Yeast Handling. BFD education Kai Troester
Advanced Yeast Handling BFD education Kai Troester Agenda Why yeast storage Short term Long term Yeast Harvesting Yeast washing Sterile techniques Yeast propagation Equipment Why yeast storage Yeast is
More informationEffectiveness of the CleanLight UVC irradiation method against pectolytic Erwinia spp.
Page 1 of 12 Effectiveness of the CleanLight UVC irradiation method against pectolytic Erwinia spp. Zon Fruit & Vegetables Author: Agnieszka Kaluza Innovation & Development Engineer 29 November 2013 Versie:
More informationINDIAN COUNCIL OF AGRICULTURAL RESEARCH DIRECTORATE OF RAPESEED-MUSTARD RESEARCH, BHARATPUR, INDIA
INDIAN COUNCIL OF AGRICULTURAL RESEARCH DIRECTORATE OF RAPESEED-MUSTARD RESEARCH, BHARATPUR, INDIA Pathogenic variability of Sclerotinia sclerotiorum isolates on Brassica differentials Pankaj Sharma ICAR-Directorate
More informationDowny Mildew Confirmed in Ohio Cucumbers
VegNet Vol. 13, No. 10. July 6, 2006 Ohio State University Extension Vegetable Crops On the WEB at: http://vegnet.osu.edu If experiencing problems receiving this fax, Call 614-292-3857 In This Issue 1.
More informationYeastmaker Yeast Transformation System 2
User Manual Yeastmaker Yeast Transformation System 2 User Manual United States/Canada 800.662.2566 Asia Pacific +1.650.919.7300 Europe +33.(0)1.3904.6880 Japan +81.(0)77.543.6116 Clontech Laboratories,
More informationWorm Collection. Prior to next step, determine volume of worm pellet.
Reinke Lab ChIP Protocol (last updated by MK 05/24/13) Worm Collection 1. Collect worms in a 50ml tube. Spin and wait until worms are collected at the bottom. Transfer sample to a 15ml tube and wash with
More informationTreebreedex Seminar On IMPROVEMENT AND BREEDING OF NOBLE HARDWWOODS. Prof. Naldo Anselmi
Treebreedex Seminar On IMPROVEMENT AND BREEDING OF NOBLE HARDWWOODS PATHOLOGY ASPECTS TO BE CONSIDERED IN NOBLE HARDWOODS Results after the PROJECT RISELVITALIA Evaluation of resistance to anthracnose,
More informationDNA Extraction from Radioative Samples Grind plus kit Method
DNA Extraction from Radioative Samples Grind plus kit Method 4 th Edition 2017.5.24 To extract DNA from radioactive sediment samples with low biomass, we are currently not allowed to use chloroform or
More informationExperiment 6 Thin-Layer Chromatography (TLC)
Experiment 6 Thin-Layer Chromatography (TLC) OUTCOMES After completing this experiment, the student should be able to: explain basic principles of chromatography in general. describe important aspects
More informationPECTINASE Product Code: P129
PECTINASE Product Code: P129 Enzyme for sample clarification prior to patulin analysis. For in vitro use only. P129/V1/02.06.16 www.r-biopharm.com Contents Page Test Principle... 3 Kit Components... 3
More informationINTERPRETATION GUIDE AN INTRODUCTION TO USE AND INTERPRETING RESULTS FOR PEEL PLATE YM TESTS. FOR MORE INFORMATION, CONTACT CHARM SCIENCES.
PeelPlate AC- Aerobic Count PeelPlate AC- Aerobic PeelPlate AC- Aerobic Count PeelPlate AC- Aer INTERPRETATION GUIDE AN INTRODUCTION TO USE AND INTERPRETING RESULTS FOR PEEL PLATE YM TESTS. FOR MORE INFORMATION,
More informationMuseum Victoria CRC National Plant Biosecurity
1. PaDIL Species Factsheet Scientific Name: Ralstonia solanacearum (Smith 1896) Yabuuchi et al. 1996 race 2 (Bacteria: Proteobacteria: Burkholderiales: Burkholderiaceae) Common Name Moko disease of banana
More informationFungal Fungal Disease Citrus Black Black Spot Guignardia Guignardia citricarpa ): Id I entifi f catio ion io, Biology Biology and and Control
Fungal Disease Citrus Black Spot (Guignardia citricarpa): ) Identification, i io Biology and Control Drs. Megan Dewdney and Natalia Peres Causal agent: Guignardia citricarpa Asexual name: Phyllosticta
More informationEXAMPLES OF WHAT PLATES CAN LOOK LIKE
INTRODUCTION Peel Plate YM (Yeast and Mold) plates diffuse the test in media that omit growth agents and color substrates designed for the detection of yeast and mold food and from surface sponges of food.
More informationBromine Containing Fumigants Determined as Total Inorganic Bromide
Bromine Containing Fumigants Determined as Total Inorganic Bromide Introduction: Fumigants containing bromine, mainly methyl bromide, are used for soil disinfection as well as postharvest treatment of
More informationBacterial wilt of geranium and portulaca caused by Ralstonia solanacearum in Japan
67 Bacterial wilt of geranium and portulaca caused by Ralstonia solanacearum in Japan Katsumi Ozaki 1 and Hiroshi Watabe 2 1 Laboratory of Plant Pathology, Department of Horticulture, Faculty of Horticulture,
More informationWALNUT BLIGHT CONTROL USING XANTHOMONAS JUGLANDIS BUD POPULATION SAMPLING
WALNUT BLIGHT CONTROL USING XANTHOMONAS JUGLANDIS BUD POPULATION SAMPLING Richard P. Buchner, Steven E. Lindow, James E. Adaskaveg, Parm Randhawa, Cyndi K. Gilles, and Renee Koutsoukis ABSTRACT Years and
More informationEffects of ginger on the growth of Escherichia coli
Effects of ginger on the growth of Escherichia coli Jennes Eloïse Klapp Vanessa Project Jonk Fuerscher 2014 Effects of ginger on the growth of Escherichia Coli Jennes Eloïse Klapp Vanessa Abstract The
More information10. THE ROLE OF PLANT GROWTH REGULATORS IN THE DEVELOPMENT, GROWTH AND MATURATION OF THE FRUIT
The Division of Subtropical Agriculture. The Volcani Institute of Agricultural Research 1960-1969. Section B. Avocado. Pg 77-83. 10. THE ROLE OF PLANT GROWTH REGULATORS IN THE DEVELOPMENT, GROWTH AND MATURATION
More informationExperiment 3: Separation of a Mixture Pre-lab Exercise
1 Experiment 3: Separation of a Mixture Pre-lab Exercise Name: The amounts of sand, salt, and benzoic acid that will dissolve in 100 g of water at different temperatures: Temperature 0 C 20 C 40 C 60 C
More informationCitrus Black Spot Update
Citrus Black Spot Update Nan-Yi Wang, Ke Zhang, Jeffrey Rollins, Megan Dewdney Presenter: Jeffrey Rollins University of Florida 2016 Citrus Expo Black Spot Background Causal agent: Guignardia citricarpa
More informationEVALUATION OF WILD JUGLANS SPECIES FOR CROWN GALL RESISTANCE
EVALUATION OF WILD JUGLANS SPECIES FOR CROWN GALL RESISTANCE Daniel Kluepfel, Malli Aradhya, Malendia Maccree, Jeff Moersfelder, Ali McClean, and Wes Hackett INTRODUCTION Paradox is the most widely used
More informationMedically Important Yeasts
Medically Important Yeasts The Medically Important Yeasts 1. Candida albicans>> Candidiasis 2. Candida sp. >> Candidiasis 3. Trichosporon beigelii >> Trichosporonosis, Candidiasis 4. Geotricum condidium
More informationThe GOODELL laboratory
The GOODELL laboratory Author Title Introduction Materials Protocol Shannon L.McKinney, KathyJo Jackson, Corinne Sonnet, Margaret A. Goodell 1996 Isolation of a heterogenous muscle-derived cell population
More informationTORELANCE LEVEL OF DIFFERENT CABBAGE VARIETIES TO BLACK ROT BY: MUNENE DAVID M. A22/0081/2009 SUPERVISOR: PROF. DANIEL MUKUNYA
TORELANCE LEVEL OF DIFFERENT CABBAGE VARIETIES TO BLACK ROT BY: MUNENE DAVID M. A22/0081/2009 SUPERVISOR: PROF. DANIEL MUKUNYA Cabbage is the most valued and the most used vegetable in the world Of all
More informationLACTIC ACID BACTERIA (OIV-Oeno , Oeno )
LACTIC ACID BACTERIA (OIV-Oeno 328-2009, Oeno 494-2012) 1. OBJECT, ORIGIN AND FIELD OF APPLICATION Lactic acid bacteria are used in oenology to perform malolactic fermentation. The lactic acid bacteria
More informationDetermination of Melamine Residue in Milk Powder and Egg Using Agilent SampliQ Polymer SCX Solid Phase Extraction and the Agilent 1200 Series HPLC/UV
Determination of Melamine Residue in Milk Powder and Egg Using Agilent SampliQ Polymer SCX Solid Phase Extraction and the Agilent 1200 Series HPLC/UV Application Note Food Safety Authors Chen-Hao Zhai
More informationCAMPYLOBACTER IN MILK ( OR: CHERCHEZ LES CAMPYLOBACTERS IN MILK ) Eva Olsson Engvall
CAMPYLOBACTER IN MILK ( OR: CHERCHEZ LES CAMPYLOBACTERS IN MILK ) Eva Olsson Engvall 12th EURL Campylobacter workshop Nantes, France, 14-15 September, 2017 WHY SAMPLE MILK? Outbreak situations, search
More informationBudrot in green kiwifruit (Actinidia sp.) varieties Spring 2014
PFR SPTS No. 11140 Budrot in green kiwifruit (Actinidia sp.) varieties Spring 2014 Tyson JL, Curtis CL, Manning MA February 2015 Confidential report for: Zespri Group Limited DISCLAIMER Unless agreed otherwise,
More informationApplication Note CL0311. Introduction
Automation of AOAC 970.16 Bitterness of Malt Beverages and AOAC 976.08 Color of Beer through Unique Software Control of Common Laboratory Instruments with Real-Time Decision Making and Analysis Application
More informationCitrus Canker and Citrus Greening. Holly L. Chamberlain Smoak Groves AGRI-DEL, INC. Lake Placid, FL
Citrus Canker and Citrus Greening Holly L. Chamberlain Smoak Groves AGRI-DEL, INC. Lake Placid, FL Hurricanes 2004 and 2005 Challenges Facing FL Citrus Production Citrus Greening Competition Citrus Canker
More information(Definition modified from APSnet)
Development of a New Clubroot Differential Set S.E. Strelkov, T. Cao, V.P. Manolii and S.F. Hwang Clubroot Summit Edmonton, March 7, 2012 Background Multiple strains of P. brassicae are known to exist
More informationThe importance and implications of high health planting material for the Australian almond industry
The importance and implications of high health planting material for the Australian almond industry by Brendan Rodoni, Mirko Milinkovic and Fiona Constable (Victorian DPI) Plant viruses and Perennial fruit
More informationRESOLUTION OIV-OENO 576A-2017
RESOLUTION OIV-OENO 576A-2017 MONOGRAPH OF SACCHAROMYCES YEASTS THE GENERAL ASSEMBLY, In view of article 2, paragraph 2 iv of the Agreement of 3 April 2001 establishing the International Organisation of
More informationA stem canker disease of olive (Olea europaea) in New Zealand
New Zealand Journal of Crop and Horticultural Science, 01, Vol. 29: 2-228 0014-0671/01/2903-02 $7.00 The Royal Society of New Zealand 01 2 Plant disease record A stem canker disease of olive (Olea europaea)
More informationWSU Crop and Soil Sciences
Ecology of a Compost Tea Catherine Crosby Ph.D. candidate Ph.D. candidate WSU Crop and Soil Sciences Compost Tea (Compost Extract) 1 part compost : 1-100 parts water Inoculants Growth stimulators, microbe
More informationFirst Occurence and Susceptibility of Prunus Species to Erwinia amylovora in Hungary
First Occurence and Susceptibility of Prunus Species to Erwinia amylovora in Hungary László Palkovics and Anita Végh Department of Plant Pathology, Faculty of Horticultural Sciences, Corvinus University
More informationIdentification of reconstituted milk in pasteurized and UHT milk
Translated English of Chinese Standard: NY/T939-2005 Translated by: www.chinesestandard.net Wayne Zheng et al. Email: Sales@ChineseStandard.net NY Agriculture Industry Standard of The People s Republic
More informationProd t Diff erenti ti a on
P d t Diff ti ti Product Differentiation September 2011 1 Yeast Products Marketed Are they all the same? Summary of Dried Yeast Products Defined by AAFCO Minimum Contains Contains # Product Name AAFCO
More informationTwig Die-Back of Tea Caused by. Macrophoma theicola in Taiwan*
Twig Die-Back of Tea Caused by Macrophoma theicola in Taiwan* Jee-song CHEN**, Fang-ming THSENG** and Wen-hsiung Ko*** Abstract Dead twigs of unknown cause standing among healthy twigs with normal green
More informationCitrus. Disease Guide. The Quick ID Guide to Emerging Diseases of Texas Citrus. Citrus. Flash Cards. S. McBride, R. French, G. Schuster and K.
E-265 1/12 Citrus Flash Cards S. McBride, R. French, G. Schuster and K. Ong Citrus Disease Guide The Quick ID Guide to Emerging Diseases of Texas Citrus The Quick ID Guide to Emerging Diseases of Texas
More informationSetting up your fermentation
Science in School Issue 24: Autumn 2012 1 Setting up your fermentation To carry out all the activities, each team of students will need about 200 ml of fermentation must, 200 ml of grape juice and about
More informationPhytophthora citricola Advances in our Understanding of the Disease
1988 Summary of Avocado Research, pages 16-24 Avocado Research Advisory Committee University of California, Riverside Phytophthora citricola Advances in our Understanding of the Disease Peter Oudemans
More informationBacterial Growth and Morphology found in Tea. Biology Department, PSU Kiersten Fullem Chongwen Shi Sebastian Cevallos
Bacterial Growth and Morphology found in Tea Biology Department, PSU Kiersten Fullem Chongwen Shi Sebastian Cevallos Why Study the Microbiology of Tea? 3 billion cups of tea are consumed daily all over
More informationInstructor: Stephen L. Love Aberdeen R & E Center 1693 S 2700 W Aberdeen, ID Phone: Fax:
Vegetable Crops PLSC 451/551 Lesson 7, Harvest, Handling, Packing Instructor: Stephen L. Love Aberdeen R & E Center 1693 S 2700 W Aberdeen, ID 83210 Phone: 397-4181 Fax: 397-4311 Email: slove@uidaho.edu
More informationChick Utricle Dissection Method
Step 1: Proceed after removing the head. Chick Utricle Dissection Method Chick Utricle Dissection Method Step 2: Insert tips of scissors beneath skin along the side of the head so as to clip through the
More informationDr.Nibras Nazar. Microbial Biomass Production: Bakers yeast
Microbial biomass In a few instances the cells i.e. biomass of microbes, has industrial application as listed in Table 3. The prime example is the production of single cell proteins (SCP) which are in
More informationBacterial Wilt of Dry Beans in Western Nebraska
University of Nebraska - Lincoln DigitalCommons@University of Nebraska - Lincoln Panhandle Research and Extension Center Agricultural Research Division of IANR 2011 Bacterial Wilt of Dry Beans in Western
More informationTrends in diagnoses of soybean foliar disease for 2015 Karen Lackermann, DuPont Pioneer
Trends in diagnoses of soybean foliar disease for 2015 Karen Lackermann, DuPont Pioneer What is the Pioneer Plant Diagnostic Laboratory? The primary Diagnostic Lab is located in Johnston, Iowa For over
More informationGeographical Distribution and Causal Agents of Chile Pepper Wilt in New Mexico
Geographical Distribution and Causal Agents of Chile Pepper Wilt in New Mexico Bulletin 789 Soum Sanogo 1 and Jared Carpenter 2 Agricultural Experiment Station College of Agriculture and Home Economics
More informationIN VITRO PRESERVATYION OF STRAWBERRY GENETIC RESOURCES
IN VITRO PRESERVATYION OF STRAWBERRY GENETIC RESOURCES Aim of the work is the development of efficient protocols for the in vitro proliferation and conservation of strawberry germplasm. With this aim have
More informationConcentration methods of fecal parasites
Concentration methods of fecal parasites Concentration techniques A concentration technique is performed mainly to separate the parasites from fecal debris. The concentration procedure not only increases
More informationFAT, TOTAL (Hydrolysis)
FATTO.01-1 FAT, TOTAL (Hydrolysis) PRINCIPLE The major portions of the native fats in corn starch are bound in a manner as to render them unextractable by the usual methods of solvent extraction. When
More informationChemistry 212 MOLAR MASS OF A VOLATILE LIQUID USING THE IDEAL GAS LAW
Chemistry 212 MOLAR MASS OF A VOLATILE LIQUID USING THE IDEAL GAS LAW To study the Ideal Gas Law. LEARNING OBJECTIVES To determine the molar mass of a volatile liquid. BACKGROUND The most common instrument
More informationSeparations. Objective. Background. Date Lab Time Name
Objective Separations Techniques of separating mixtures will be illustrated using chromatographic methods. The natural pigments found in spinach leaves, β-carotene and chlorophyll, will be separated using
More informationCitrus Health Response Program
PATHOLOGY TRAINING Citrus Health Response Program Objectives: 1. To learn about Citrus Canker A. Identifying citrus canker leaf suspects. B. Identifying i citrus canker fruit suspects. 2. To compare Citrus
More informationC27 Chromatography. Collect: Column Mortar and pestle Dropper (229 mm) Capillary tube TLC plate Aluminum foil UV light
C27 Chromatography (2017/04/24) Collect: Column Mortar and pestle Dropper (229 mm) Capillary tube TLC plate Aluminum foil UV light Prepare: Green leaves Beaker (30 100 ml) Erlenmeyer flask (50, 125 ml)
More informationAugust Instrument Assessment Report. Bactest - Speedy Breedy. Campden BRI
August 2013 Instrument Assessment Report Campden BRI food and drink innovation Bactest - Speedy Breedy Assessment of the suitability of Speedy Breedy as a rapid detection method for brewing contaminants
More informationWALNUT BLIGHT CONTROL USING INTEGRATED PEST MANAGEMENT TECHNIQUES
WALNUT BLIGHT CONTROL USING INTEGRATED PEST MANAGEMENT TECHNIQUES Richard P. Buchner, Steven E. Lindow, James E. Adaskaveg, Cyndi K. Gilles, and Renee Koutsoukis ABSTRACT Three years of surveying walnut
More informationVITAMIN B12 PRODUCTION BY Propionibacterium shermanil In Tempeh Warawut Krusong, Busaba Yongsmith* and Priscilla C. Sanchez**
VITAMIN B12 PRODUCTION BY Propionibacterium shermanil In Tempeh Warawut Krusong, Busaba Yongsmith* and Priscilla C. Sanchez** Department of Agro-Industry, Faculty of Agricultural Technology, King Mongkut's
More informationIn the preparation of this Tanzania Standard assistance was derived from:
TANZANIA BUREAU OF STANDARDS DRAFT TANZANIA STANDARD COCONUT MILK AND COCONUT CREAM SPECIFICATION (DRAFT FOR COMMENT ONLY) AFDC 4 (3761) P3 0 FOREWORD Coconut milk and coconut cream shall be prepared by
More informationIdentification and Classification of Pink Menoreh Durian (Durio Zibetinus Murr.) Based on Morphology and Molecular Markers
RESEARCH Identification and Classification of Pink Durian (Durio Zibetinus Murr.) Based on Morphology and Molecular Markers Nandariyah a,b * adepartment of Agronomy, Faculty of Agriculture, Sebelas Maret
More informationAnalysis of Beta-Carotene and Total Carotenoids from Pacific Sea Plasma (Spectrophotometric Method)
Analysis of Beta-Carotene and Total Carotenoids from Pacific Sea Plasma (Spectrophotometric Method) Background: Spirulina has several carotenoids, the major components being β-carotene, zeaxanthin, echinenone,
More informationForest Pathology in New Zealand No. 22 (Second Edition 2010) Lupin blight. Monique Williams
Forest Pathology in New Zealand No. 22 (Second Edition 2010) Lupin blight Monique Williams (Revised by M.A. Dick) Fig. 1 - Shoot of Lupinus arboreus showing crooked and twisted tip caused by Colletotrichum
More informationRecognizing and Managing Blueberry Diseases
Recognizing and Managing Blueberry Diseases 2016 Mississippi Blueberry Education Workshop Hattiesburg, Mississippi January 14, 2016 Rebecca A. Melanson, Extension Plant Pathologist Central MS Research
More informationVisit to Chile to assess impacts of Psa-V, and to better coordinate research efforts
Visit to Chile to assess impacts of Psa-V, and to better coordinate research efforts In January 2014, Dave Tanner and Barry O Neil visited Chile and meet with industry leaders, government officials and
More informationDefinition of Honey and Honey Products
Definition of Honey and Honey Products Approved by the National Honey Board June 15, 1996 Updated September 27, 2003 PART A: HONEY I. Definition Honey is the substance made when the nectar and sweet deposits
More informationSDS-PAGE. Resolving gel Stacking gel
SDS-PAGE Resolving gel Stacking gel For large gel, thin thickness large gel, thin thickness 10 ml 30% acrylamide 2.6 ml 30% acrylamide 7.5 ml 4X soln* Tris ph 8.9 5 ml 4X soln* Tris ph 6.8 12.5 ml ddh
More informationDetermination Of Saponin And Various Chemical Compounds In Camellia Sinensis And Genus Ilex.
Determination Of Saponin And Various Chemical Compounds In Camellia Sinensis And Genus Ilex. Sensus Technical Note (SEN-TN-0027) 05/22/2009 ABSTRACT Youngmok Kim, Ph.D. and Daniel J. Wampler, Ph.D. Saponin
More informationAccuID TM _V1. Bone DNA Preparation Protocol. SNP based New Human Identification Technology. Protocol Version
AccuID TM _V1 SNP based New Human Identification Technology Bone DNA Preparation Protocol Protocol Version 1.0 2013.10.02 Copyright 2013 DNA Link, Inc. All rights reserved. AccuID TM Bone Preparation Protocol
More informationManaging Stone Fruit Diseases. Mohammad Babadoost University of Illinois Tree Fruit Schools 2,3 February 2016
Managing Stone Fruit Diseases Mohammad University of Illinois babadoos@illinois.edu Tree Fruit Schools 2,3 February 2016 Updates in the Spray Guides One spray guide for all fruit crops No new fungicides
More informationSCENARIO Propose a scenario (the hypothesis) for bacterial succession in each type of milk:
Prokaryotic Diversity! and Ecological Succession in Milk Name INTRODUCTION Milk is a highly nutritious food containing carbohydrates (lactose), proteins (casein or curd), and lipids (butterfat). is high
More informationHARVEST & POST-HARVEST PRACTICES. Harvest Fermentation Drying Micro-fermentation HARVESTING FERMENTATION
HARVEST & POST-HARVEST PRACTICES Harvest Fermentation Drying Micro-fermentation Information for this chapter is taken from CAOBISCO/ECA/FCC Cocoa Beans: Chocolate and Cocoa Industry Quality Requirements.
More informationGlobal Salm-Surv. A global Salmonella surveillance e and laboratory support project. Laboratory Protocols. Step 2 Training Course
Global Salm-Surv A global Salmonella surveillance e and laboratory support project of the World Health Organization Laboratory Protocols Step 2 Training Course Isolation of thermotolerant Campylobacter
More information3. Aspirin Analysis. Prelaboratory Assignment. 3.1 Introduction
In this experiment, you will analyze the purity of your crude and recrystallized aspirin products using a method called thin layer chromatography (TLC). You will also determine the percent yield of your
More informationCollecting, Drying, and Storing Chestnut Anthers Version 2.0
Collecting, Drying, and Storing Chestnut Anthers Version 2.0 1 Paul Sisco June 6, 2008 Following is a step-by-step guide to collecting, drying, and storing chestnut anthers. This closely follows the method
More informationGROWTH RATES OF RIPE ROT FUNGI AT DIFFERENT TEMPERATURES
: 77-84 GROWTH RATES OF RIPE ROT FUNGI AT DIFFERENT TEMPERATURES T.A. Elmsly and J. Dixon Avocado Industry Council Ltd., P.O. Box 13267, Tauranga 3110 Corresponding author: tonielmsly@nzavaocado.co.nz
More informationPsa and Italian Kiwifruit Orchards an observation by Callum Kay, 4 April 2011
Psa and Italian Kiwifruit Orchards, 2011 The Psa-research programme in New Zealand draws on knowledge and experience gained from around the world particularly in Italy, where ZESPRI, Plant & Food Research
More informationOne class classification based authentication of peanut oils by fatty
Electronic Supplementary Material (ESI) for RSC Advances. This journal is The Royal Society of Chemistry 2015 One class classification based authentication of peanut oils by fatty acid profiles Liangxiao
More informationGUIDELINES TO DETERMINE THE EFFECT OF FUNGICIDAL AGRICULTURAL REMEDIES ON FERMENTATION PROCESSES AND WINE QUALITY
GUIDELINES TO DETERMINE THE EFFECT OF FUNGICIDAL AGRICULTURAL REMEDIES ON FERMENTATION PROCESSES AND WINE QUALITY Issued by the Registrar: Act No. 36 of 1947, Private Bag X343, Pretoria 0001, Republic
More informationCORN, CANOLA, & ALFALFA BULK GRAIN
CORN, CANOLA, & ALFALFA BULK GRAIN AgraStrip RUR-HS Bulk Grain Strip Test Part Number 7000011 Intended Use The intended use of the kit is the qualitative (yes/no) determination of the CP4 EPSPS protein
More informationVMP 930L Fall 2017 APPENDIX C VETERINARY PARASITOLOGY DIAGNOSTIC TECHNIQUES
APPENDIX C VETERINARY PARASITOLOGY DIAGNOSTIC TECHNIQUES 41 VETERINARY PARASITOLOGY DIAGNOSTIC TECHNIQUES 1. Direct Fecal. Utilized to diagnose intestinal Protozoan trophs. Students will be provided with
More information