University of Warwick institutional repository: This paper is made available online in accordance with publisher

Transcription

1 University of Warwick institutional repository: This paper is made available online in accordance with publisher policies. Please scroll down to view the document itself. Please refer to the repository record for this item and our policy information available from the repository home page for further information. To see the final version of this paper please visit the publisher s website. Access to the published version may require a subscription. Author(s): Alix, Karine; Joets, Johann; Ryder, Carol D.; Moore, Jay; Barker, Guy C.; Bailey, John P.; King, Graham J.; Pat Heslop- Harrison, John S Article Title: The CACTA transposon Bot1 played a major role in Brassica genome divergence and gene proliferation Year of publication: 2008 Link to published version: /j X x Publisher statement: The definitive version is available at

2 The CACTA transposon Bot1 played a major role in Brassica genome divergence and gene proliferation Karine ALIX 1*, Johann JOETS 1, Carol D. RYDER 2, Jay MOORE 2, Guy C. BARKER 2, John P. BAILEY 3, Graham J. KING 4 and J. S. (Pat) HESLOP- HARRISON 3 1 UMR de Génétique Végétale INRA/Univ Paris-Sud/CNRS/AgroParisTech, Ferme du Moulon, F Gif-sur-Yvette, France 2 Warwick HRI, Wellesbourne, Warwick CV35 9EF, UK 3 Department of Biology, University of Leicester, Leicester LE1 7RH, UK 4 Rothamsted Research, Harpenden, Hertfordshire, AL5 2QJ, UK *author to whom correspondence should be addressed alix@moulon.inra.fr, phone: +33/(0) , fax: +33/(0) Running title: Role of CACTA Bot1 in Brassica genome evolution Keywords: En/Spm transposable element, Brassica oleracea, Brassica rapa, genome evolution, SLL3 gene, S locus The TE sequences reported in this paper have been deposited in the EMBL database under accessions nos. AM AM888369; the three B. oleracea BAC sequences have been deposited under accessions nos. EU EU Word count: 6,938 Submit to The Plant Journal 1

3 SUMMARY We isolated and characterized a Brassica C genome-specific CACTA element, designated Bot1 (B. oleracea transposon 1). Analysing phylogenetic relationships, copy numbers and sequence similarity of Bot1 and Bot1-analogues in B. oleracea (C genome) vs. B. rapa (A genome), we concluded that Bot1 has encountered several rounds of amplification in the oleracea genome only, playing a major role in the recent rapa and oleracea genome divergence. We performed in silico analyses of the genomic organization and internal structure of Bot1 and establish which segment of Bot1 is C genome specific. Our work represents the first report of a fully characterised Brassica repetitive sequence which can distinguish the Brassica A and C chromosomes in the allotetraploid B. napus, by fluorescent in situ hybridization. We demonstrated that Bot1 carries a host S locus-associated SLL3 gene copy. We speculate that Bot1 was involved in the proliferation of SLL3 around the Brassica genome. The present study reinforces the assumption that transposons are major drivers of genome and gene evolution in higher plants. 2

4 INTRODUCTION Repetitive DNA sequence motifs represent a large fraction of the eukaryotic genome; they account for at least 50% of the human genome (IHGSC, 2001), and in some plants they can constitute up to 80% of the genome (Meyers et al., 2001; Vicient et al., 2001). Repetitive sequences can be divided into two broad groups: those that are tandemly repeated and form large blocks in the genome, and those that have a dispersed genomic distribution and include transposable elements (TEs) (for review Heslop-Harrison, 2000). Transposable, or mobile, elements are divided into two main classes (Wicker et al., 2007), according to the presence or absence of an RNA transposition intermediate: class I elements or retrotransposons move via an RNA intermediate, which is reverse transcribed prior to its reintegration into the genome; class II transposons directly move as DNA elements, including transposons that copy themselves for insertion (subclass 2) and the others that leave the donor site to reintegrate elsewhere in the genome (subclass 1). It is now assumed that repetitive elements, especially TEs, are major drivers of genome and gene evolution (for reviews: Bennetzen, 2005; Casacuberta and Santiago, 2003; Fedoroff, 2000; Kazazian, 2004). In plants, nuclear genome sizes vary tremendously between species; while polyploidy (a key evolutionary process in plants; Gaeta et al., 2007; Wendel, 2000) is often associated with rapid and dramatic changes in sizes of the constituent genomes, it has been shown that most genome size variability is associated with differences in repetitive DNA content and is mainly ascribed to differential amplification of TEs (Hawkins et al., 2006). There is also a possible higher order chromosome structural role for repeats, related to packaging of genes, DNA methylation or histone modifications and genetic regulation, with consequential effects 3

5 on rate of recombination: large-scale genome rearrangements are commonly found near or at regions enriched for repeated DNA (Eichler and Sankoff, 2003). The role of transposons in gene evolution in plants has been demonstrated only recently. Class II transposons preferentially target gene-rich regions for insertion, as observed in Arabidopsis, rice and maize (for reviews, Feschotte et al., 2002 and Walbot and Petrov, 2001). Studies on flowering plants provided evidence for the involvement of transposons in generation and evolution of genes by mechanisms of transposon capture and exon shuffling (for reviews, Bennetzen, 2005 and Morgante, 2006). Examples of transposons mediating gene movements were first represented by Pack- MULEs (Mutator-like transposable elements) found in maize (Talbert and Chandler, 1988), Arabidopsis (Yu et al., 2000) and rice (Turcotte et al., 2001). In rice, it has been estimated that 3,000 Pack-MULEs contain genic fragments derived from more than 1,000 different cellular genes, with some of the captured genes being transcribed and potentially functional (Jiang et al., 2004). Helitrons, which transpose by rolling-circle replication (for review Kapitonov and Jurka, 2007), were discovered by computer-based analysis of genomic sequences from Arabidopsis, Caenorhabditis elegans and rice, and were reported to have recruited host genes, and multiplied them in the host genomes (Kapitonov and Jurka, 2001), seen also in maize (Brunner et al., 2005; Morgante et al., 2005). Elements of another superfamily of subclass 1 transposons, called CACTA or En/Spm (referred to the first element described in maize, Enhancer/Suppressor-mutator Peterson, 1953), were also able to capture host cellular genic fragments (Kawasaki and Nitasaka, 2004; Rocarro et al., 2005; Zabala and Vodkin, 2005) which were retained as functional coding sequences (Zabala and Vodkin, 2007). According to these different studies, transposons have the potential to amplify genes across the genome and 4

6 to create novel genes by capturing and rearranging genic sequences, which thus represents an important mechanism for the evolution of genes in higher plants and can lead to rapid diversification of genome lineages during speciation. Access to the complete genomic sequence of Arabidopsis thaliana demonstrated that Arabidopsis harbours all of the TE types found in larger plant genomes (AGI, 2000), and a recent comparative analysis based on bioinformatics showed that A. thaliana and Brassica oleracea (Brassica genome CC) share largely the same collection of TEs (but in differing proportions, the number of elements of each type of TEs being greater in B. oleracea) (Zhang and Wessler, 2004), in accordance with the high level of sequence conservation between the two species which diverged from a common ancestor million years ago (Yang et al., 1999). Up to now, only a very small fraction of the Brassica TEs has been studied and analysed at the molecular level; indeed, efforts were focused on the isolation, sequence characterization and molecular evolution mainly of class I TEs including LTR-retrotransposons and LINEs (Alix et al., 2005; Alix and Heslop-Harrison, 2004), SINEs (S1: Deragon et al., 1994; BoS: Zhang and Wessler, 2005), and recently TRIM (Yang et al., 2007). Interestingly, it has been estimated that the most abundant class II superfamily in B. oleracea is CACTA (Zhang and Wessler, 2004). The designation CACTA refers to the flanking terminal inverted repeats (TIRs), normally 10 to 28bp long, which terminate in a conserved 5 -CACTA-3 motif. CACTA elements also have characteristic sub-terminal repetitive regions of 10 to 20bp units which are repeated in direct and inverted orientations. The En/Spm transposable element system of maize was the first CACTA element that was isolated and characterized at the molecular level (Pereira et al., 1986). Internal sequences of CACTA 5

7 elements are highly variable, and it is difficult to identify CACTA transposons from only the analysis of sequence similarity; therefore, most CACTA transposons were found because of the presence of a transposase-like protein and a terminal CACTA motif. CACTA elements seem to be found mostly in plants (DeMarco et al., 2006; Wicker et al., 2003), and several autonomous and active CACTA (En/Spm) transposons were isolated and characterized in various plant species including Tam1 in snapdragon (Nacken et al., 1991), Tdc1 in carrot (Itoh et al., 2003; Ozeki et al., 1997), Tpn1 in Japanese morning glory (Inagaki et al., 1994), Ps1 in petunia (Snowden and Napoli, 1998), Rim2 in rice (He et al., 2000), CAC1 in Arabidopsis (Miura et al., 2001) and in Beta vulgaris (Jacobs et al., 2006). In the present work, we isolated and characterized a Brassica C genome specific CACTA transposon, designated Bot1 (Brassica oleracea transposon 1). We assessed the genome-specificity of this B. oleracea class II transposon by carrying out sequence, molecular and cytogenetic analyses on representatives of six diploid and allotetraploid Brassica species; our results show that Bot1 has proliferated within the C genome contributing to Brassica genome divergence. Moreover, characterising Bot1, we have identified the domain which appears to be C genome specific and a new example of a transposon capturing a host gene, with the systematic finding of the S locus-associated SLL3 gene copy inside the CACTA Bot1; we speculate that Bot1 was involved in the multiplication of SLL3 across the Brassica genome. Thus this study confirms that transposons are major drivers of genome and gene evolution in higher plants. 6

8 RESULTS Isolation of Bot1, a Brassica C genome-specific transposon We carried out PCR using the degenerate primer pair BEL1MF/BEL2MR (originally designed to amplify LINE-related retrotransposons; Kubis et al., 2003) with genomic DNA from the three diploid Brassica species, B. rapa (Brassica genome AA), B. nigra (BB), and B. oleracea (CC), and the three allotetraploid species, B. napus (AACC), B. juncea (AABB) and B. carinata (BBCC) of U s triangle (1935) (plant material is listed in Table 1). A 410bp fragment was amplified from all six species and shown to represent LINEs (Alix and Heslop-Harrison, 2004). In contrast, and fortuitously, a 1kb fragment was amplified only in Brassica species including the C genome: B. oleracea (CC), B. napus (AACC) and B. carinata (BBCC). The 1kb fragment was tested on a set of 24 accessions and was observed in 9 B. oleracea accessions, 9 B. napus, and 1 B. carinata, but not seen in 2 B. rapa, 1 B. nigra, or 2 B. juncea (a subset of the results obtained is given in Figure 1a), and further tests showed the 1kb fragment was also amplified with the single primer BEL1MF (Figure 1a; BEL2MR alone gave no products). We cloned representatives of the 1kb-band from the three species possessing the C genome (Table 1). To examine the genomic distribution of the amplicon, clone Bo6L1-15 (from B. oleracea, see Methods for nomenclature, EMBL accession #AM888359) was used for Southern hybridization to EcoRI-digests of genomic DNA from the six Brassica species; hybridization signals were only detected in Brassica species with the C genome, with stronger hybridization to B. oleracea (Figure 1b). Analysis of the 16 sequences from various accessions of diploids and allopolyploids with the C genome (EMBL accession nos. AM AM888369) showed ten were 7

9 around 1010bp long; five others had a single deletion of 29bp relative to these, while one had an additional 69bp deletion (Figure S1). Fifteen of the sequences contained a 312bp ORF encoding a protein of 103 amino acids (Bn14L1-25 had a SNP, TGA GGA). Sequences were conserved within coding (average of 81% at DNA level) and non-coding (67%) regions. BLASTN comparisons using Bo6L1-15 (1010bp) as a query sequence identified homologous fragments in three BAC sequences from a B. oleracea BAC library (the BoB library from Warwick-HRI see Alix et al. (2005) which correspond to a triplicated region within the B. oleracea genome (C. Ryder, unpublished data): BoB028L01 EMBL accession number EU642504, BoB048N13 #EU642506, and BoB029L16 #EU with respectively 63%, 92%, and 96% similarity to Bo6L1-15. BLAST comparisons also indicated that Bo6L1-15 was homologous to fragments in three B. oleracea sequence contigs (contigs A, G, and B: EMBL accessions #AC183495, AC and AC183493; Town et al., 2006), again corresponding to two sets of paralogous triplicated sequences within the B. oleracea genome (O Neill and Bancroft, 2000). We obtained other significant sequence identities with a single B. napus clone corresponding to the non-coding part of the S locus region (EMBL accession #AJ245479; Cui et al., 1999) and eight B. rapa BAC sequences (AC189496, AC189360, AC189655, AC189480, AC189314, AC189341, AC189446, AC189258). The conserved 103aa-long ORF exhibited homologies to multiple plant En/Spm-like transposases (from Arabidopsis: AAF06087, AAG50553; from carrot: AB070979; or from Medicago: ABE78938). We chose the designation Bot1, Brassica oleracea transposon 1, for this Brassica C genome-specific element. BLAST searches with the ORF of the Bot1 representative Bo6L1-15 as a query sequence against the Brassica EST 8

10 database revealed strong homologies between the Bot1 coding sequence and one B. oleracea EST (AM394037), the B. napus EST CN and a set of forty two B. napus ESTs (UniGene Bna.6539). Interestingly, the B. oleracea EST AM corresponds to a drought-stress induced EST in the database (Paniwnyk Z., Pink D., Akehurst J., Buchanan-Wollaston V., unpublished work), and the B. napus EST CN has been identified at early stages of seed development under abiotic stress conditions (Georges F., unpublished). We performed phylogenetic analyses on the 16 Bot1 ORF sequences we isolated and 13 other ORF sequences of Bot1 from B. oleracea or of Bot1-related elements from B. napus and B. rapa obtained from the three BoB BAC sequences or mined from the database (including those published by Town et al., 2006; see methods). Topologies of trees from the maximum parsimony (MP), maximum likelihood (ML; Figure 2) and neighbour-joining (NJ) analyses were similar, showing two main clades supported by a bootstrap value of 100%, with Bot1 constituting a C genome-specific phylogenetic clade (Figure 2). The Bot1 clade is marked by unresolved polytomies (rake-like branching) suggesting a low rate of sequence divergence, in accordance with the extensive identity we observed among the ORFs of Bot1 (see above). In contrast, the second major clade which tends to be Brassica A genome-specific shows a wellresolved phylogeny with all branches supported by high bootstrap values (Figure 2) suggesting a relatively high rate of sequence divergence. Bot1 allows Brassica A and C chromosomes to be distinguished In situ hybridization on metaphase plates from B. oleracea and B. napus using clone Bo6L1-15 as a probe showed specificity of Bot1 and its physical distribution along the chromosomes. The probe hybridized to multiple sites dispersed along the full length of 9

11 all 18 chromosomes in B. oleracea and 18 of the 38 chromosomes in B. napus (Figure 3), with gaps around most centromeres, some chromosome arms with less signal, and a few stronger sites seen as dots on both chromatids. Thus the elements were abundant and widely dispersed throughout the C genome. A few minor hybridization signals were detected on the 20 A-genome chromosomes, supporting the presence of Bot1-analogues in the genome of B. rapa, in accordance with the results obtained from the BLAST similarity search. Bot1 belongs to a Brassica family of CACTA elements We subjected the three BoB BAC sequences including CACTA homologies to dot plot analyses in order to identify exact or degenerate repeats (see methods) and CACTA motifs (Figure 4a). The analysis delimited a single full-length CACTA element for each BAC analysed; size and position of the CACTA within each BAC are thus provided in Figure 4b. TIRs of 15 and 17bp were identified in BoB028L01 (CACTACAAGAAAACA) and BoB029L16 (CACTACAAGAAAACAGC), while the third TIR, in BoB048N13, was 64bp long (CACTACAAGAAAACAGCGATATTCTGACGGACATTCCGACGGAAAATGAA ATCCTCGGAATATA). The first 15 nucleotides from each TIR were conserved across the three BAC sequences; sub-terminal repeats were also found (Figure 4a, 4b). In addition, CTA 3bp-target site duplication (TSD) which is characteristic for the CACTA superfamily (Wicker et al., 2007) was identified for each Bot1 insertion. Interestingly, the 5 and 3 flanking sequences of Bot1 were AT-rich with an average GC content of less than 30 % (Figure 4c), 41% GC content being considered average for the C genome (J. Moore, unpublished data). These three elements showed similar overall structures, distinguished by sequence insertions and rearrangements (Figure 5). 10

12 CDS with identities to putative retroelement pol polyproteins (28% identity with AAM15254 from Arabidopsis) were identified in Bot1-2 ad Bot1-3 (Figure 4b), with approximately 80bp overlapping the Bo6L1-15 sequence we used as a probe (Figure 5). The presence of stop-codons in the internal part of the CDS which is relatively small compared to its homologue in Arabidopsis, suggests that this CDS is a pseudogene. Considering the CACTA domain matching the Bo6L1-15 sequence (Figure 4b), it seems that the use of a degenerate primer originally designed to target the reverse transcriptase of LINEs (a gene that is included in the pol region of retrotransposons), led to non-specific amplifications of a short section of a gene coding for TE-related proteins, namely a transposase and a pol protein-like in the present case. Fortuitously, as part of this non-specific amplicon, this degenerate primer goes on to amplify one of the C genome-specific parts of Bot1 (Figure 5). Database BLAST comparisons identified full-length CACTA elements from both B. rapa and B. napus BAC sequences; locations of these elements within each BAC, as well as size and TIR sequences are reported in Table 2. The overall structure of these elements is similar to those characterized in B. oleracea; however, when we compared the three B. oleracea Bot1 representatives to the CACTA elements identified in the genomes of B. napus and B. rapa, we observed that all Bot1 copies contain B. oleracea-specific sequence fragments (orange domains in Figure 5); for instance, within the region corresponding to the Bo6L1-15 fragment, two thirds of the nucleotide sequence is specific to B. oleracea for two of the BACs (Figure 5). Using the complete 10.9kb of Bot1-2 against B. oleracea WGS and B. rapa BAC end sequences the number of BLAST alignments to each genome was investigated (Figure S2). This analysis again highlighted a C genome proliferation but also revealed 11

13 a 2.7kb region in which we found no B. rapa alignments. This region appears to be C genome specific. The transposase sequence of CACTA elements is not well defined; we looked for potential active transposases in the Brassica CACTA elements. The B. rapa BAC sequence AC contains a complete and intact transposase-encoding gene of 3,363bp (1,120aa) which belongs to the Tnp2-like family, while the homologous gene of B. oleracea is interrupted by insertions (orange domains) or deletions (Bot1-3) which appear C genome-specific (Figure 6). We found that the 103aa-long putative transposase-encoding ORF that was first identified in the Bo6L1-15 fragment (see above) corresponds to the C-terminal part of the transposase (Figure 6), and can be classified as a pseudogene. We conclude that the different ESTs mined from expressed sequence database as similar to the Bo6L1-15 ORF may originate from another complete version of the transposase gene present elsewhere in the B. oleracea genome. In addition, the coding sequence of each putative transposase of the three B. oleracea CACTA elements contains several in-frame stop codons. As we could not identify any other gene with a potential transposase function in Bot1, we believe that the Bot1 representatives we analysed do not possess any functional and still active transposase. Bot1 carries a host SLL3 gene copy Notably, one copy of the Brassica S locus-associated SLL3 gene, first described in B napus by Cui et al. (1999), was found in all the Bot1-related CACTA elements we characterized in B. oleracea and B. napus/b. rapa (Figure 4b and data not shown). Likewise, the three B. oleracea contig fragments (Town et al., 2006) we identified as possessing sequences highly similar to the Bot1 clone Bo6L1-15 by BLAST similarity search also carry a SLL3 gene downstream from the Bot1 matching sequence. The 12

14 general structure of the SLL3 copies was highly conserved in the various CACTA elements we analysed, including 5 exons and 4 introns as previously described by Cui et al. (1999), except for the first intron sequence: the corresponding genes identified in B. oleracea CACTA elements exhibit an alternative shorter intron 1 sequence compared to the published B napus gene, and SLL3 copies included in B. rapa Bot-1-like CACTA elements contain a short insertion in the first intron. The very low GC content of SLL3 intron sequences was intriguing. We found five different PlantGDB-assembled Unique Transcripts (PUT) highly similar to SLL3 (90 to 97% identity) which overlap together 80% of the gene, although no PUT supported the four intron five exon structure suggested by Cui et al. (1999). Bot1 and SLL3 have proliferated in the B. oleracea genome We estimated the copy number of Bot1 in the B. oleracea genome by examining the presence of this element in a portion of the BoB BAC library representing 2.8 genome coverage (Alix et al., 2005). A total of 2,110 BACs hybridized to the probe Bo6L1-15. Assuming the B. oleracea genome is fully represented in the BAC library and there is no clustering of copies of the element on single BACs, we predict 755 genomic insertion sites for Bot1, per haploid genome. Analysis of three different Bot1 sequences (Bo6L1-15, Bo1L1-04 and Bo8L1-11) against B. oleracea whole genome shotgun (WGS) sequences gave estimates of between 1,420 and 1,629 copies in the B. oleracea genome (Table 3); the three sequences hit the same set of B. oleracea WGS sequences, demonstrating that we isolated representatives of a single family of CACTA transposons. For the two clones Bo6L1-15 and Bo1L1-04, we performed BLAST comparisons using first the transposase-cds only and then the full 1kb-sequence: we obtained closely similar copy number estimates in both cases, demonstrating that the pol 13

15 polyprotein retroelement present in Bot1 (Figure 4b) is not found elsewhere in the genome and now constitutes a specific part of Bot1. The two-fold higher estimates of genome copy number from WGS analysis compared to BAC library hybridization suggests some clustering of Bot1. Comparison of results obtained at different E value stringencies reveal only small differences; this is indicative of a relatively low rate of sequence divergence for this CACTA element. We performed the same analysis using the complete Arabidopsis genomic sequence and B. rapa BAC sequences (BAC ends (BES) & whole BACs): no alignments to any sequence in the Arabidopsis genome were found and only approx. 30 in B. rapa (Table 3). To evaluate the dynamics of Bot1 in the Brassica genomes, we used 266 Bot1 ORF sequences mined from B. oleracea WGS (plus the ORF of Bo6L1-15) and 14 Bot1-like ORFs from B. rapa BAC sequences in Genbank to calculate a median network phylogeny (Figure 7) and a phylogenetic tree (Figure S3). For the median network phylogeny we found that tree topologies from the maximum parsimony (MP), maximum likelihood (ML) and neighbour-joining (NJ) analyses were identical in almost all aspects. The median network phylogeny distinguishes of a group of 12 B. rapa copies constituting a B. rapa-specific clade which is monophyletic. The other A genome copies are closer to some copies of the C genome. This same trend is observed in the phylogenetic tree (Figure S3). Such a topology suggests that only a few copies of the CACTA transposon were present in the common ancestor, while the star contractions in the median network phylogeny suggest two or three main expansions in the C genome. The phylogeny contains considerable reticulation (i.e. not a straightforward tree) indicating that there may well have been recombination through conversion, complicating the phylogenetic relationships. The reticulations are independent between the two genomes, indicating that such 14

16 recombination would be expected to have occurred since speciation. Thus Figure 7 and Figure S3 echo the trend observed in Figure 2, produced using a smaller data set, with one particular B. oleracea clade marked by unresolved polytomy with a typical rakelike branching pattern, indicating a low rate of sequence divergence. Analysis of the SLL3 gene sequence against B. oleracea WGS and B. rapa BAC and BAC-end sequences gave estimates of between 2,490 and 4,240 copies in the B. oleracea genome and only 395 to 910 copies in the B. rapa genome (Table 3), with no evidence for copies in the Arabidopsis genome. Parallel copy number estimates suggest that SLL3 has been more highly proliferated within the C genome. It is noteworthy that this high copy number of SLL3 in the C genome contrasts strongly with the retrieval of only five B. napus PUT from the EST database. DISCUSSION In this study, we isolated and characterized a new family of Brassica CACTA elements (En/Spm transposons), with representatives from B. oleracea, named Bot1. We demonstrated Brassica C genome proliferation and identified a 2.7kb region of C genome specificity. Full-length but defective elements averaging 10kb in length were identified by BAC library screening. BLASTN analysis against B. oleracea WGS showed that about 1,500 copies of Bot1 are present in the B. oleracea haploid genome, representing some 2.3% of the genome, or more than 10% of the transposable elements (Zhang and Wessler (2004) estimate that TEs constitute 20% of the B. oleracea genome). It is noteworthy that Bot1 represents the first B. oleracea-specific dispersed repeated sequence which has been isolated. 15

17 Bot1 played a role in the recent Brassica genome divergence and shows evidence for genomic homogenization events The evolutionary history of TEs is important to study because of the effect of these elements on the structure of the plant genome and its evolution. Our analysis of the Bot1 element in BACs and contigs showed its presence in homologous sites in triplicated regions of B. oleracea, suggesting that an element was present in the ancestral Brassiceae genome which then underwent triplication of its genome (Lysak et al., 2005). Our data also identified, at low copy number, a Bot1 family-related sequence in the B. rapa genome. Hence we suggest that evolutionarily recent homogenization, based on an existing element variant, has allowed replacement of other, older, elements, perhaps combined with some amplification and new dispersal, giving the characteristic dispersed and high copy number C-genome-specific element that we observe. Such a mechanism has been suggested for tandemly repeated satellite DNA sequences in Drosophila (Strachan et al., 1985) with increasing evidence coming from sequence and cytogenetic analysis (Kuhn et al., 2008). Another notable feature of Bot1 is the low sequence divergence, a result in accordance with Zhang and Wessler (2004) who performed phylogenetic analyses on CACTA-like elements in Arabidopsis and B. oleracea, and demonstrated a high intrafamily sequence identity for the B. oleracea elements. The combination of PCR, bioinformatics, DNA and chromosomal hybridizations used here all show low divergence within the family, and high divergence from other families in the A and B genome species, demonstrating that the result is not a consequence of selective sampling. Our phylogenetic tree with 280 Bot1 sequences indicates expansion through two or three rounds of amplification (Figure 7). High sequence identity is normally 16

18 taken to indicate that an element has amplified recently; our result suggests that Bot1 has amplified through homogenization and replacement of other elements in the C genome (from a low and undetectable ancestral Bot1 copy which is present in the common Brassica progenitor), after divergence from the A genome approximately 3.75 million years ago (Inaba and Nishio, 2002). Bot1 is a non-autonomous but apparently still active CACTA transposon Bot1 and related Brassica elements display all characteristics of CACTA transposons, including (i) the presence of TIRs of bp in size containing the consensus sequence CACTACAAGAAA (Kawasaki and Nitasaka, 2004) and sub-terminal regions consisting of both direct and inverted repeats, (ii) a 3bp-TSD, (iii) ORFs showing sequence identities to transposases of previously characterized plant En/Spm transposons, and (iv) preference for insertion in AT-rich regions (Le et al., 2000; Nacken et al., 1991; Wang et al., 2003). One element analysed, Bot1-3, harbours unexpectedly long TIRs of 64bp; this could reflect analogies with MULEs (Mutator-like elements) as transposons with long TIRs (e.g. Mu in maize). The complete Bot1 representatives we identified in B. oleracea were defective and thus non-autonomous, although an apparently complete Bot1-like transposase gene was found in B. rapa, and enzymes from such elements could trans-activate the movement of defective elements. BLAST searches for Bot1 in B. oleracea and B. napus EST database showed that some Bot1 copies are transcribed into polyadenylated RNA, demonstrating the existence of Bot1 transcripts. It is noteworthy that the B. oleracea Bot1 homologue EST was isolated during the study of the effect of pre-harvest drought stress on gene expression in postharvest broccoli (Paniwnyk et al., unpublished work) and that B. napus ESTs similar to 17

19 Bot1 were also isolated during B. napus seed development under abiotic stress conditions (Georges et al., unpublished work). Stress, including that from interspecific hybridization, is now accepted to lead to transposable element activity (Grandbastien, 1998) but the impact on turnover of transposon sequences is still not clear. C-genome specificity of Bot1 The results shown here demonstrate the value of Bot1 as a genetic marker for the Brassica C genome. Up to now, A or C genome-specific markers were mostly derived from diverged sequences and consisted of various nucleotide substitutions (e.g. SINE S1 Lenoir et al., 1997; various RFLP markers Gaeta et al., 2007). In an analysis of the Brassicas in the U triangle, PCR with the single primer BEL1MF gives a product only from species including the C genome, and hence could be used to identify these species, including any C genome introgression, in DNA extracts from plant bulks. In situ hybridization demonstrated that the Bot1 sequence was abundant throughout the C genome and present on all chromosomes, and that hybridization sites were restricted to the C chromosomes. Thus, the sequence can distinguish A and C chromosomes efficiently in the allotetraploid species B. napus. There are no previous reports of such dispersed C genome-specific repeats. Gene sequence analysis shows that the A and C genome species B. rapa and B. oleracea are more related to each other than to the B genome B. nigra (Lysak et al., 2005). As a consequence, classical genomic in situ hybridization (GISH) allows the B genome chromosomes to be distinguished from the A or C genome chromosomes in natural allotetraploids, while it fails to differentiate efficiently the A and C genomes in B. napus because of extensive cross-hybridization between the two genomes (Snowdon et al., 1997) and stronger labelling of the centromeric regions and their genome-specific satellite repeats. The Bot1 sequence 18

20 distribution along the chromosomes, with exclusion from major satellite repeats around the centromere, and some variation in hybridization strength along the arms, was similar to that found for an En/Spm element in Beta vulgaris (Jacobs et al., 2006). The CACTA transposon Bot1 appears to be of great value for studies on the evolution of the Brassica genome, for physical mapping or for monitoring introgression in oilseed rape thanks to the detection of intergenomic recombination. The B. oleracea BAC BoB014O06, that was shown to contain Bot1 according to our results from BAC filter hybridization using Bo6L1-15 as a probe, has already been used successfully to analyse recombination in AAC triploid hybrids (Leflon et al., 2006) and to differentiate allosyndesis from autosyndesis in B. napus haploids (Nicolas et al., 2007); this demonstrates the high efficiency of Bot1 in distinguishing A and C Brassica chromosomes. In particular, in a context of reducing gene flow from genetically modified oilseed rape to its wild related counterpart represented mostly by B. rapa, Bot1 will be very helpful in monitoring transgene introgression specifically into C-genome chromosomes. Bot1 was involved in the proliferation of the host SLL3 gene Bot1 and other Brassica Bot1-analogues contain the SLL3 gene from the Brassica S locus, inside the CACTA element. We note that an 8kb Bot1-analogue present in B. rapa was previously identified when characterizing the genomic organization of the S locus (Suzuki et al., 1999). Sporophytic self-incompatibility (SI) is controlled by a single Mendelian genetic locus, the S locus (Bateman, 1955). Genomic characterization of this complex locus has demonstrated the occurrence of more than ten genes including three major highly polymorphic genes responsible for SI: the two genes SLG and SRK encode the female determinant of SI and SP11/SCR determines the S haplotype specificity of pollen (Shiba et al., 2001). Cui et al. (1999) identified the S locus-linked 19

21 gene 3, SLL3; this gene encodes a putative secreted small peptide but its functional role is still unknown, as no functional evidence could be obtained due to its multiple-copy nature and the difficulty in studying its expression pattern (Cui et al., 1999). Our study has confirmed the multiple-copy nature of SLL3, and strongly suggests that the copy number of SLL3 is directly linked to the level of amplification of Bot1: indeed, we estimated SLL3 copies in the B. rapa genome in which Bot1-like sequences were slightly amplified while more than 3,000 SLL3 copies were estimated in the B. oleracea genome where Bot1 has proliferated. Such data suggest that the proliferation of SLL3 across the B. oleracea genome is related to the proliferation of Bot1. The intron/exon structure of all the SLL3 copies we analysed demonstrated that SLL3 was captured from the eukaryotic host genome, eliminating the hypothesis that SLL3 could be a gene necessary for transposition of the CACTA element which potentially originated from prokaryotic genome. Further study of the SLL3 gene may enable an estimate to be made on the date of incorporation into the CACTA element. The hypothesis that most SLL3 copies are pseudogenes due to mutation accumulation, could be tested along with the fact that the high SLL3 gene copy number seems infrequently transcribed in the Brassica genome. Conclusion We report here the first example of a transposon mediating gene movement and proliferation across the Brassica genome. Bot1 thus increases the number of transposons which have the potential to capture host genes, such as the CACTA elements identified in soybean (Zabala and Vodkin, 2005 and 2007), the Pack-MULEs characterized in maize (Talbert and Chandler, 1988), Arabidopsis (Yu et al., 2000) and rice (Jiang et al., 2004; Turcotte et al., 2001), and the more recently discovered 20

22 helitrons in maize (for review Kapitonov and Jurka, 2007 and references therein). Moreover, we demonstrated that Bot1 played a major role in the recent A and C Brassica genome divergence, supporting transposon amplification and homogenization as one of the major mechanisms of plant genome expansion and evolution (Bennetzen, 2005). The present study reinforces the view that the so-called junk DNA is a major driver of genome and gene evolution and diversification, demonstrating the need and importance of analysing repetitive sequences and in particularly TEs, to fully depict the evolution of the plant genome. EXPERIMENTAL PROCEDURES PCR amplification and cloning Table 1 shows the identification and origin of the Brassica accessions used in the present study. Genomic DNAs were extracted from fresh leaves of three-week old plants following a standard CTAB protocol. For PCR amplifications, degenerate oligonuclotide primers were used from conserved domains flanking parts of LINE reverse transcriptase genes: BEL1MF = 5 RVN-RAN-TTY-CGN-CCN-ATH-AG3 (45% degeneracy, Tm=55 C) and BEL2MR = 5 GAC-ARR-GGR-TCC-CCC-TGN- CK3 (25% degeneracy, Tm=67 C) (Kubis et al., 2003). PCR reactions were carried out according to Kubis et al. (1998) with an annealing temperature of 48 C for 1 min. PCR products of approximately 1kb in length were cloned (pgem -T, Promega) and transformed in Escherichia coli strain XL1-Blue. Clone names were established as follows: Bo for B. oleracea, Bn for B. napus, Bc for B. carinata, then the plant accession code number as given in Table 1 followed by L1 with L for LINE primer 21

23 and 1 to indicate the 1kb band, a hyphen and a serial number to identify individual bacterial clones. Southern blot hybridization Five micrograms of total genomic DNA were restricted with the endonuclease EcoRI (Gibco BRL), separated in 1.2 % agarose gels and transferred onto positively charged nylon membranes (Roche) following standard procedures. The Bo6L1-15 probe was labelled with [α- 32 P]dCTP by random priming using the Amersham Pharmacia Biotech Oligolabelling kit and purified on Sephadex columns. Southern blot hybridization was performed at high stringency as described previously (Alix et al., 1998). Autoradiograph exposure of the Southern blot was 2 days. Chromosomal in situ hybridization Chromosome spreads were prepared from root tips of B. napus cv. Yudal and Drakkar. Methods for chromosome spreads and in situ hybridization essentially followed Alix et al. (2005) and Schwarzacher and Heslop-Harrison (2000). Bo6L1-15 was labelled with biotin-11-dutp or digoxigenin-16-dutp for use as a probe, and the most stringent wash was carried out in 20% formamide, 0.2 SSC at 42 C, allowing labelled probe sequences with more than 85% homology to the chromosomes to remain hybridized. Images were captured on a Zeiss fluorescence microscope and processed with Adobe Photoshop using only functions which affect the whole image equally, except filling in some out-of-frame dark areas. 22

24 Sequence and phylogenetic analyses Sixteen Bot1 clones from seven accessions of the three Brassica species including the C genome, namely B. oleracea (C), B. napus (AC) and B. carinata (BC), were sequenced. Bot1 sequences were compared with entries in the GenBank-EMBL database using WU-BLAST2 software (Gish, 2006), and ORFs were identified using ORF Finder from NCBI ( Multiple sequence alignment was made using the ClustalW programme ( Phylogenetic analyses were performed on the set of 16 ORFs of 312 bp isolated in the present study and 13 additional Bot1 ORF analogues: 6 sequences from B. rapa (EMBL accessions nos. AC189341, AC189314, AC189655, AC AC and AC189496), 1 sequence from B. napus (AJ245479) and 6 sequences from B. oleracea (AC183492, AC and AC183495) including 3 BAC sequences from the BoB library (EU EU642506). A nexus file was created from the multiple sequence alignment with Mesquite v (Maddison and Maddison, 2005). We used MODELTEST v (Posada and Crandall, 1998) to select the most likely model of evolution according to the Akaike information criterion (AIC); the selected model of DNA substitution was the GTR model (Rodríguez et al., 1990), with no invariable site and Rmat = { }. Using PAUP v. 4.0b10 (Swofford, 2002), three different phylogenetic methods were applied and compared within each other to evaluate the molecular phylogeny of the 29 Bot1 ORF-like sequences: the maximum parsimony (MP) method, the neighbour-joining (NJ) method and the maximum likelihood (ML) method, taking into account the optimized parameters obtained from MODELTEST when appropriate. For NJ and ML analyses, bootstrapping of 1000 cycles was conducted. All the phylogenetic trees were obtained 23

25 with the 50% majority-rule consensus tree method and were drawn using TreeView v All trees were treated as unrooted. BLASTN was used to align Bo6L1-15 coding sequence with B. oleracea WGS and B. rapa sequences (whole BAC and BES). Only alignments spanning the whole segment from base 80 to base 250 were included, duplicates were removed. The resulting aligned segments (266 from B. oleracea and 14 from B. rapa) were aligned to each other using MUSCLE 3.6 (Edgar, 2004). From this alignment a 'median network' phylogeny was calculated (Figure 7) using the 'Network' program (Bandelt et al., 1999) and an artificially rooted phylogenetic tree was built using PhyML to compute maximum likelihood from a neighbour-joined seed tree (Figure S3). In silico analyses We identified and analysed the genomic structure of full-length Bot1 elements on the three B. oleracea BAC sequences BoB028L16, BoB048N13 and BoB029L16 (accession nos. EU EU642506; BoB library from Warwick-HRI Ryder, Barker, King, unpublished). We searched these BAC sequences for typical CACTA motifs consisting of (i) terminal inverted repeats (TIRs) that terminate in the conserved CACTA motif and (ii) subterminal repeats (TRs) of 10 to 20bp repeated in direct and inverted orientation. We thus subjected each BAC sequence to dot plot analyses using the program Dotter (Sonnhammer and Durbin, 1995) and we looked for exact or degenerated repeats using the REPuter package (Kurtz et al., 2001). We applied the same strategy to B. rapa and B. napus BAC sequences to identify and characterize fulllength Bot1 analogues in these two Brassica species. The sequences of the CACTA elements were aligned (Figure 5) using the Mauve progressive alignment algorithm (Darling et al., 2004). The software provides user with a display layout option (termed 24

26 colour multiplicity) that highlight homologous regions appearing across all the sequences (denoted as backbone and coloured in mauve), as well as conserved sequences appearing only in a subset of the aligned sequences. Matches are coloured differently based on which sequence they match in. Estimation of copy numbers The BoB BAC library developed by Warwick-HRI and exploited in a previous study to characterize the genomic organization of Brassica retrotransposons (Alix et al., 2005) was used to evaluate the copy number and genomic distribution of Bot1 in the B. oleracea genome. For BAC library screening, the protocol described by Alix et al. (2005) was followed by probing the clone Bo6L1-15 on colony filters representing 75% of the full BoB library (19,584 clones). Film exposure time was 1 day. When scoring the BAC library hits on autoradiographs, all signals stronger than background were scored. As previously described (Alix et al., 2005), we analysed the full length sequence of Bot1 and the SLL3 gene against the B. oleracea whole genome shotgun (WGS) sequences (0.5-1 genome coverage) available from The Institute for Genomic Research (TIGR - preliminary sequence data obtained from the complete Arabidopsis genomic sequence, and against a genomic sample of B. rapa genome sequences. B. rapa BAC-end sequences (BES), BAC phase II sequences and complete BAC sequences were extracted from Genbank on Nov. 1st ,535 BAC-end sequences were extracted, totalling 154.6Mbp, representing approximately 29% coverage of the B. rapa genome, and 527 BAC sequences were extracted, totalling 62.2Mbp, representing approximately 12% coverage of the B. rapa genome (Johnston et al., 2005). A relatively stringent E value of 1e-10 and a less stringent value of 1e-02 25

27 were used in BLASTN searches using WU-BLAST2 software (Gish, 2006). The formula presented in Zhang and Wessler (2004) was used to generate genome copy number estimates from BLASTN results using the number of hits and length of Bot1 or SLL3 sequence. ACKNOWLEDGEMENTS We particularly thank Catherine Damerval for valuable discussion on the phylogeny of Bot1. Part of Dr K. Alix s work was supported by a fellowship under the OECD Cooperative Research Programme: Biological Resource Management for Sustainable Agriculture Systems. Preliminary sequence data from B. oleracea were obtained from The Institute for Genomic Research website at Sequencing of B. oleracea was funded by the National Science Foundation. REFERENCES AGI, Arabidopsis Genome Initiative. (2000) Analysis of the genome sequence of the flowering plant Arabidopsis thaliana. ature, 408, Alix, K., Baurens, F.-C., Paulet, F., Glaszmann, J.-C. and D Hont, A. (1998) Isolation and characterization of a satellite DNA family in the Saccharum complex. Genome, 41, Alix, K. and Heslop-Harrison, J.S. (2004) The diversity of retroelements in diploid and allotetraploid Brassica species. Plant Mol. Biol. 54, Alix, K., Ryder, C.D., Moore, J., King, G.J. and Heslop-Harrison, J.S. (2005) The genomic organization of retrotransposons in Brassica oleracea. Plant Mol. Biol. 59,

28 Bandelt, H.-J., Forster, P. and Rohl, A. (1999) Median-Joining Networks for Inferring Intraspecific Phylogenies. Mol. Biol. Evol. 16, Bateman, A.J. (1955) Self-incompatibility systems in angiosperms. III. Cruciferae. Heredity, 9, Bennetzen, J.L. (2005) Transposable elements, gene creation and genome rearrangement in flowering plants. Curr. Opin. Genet. Dev. 15, Brunner, S., Pea, G. and Rafalski, A. (2005) Origins, genetic organization and transcription of a family of non-autonomous helitron elements in maize. Plant J. 43, Casacuberta, J.M. and Santiago, N. (2003) Plant LTR-retrotransposons and MITEs: control of transposition and impact on the evolution of plant genes and genomes. Gene, 311, Cui, Y., Brugière, N., Jackman, L., Bi, Y.-M. and Rothstein, S.J. (1999) Structural and transcriptional comparative analysis of the S locus regions in two selfincompatible Brassica napus lines. Plant Cell, 11, Darling, A.C.E., Mau, B., Blattner, F.R. and Perna, N.T. (2004) Mauve: multiple alignment of conserved genomic sequence with rearrangements. Genome Res. 14, DeMarco, R., Venancio, T.M. and Verjovski-Almeida, S. (2006) SmTRC1, a novel Schistosoma mansoni DNA transposon, discloses new families of animal and fungi transposons belonging to the CACTA superfamily. BMC Evol. Biol. 6, 89. Deragon, J.-M., Landry, B.S., Pélissier, T., Tutois, S., Tourmente, S. and Picard, G. (1994) An analysis of retroposition in plants based on a family of SINEs from Brassica napus. J. Mol. Evol. 39,

29 Edgar, R.C. (2004) MUSCLE: multiple sequence alignment with high accuracy and high throughput. ucleic Acids Res. 32, Eichler, E.E. and Sankoff, D. (2003) Structural dynamics of eukaryotic chromosome evolution. Science, 301, Fedoroff, N. (2000) Transposons and genome evolution in plants. Proc. atl. Acad. Sci. USA, 97, Feschotte, C., Jiang, N. and Wessler, S.R. (2002) Plant transposable elements: where genetics meets genomics. at. Rev. Genet. 3, Gaeta, R.T., Pires, J.C., Iniguez-Luy, F., Leon, E. and Osborn, T.C. (2007) Genomic changes in resynthesized Brassica napus and their effect on gene expression and phenotype. Plant Cell, 19, Gish, W.R. (2006) WU-BLAST archives: Grandbastien, M.-A. (1998) Activation of plant transposons under stress conditions. Trends Plant Sci. 3, Hawkins, J.S., Kim, H., Nason, J.D., Wing, R.A. and Wendel, J.F. (2006) Differential lineage-specific amplification of transposable elements is responsible for genome size variation in Gossypium. Genome Res. 16, He, Z.H., Dong, H.T., Dong, J.X., Li, D.B. and Ronald, P.C. (2000) The rice Rim2 transcript accumulates in respone to Magnaporthe grisea and its predicted protein product shares similarity with TNP2-like proteins encoded by CACTA transposons. Mol. Gen. Genet. 264, Heslop-Harrison, J.S. (2000) Comparative genome organization in plants: from sequence and markers to chromatin and chromosomes. Plant Cell, 12, IHGSC (2001) Initial sequencing and analysis of the human genome. ature, 409,

30 921. Inaba, R. and Nishio, T. (2002) Phylogenetic analysis of Brassicaceae based on the nucleotide sequences of the S-locus related gene, SLR1. Theor. Appl. Genet. 105, Inagaki, Y., Hisatomi, Y., Suzuki, T., Kasahara, K. and Iida, S. (1994) Isolation of a Suppressor-mutator/Enhancer-like transposable element, Tpn1, from Japanese morning glories. Genes Genet. Syst. 74, Itoh, Y., Hasebe, M., Davies, E., Tadeka, J. and Ozeki, Y. (2003) Survical of Tdc transposable elements of the En/Spm superfamily in the carrot genome. Mol. Genet. Genomics, 269, Jacobs, G., Dechyeva, D., Menzel, G., Dombrowski, C. and Schmidt, T. (2006) Molecular characterization of Vulmar1, a complete mariner transposon of sugar beet and diversity of mariner- and En/Spm-like sequences in the genus Beta. Genome, 47, Jiang, N., Bao, Z., Zhang, X., Eddy, S.R. and Wessler, S.R. (2004) Pack-MULE transposable elements mediate gene evolution in plants. ature, 431, Johnston, J.S., Pepper, A.E., Hall, A.E., Chen, Z.J., Hodnett, G., Drabek, J., Lopez, R. and Price, H.J. (2005) Evolution of genome size in Brassicaceae. Ann. Bot. 95, Kapitonov, V.V. and Jurka, J. (2001) Rolling-circle transposons in eukaryotes. Proc. atl. Acad. Sci. USA, 98, Kapitonov, V.V. and Jurka, J. (2007) Helitrons on a roll: eukaryotic rolling-circle transposons. Trends Genet. 23, Kawasaki, S. and Nitasaka, E. (2004) Characterization of Tpn1 family in the Japanese 29

31 morning glory: En/Spm-related transposable elements capturing host genes. Plant Cell Physiol. 45, Kazazian, H.H. (2004) Mobile elements: drivers of genome evolution. Science, 303, Kubis, S.E., Castilho, A.M.M.F., Vershinin, A.V. and Heslop-Harrison, J.S. (2003) Retroelements, transposons and methylation status in the genome of oil palm (Elaeis guineensis) and the relationship to somaclonal variation. Plant Mol. Biol. 52, Kuhn, G.C.S., Sene, F.M., Moreira-Filho, O., Schwarzacher, T. and Heslop-Harrison, J.S. (2008) Sequence analysis, chromosomal distribution and long-range organization show that rapid turnover of new and old pbum satellite DNA repeats leads to different patterns of variation in seven species of the Drosophila buzzatii cluster. Chromosome Res. 16, Kurtz, S., Choudhuri, J.V., Ohlebusch, E., Schleiermacher, C., Stoye, J. and Giegerich, R. (2001) REPuter: The manifold applications of repeat analysis on a genomic scale. ucleic Acids Res. 29, Le, Q.H., Wright, S., Yu, Z. and Bureau, T. (2000) Transposon diversity in Arabidopsis thaliana. Proc. atl. Acad. Sci. USA, 97, Leflon, M., Eber, F., Letanneur, J.-C., Chelysheva, L., Coriton, O., Huteau, V. Ryder, C.D., Barker, G., Jenczewski, E. and Chèvre, A.-M. (2006) Pairing and recombination at meiosis of Brassica rapa (AA) Brassica napus (AACC) hybrids. Theor. Appl. Genet. 113,

32 Lenoir, A., Cournoyer, B., Warwick, S., Picard, G. and Deragon, J.-M. (1997) Evolution of SINE S1 retroposons in Cruciferae plant species. Mol. Biol. Evol. 14, Lysak, M.A., Koch, M.A., Pecinka, A. and Schubert, I. (2005) Chromosome triplication found across the tribe Brassiceae. Genome Res. 15, Maddison, W.P. and Maddison, D.R. (2005) Mesquite: A modular system for evolutionary analysis. Version Meyers, B.C., Tingey, S.V. and Morgante, M. (2001) Abundance, distribution, and transcriptional activity of repetitive elements in the maize genome. Genome Res. 11, Miura, A., Yonebayashi, S., Watanabe, K., Toyama, T., Shimada, H. and Kakutani, T. (2001) Mobilization of transposons by a mutation abolishing full DNA methylation in Arabidopsis. ature, 411, Morgante, M. (2006) Plant genome organisation and diversity: the year of the junk! Curr. Opin. Biotechnol. 17, Morgante, M., Brunner, S., Pea, G., gler, K., zuccolo, A. and Rafalski, A. (2005) Gene duplication and exon shuffling by helitron-like transposons generate intraspecies diversity in maize. at. Genet. 37, Nacken, W.K., Piotrowiak, R., Saedler, H. and Sommer, H. (1991) The transposable element Tam1 from Antirrhinum majus shows structural homology to the maize transposon En/Spm and has no sequence specificity of insertion. Mol. Gen. Genet. 228, Nicolas, S., Le Mignon, G., Eber, F., Coriton, O., Monod, H., Clouet, V., Huteau, V. Lostanlen, A., Delourme, R., Chalhoub, B., Ryder, C.D., Chèvre, A.-M. and 31

33 Jenczewski, E. (2007) Homeologous recombination plays a major role in chromosome rearrangements that occur during meiosis of Brassica napus haploids. Genetics, 175, O Neill, C.M. and Bancroft, I. (2000) Comparative physical mapping of segments of the genome of Brassica oleracea var. alboglabra that are homoeologous to sequenced regions of chromosomes 4 and 5 of Arabidospis thaliana. Plant J. 23, Ozeki, Y., Davies, E. and Takeda, J. (1997) Somatic variation during long-term subculturing of plant cells caused by insertion of a transposable element in a phenylalanine ammonia-lyase (PAL) gene. Mol. Gen. Genet. 254, Peterson, P.A. (1953) A mutable pale green locus in maize. Genetics, 45, Pereira, A., Cuypers, H., Gierl, A., Sommers, Z.S. and Saedler, H. (1986) Molecular analysis of the En/Spm transposable element system of Zea mays. EMBO J. 5, Posada, D. and Crandall, K.A. (1998) MODELTEST: testing the model of DNA substitution. Bioinformatics, 14, Rocarro, M., Li, Y., Masiero, S., Saedler, H. and Sommer, H. (2005) ROSINA (RSI), a novel protein with DNA-binding capacity, acts during floral organ development in Antirrhinum majus. Plant J. 43, Rodríguez, F.J., Oliver, J.L., Marín, A. and Medina, J.R. (1990) The general stochastic model of nucleotide substitution. J. Theor. Biol. 142, Schwarzacher, T. and Heslop-Harrison, J.S.(P.). (2000) Practical in situ hybridization. BIOS Scientific Publishers Ltd, Oxford, UK. Shiba, H., Takayama, S., Iwano, M., Shimosato, H., Funato, M., Nakagawa, T., Che, F.- S., Suzuki, G., Watanabe, M., Hinata, K. and Isogai, A. (2001) A pollen coat 32

34 protein, SP11/SCR, determines the pollen S-specificity in the self-incompatibility of Brassica species. Plant Physiol. 125, Snowden, K.C. and Napoli, C.A. (1998) Ps1: a novel Spm-like transposable element from Petunia hybrida. Plant J. 14, Snowdon, R.J., Köhler, W., Friedt, W. and Köhler, A. (1997) Genomic in situ hybridization in Brassica amphiploids and interspecific hybrids. Theor. Appl. Genet. 95, Sonnhammer, E.L.L. and Durbin, R. (1995) A dot-matrix program with dynamic threshold control suited for genomic DNA and protein sequence analysis. Gene, 167, GC1-GC10. Strachan, T., Webb, D. and Dover, G. (1985) Transition stages of molecular drive in multiple-copy DNA families in Drosophila. EMBO J. 4, Suzuki, G., Kai, N., Hirose, T., Fukui, K., Nishio, T., Takayama, S., Isogai, A., Watanabe, M. and Hinata, K. (1999) Genomic organization of the S locus: identification and charcterization of genes in SLG/SRK region of S 9 haplotype of Brassica campestris (syn. rapa). Genetics, 153, Swofford, D.L. (2002) PAUP* Phylogenetic Analysis Using Parsimony (*and Other Methods); Version 4. Sinauer associates, Sunderland, MA. Talbert, L.E. and Chandler, V.L. (1988) Characterization of a highly conserved sequence related to mutator transposable elements in maize. Mol. Biol. Evol. 5, Town, C.D., Cheung, F., Maiti, R., Crabtree, J., Haas, B.J., Wortman, J.R., Hine, E.E., Althoff, R., Arbogast, T.S., Tallon, L.J., Vigouroux, M., Trick, M. and Bancroft, I. (2006) Comparative genomics of Brassica oleracea and Arabidopsis thaliana 33

35 reveal gene loss, fragmentation, and dispersal after polyploidy. Plant Cell, 18, Turcotte, K., Srinivasan, S. and Bureau, T.E. (2001) Survey of transposable elements from rice genomic sequences. Plant J. 25, U, N. (1935) Genome analysis in Brassica with special reference to the experimental formation of B. napus and peculiar mode of fertilization. Jpn. J. Bot. 7, Vicient, C.M., Jääskeläinen, M.J., Kalendar, R. and Schulman, A.H. (2001) Active retrotransposons are a common feature of grass genomes. Plant Physiol. 125, Walbot, V. and Petrov, D.A. (2001) Gene galaxies in the maize genome. Proc. atl. Acad. Sci. USA, 98, Wang, G.-D., Tian, P.-F., Cheng, Z.-K., Wu, G., Jiang, J.-M., Li, D.-B., Li, Q. and He, Z.-H. (2003) Genomic characterization of Rim2 / Hipa elements reveals a CACTA-like transposon superfamily with unique features in the rice genome. Mol. Gen. Genomics, 270, Wendel, J.F. (2000) Genome evolution in polyploids. Plant Mol. Biol. 42, Wicker, T., Guyot, R., Yahiaoui, N. and Keller, B. (2003) CACTA transposons in Triticeae. A diverse family of high-copy repetitive elements. Plant Physiol. 132, Wicker, T., Sabot, F., Hua-Van, A., Bennetzen, J.L., Capy, P., Chalhoub, B., Flavell, A., Leroy, P., Morgante, M., Panaud, O., Paux, E., SanMiguel, P. and Schulman, A.H. (2007) A unified classification system for eukaryotic transposable elements. at. Rev. Genet. 8,

36 Yang, T.-J., Kwon, S.-J., Choi, B.-S., Kim, J.S., Jin, M., Lim, K.-B., Park, J.Y., Kim, J.- A., Lim, M.-H., Kim, H.-I., Lee, H.-J., Lim, Y.P., Paterson, A.H. and Park, B.-S. (2007) Characterization of terminal-repeat retrotransposon in miniature (TRIM) in Brassica relatives. Theor. Appl. Genet. 114, Yang, Y.W., Lai, K.N., Tai, P.Y. and Li, W.H. (1999) Rates of nucleotide substitution in angiosperm mitochondrial DNA sequences and dates of divergence between Brassica and other angiosperm lineages. J. Mol. Evol. 48, Yu, Z., Wright, S.I. and Bureau, T.E. (2000) Mutator-like elements in Arabidopsis thaliana: Structure, diversity and evolution. Genetics, 156, Zabala, G. and Vodkin, L.O. (2005) The wp mutation of Glycine max carries a genefragment-rich transposon of the CACTA superfamily. Plant Cell, 17, Zabala, G. and Vodkin, L. (2007) Novel exon combinations generated by alternative splicing of gene fragments mobilized by a CACTA transposon in Glycine max. BMC Plant Biol. 7, 38. Zhang, X. and Wessler, S.R. (2004) Genome-wide comparative analysis of the transposable elements in the related species Arabidopsis thaliana and Brassica oleracea. Proc. atl. Acad. Sci. USA, 101, Zhang, X. and Wessler, S.R. (2005) BoS: a large and diverse family of short interspersed elements (SINEs) in Brassica oleracea. J. Mol. Evol. 60, SUPPLEMENTARY MATERIAL The following supplementary material is available for this article on line: Figure S1. ClustalW multiple sequence alignment of the 16 Bot1 sequences isolated in the present study (EMBL accessions: AM AM888369). The Bot1 ORF is 35

37 highlighted in green; the deletions of respectively 29 and 69bp mentioned in the text are indicated in yellow. The degenerate PCR primers used for amplification are shown in grey. Figure S2. Bot1-2 used as a query sequence aligned by BLASTN with E-value threshold 0.01 to B. oleracea WGS and B. rapa BES. The frequency of subject sequence segment alignments overlapping each 100bp segment of the query sequence is represented. Figure S3. A phylogeny of A and C genome copies of the Bot1 (or Bot1-like) transposase constructed using PhyML. B. oleracea copies are in blue and B. rapa in red. The B. rapa copies are almost monophyletic. 36

38 Table 1. Accessions of the different diploid and allotetraploid Brassica species surveyed in the present study accession species 2n subspecies variety common name cultivar/ code (genomes) accession 1* B. oleracea 18 oleracea ramosa thousand head kale FO a 3* (CC) acephala acephala kale FO a 4 capitata capitata cabbage PO sabauda Savoy cabbage PO a 6* botrytis botrytis cauliflower FLE a 8* gemmifera Brussels sprout BR a 9 gongyloides kohl rabi CRA 21-0 a 26 alboglabra Chinese kale A12DHd 11 B. rapa 20 rapifera field mustard Chicon b 12 (AA) oleifera R 500 b 13 B. nigra 16 black mustard Junius b (BB) 14* B. napus 38 oleifera oilseed rape - Winter Darmor b 18 (AACC) oleifera oilseed rape - Spring Westar b 20 oleifera oilseed rape - Spring Drakkar b 21* oleifera oilseed rape - Spring Yudal b 27 oleifera oilseed rape -? - 23 B. juncea 36 brown mustard Picra b 24 (AABB) brown mustard Varuna b 25* B. carinata (BBCC) 34 Abyssinian mustard Awassa 67 b * Accessions from which 1kb-fragments of Bot1 were isolated. Seeds were kindly provided by a Pr G. Thomas and b Dr A.-M. Chèvre, UMR APBV, Rennes, France. 37

39 Table 2. Main characteristics of the Bot1-like CACTA elements identified in B. rapa and B. napus BAC clones mined from the database BAC ID Position within BAC size TIR sequence start stop B. rapa gi gb AC CACTACAAGAAAACA gi gb AC CACTACAAGAAAACA gi gb AC CACTACAAGAAAACA gi gb AC CACTACAAGAAAACA gi gb AC CACTACAAGAAAACA gi gb AC CACTACAAGAAAACA B. napus gi emb AJ CACTACAAGAAAACAGC 38

40 Table 3. Summary of results obtained by BLASTN comparison at two different E values of Bot1 and the SLL3 gene to 1) the 0.5 coverage set of B. oleracea whole genome shotgun sequences from TIGR and to 2) the set of B. rapa genome BAC-end, BAC phase II and complete BAC sequences from Genbank. For the analysis against B. rapa sequences, two estimates are given, in each case the first estimate being derived from alignments to BACends, and the second to whole BAC sequences. The formula for estimating genome copy number is likely to be more reliable for the BACend estimates, since the BAC-ends are pseudo-randomly distributed throughout the genome whereas the whole BACs had been deliberately chosen to form a tiling path. Query sequence BLASTn hits Estimate of genome copy BLASTn hits Estimate of genome copy at 1.e-02 number at 1.e-02* at 1.e-10 number at 1.e-10* 1) against B. oleracea WGS Bo6L1-15: full 1010bp 1,366 1,605 1,209 1,420 ORF 312bp 757 1, ,457 Bo1L1-04: full 991bp 1,371 1,629 1,213 1,441 ORF 312bp 758 1, ,470 Bo8L1-11: full 994bp 1,367 1,621 1,215 1,441 SLL3 : genomic 2067bp 5,298 3,802 3,463 2,485 coding 1488bp 4,646 4,237 3,434 3,132 39

41 2) against B. rapa BES and BAC sequences Bo6L1-15: full 1010bp ORF 312bp Bo1L1-04: full 991bp ORF 312bp Bo8L1-11: full 994bp SLL3 : genomic 2067bp coding 1488bp * Calculated taking into account length of sequences being compared, probability that 1 hit = 1 element and relative genome coverage (see Zhang and Wessler 2004). 40

42 a b Figure 1. Isolation of a Brassica C genome-specific sequence. (a) PCR amplification of a 1kb-band from genomic DNA using the single primer BEL1MF shown by gel electrophoresis. The 1kb- band is specifically amplified in Brassica species that possess the C genome. (b) EcoRI digests of genomic DNAs of the three diploid and three allotetraploid Brassica species of U s triangle after Southern hybridization with the Bot1 clone Bo6L1-15. Only the C genome species show hybridization signals demonstrating the C genome-specificity of the probe. Variations of hybridization signals among the different B. napus accessions are mainly due to variations of DNA loading (seen after gel staining with ethidium bromide; data not shown). Genomes are designated; see Table 1 for accession identifications. Molecular weight marker (M): 1kb ladder. 41

43 A_BrAC A_BrAC AC_BnAJ A genome A_BrAC A_BrAC C_BoB28L A_BrAC C_BoAC C_BoAC AC_Bn21L AC_Bn14L1-25 C_BoB29L16 C_Bo6L1-15 AC_Bn14L1-24 C_Bo6L1-36 C_Bo3L C_Bo1L1-04 C_Bo8L1-14 C genome C_Bo3L1-01 C_Bo8L1-21 AC_Bn21L1-25 C_Bo1L1-06 C_Bo8L1-11 BC_Bc25L1-04 C_BoAC C_BoB48N13 BC_Bc25L1-02 C_Bo1L1-01 A_BrAC Figure 2. An unrooted maximum likelihood consensus tree of Bot1 based on the 312bplong ORFs of the 16 sequences of 1kb isolated in the present study and of 13 additional analogous sequences obtained from BAC sequencing or mined from the database. Numbers indicate the percentage values ( 50) from 1000 bootstrap replicates supporting a particular clade. Polytomies are shown by ( ). Genome composition for each accession is indicated: A for B. rapa (Br), C for B. oleracea (Bo), AC for B. napus (Bn) and BC for B. carinata (Bc). 42

44 Figure 3. Fluorescent in situ hybridization of Bot1 (clone Bo6L1-15) to metaphase chromosomes of B. napus cv. Yudal (A) and Drakkar (B). Chromosomes are counterstained blue with DAPI (left), and probe hybridization sites are shown in red (centre), and in overlay (right). Bot1 labels the eighteen C-genome chromosomes in each metaphase originating from B. oleracea strongly and relatively uniformly along their lengths, with some stronger and weaker areas around centromeres. Only weak hybridization is seen to the 20 A genome chromosomes from B. rapa (probe in Yudal labelled with digoxigenin detected with antidigoxigenin-fitc and colour converted to red; probe in Drakkar labelled with biotin detected with streptavidin-alexa 594 where large red dots are not considered signal). Scale bar = 5µm. 43

45 a Bot1-1 TIR Transposase pseudogene TR SLL3 gene b Bot1-1 Position of Bot1-1 within BAC BoB028L01 (#EU642504): from to ,393bp Bot1-2 Position of Bot1-2 within BAC BoB029L16 (#EU642505): from to ,908bp Position of Bot1-3 within BAC BoB048N13 (#EU642506): from to ,814bp Bot1-3 TIR TR Transposase CDS (pseudogene) SLL3 gene Putative retroelement polyprotein CDS (pseudogene) region matching Bo6L1-15 stop codon c GC content (%) max GC% average GC% min GC% 5.83 Bot1-1 BoB028L01 Figure 4. Schematic representation of the overall genomic structure of the different B. 44

46 oleracea CACTA transposons studied. a. Dot-plot pattern and corresponding overall structure of Bot1-1 identified in the B. oleracea BAC BoB028L01. b. Structural comparisons of the CACTA transposons. c. GC content of Bot1-1 and its flanking regions which correspond to AT-rich regions (encircled on the figure). The median line corresponds to the average GC content of the entire BAC sequence analysed (window size 120). 45

47 B. napus AJ AC B. rapa AC AC AC Bot1-1 1 large insertion specific to Bot1-1 B. oleracea Bot1-2 large insertion in common between Bot1-2 and Bot1-3 rearrangement Bo6L1-15 Bot bp specific to of Bot bp Figure 5. Multiple alignment of Bot1 elements from B. napus (AJ245479) B. rapa (AC189496, AC189446, AC189655, AC189480) and B. oleracea (Bot1-1, Bot1-2, Bot1-3 with BAC accession numbers). A similarity profile using Mauve multiple alignment software (Darling et al. 2004) is shown 46

48 for each sequence. Regions exhibiting no homology with any other sequence are uncoloured, e.g. the large insertion annotated in Bot1-1. Homologous regions appearing across all the sequences (denoted as backbone) are coloured mauve. Conserved regions appearing only in a subset of the aligned sequences are coloured differently based on which sequence they match. Orange regions delineate fragments found only in B. olereacea which appear C genome-specific. The region homologous to the B6L1-15 sequence is shown in the black box. ( ) transposase pseudogene CDS ( ) retroelement polyprotein pseudogene CDS, as described in Figure 4. 47

49 En/Spm-like putative transposase (Tnp2) coding sequence gi transposon protein-like [Arabidopsis thaliana] AC Complete CDS Bot1-1 Interrupted CDS Bot1-2 Interrupted CDS Bot1-3 Interrupted CDS Figure 6. Multiple alignment analysis reveals that Bot1 elements of B. oleracea contain an interrupted version of the En/Spm-like transposase gene. The blue arrow corresponds to the transposase CDS. A full CDS is present in B. rapa Bot1-like element. The En/Spm-like gene is interrupted by fragments of putative C genome specific DNA in B. oleracea Bot1 CACTA transposable elements. 48