Atypical citrate-fermenting Lactococcus lactis strains isolated from dromedary s milk

Transcription

1 Journal of Applied Microbiology ISSN ORIGINAL ARTICLE Atypical citrate-fermenting Lactococcus lactis strains isolated from dromedary s milk H. Drici 1,2, C. Gilbert 1, M. Kihal 2 and D. Atlan 1 1 Université de Lyon, Lyon, France; Université Lyon, Villeurbanne; INSA de Lyon, Villeurbanne; CNRS UMR5240 Microbiologie, Adaptation et Pathogénie, Lyon, France 2 Laboratory of Applied Microbiology, University Es-Sania, Oran, Algérie Keywords CitP, citrate fermentation, Lactococcus lactis ssp. lactis biovar diacetylactis, thermotolerance. Correspondence Danièle Atlan, Université de Lyon, Lyon, France; Université Lyon 1, Villeurbanne; INSA de Lyon, Villeurbanne; CNRS UMR5240 Microbiologie, Adaptation et Pathogénie, Lyon, France. atlan@biomserv.univ-lyon1.fr : received 17 February 2009, revised 4 June 2009 and accepted 15 June 2009 doi: /j x Abstract Aim: The aim was to isolate and characterize Lactococcus strains with new properties compared to those of usual Lactococcus dairy starters derived from cow s milk. Methods and Results: Algerian dromedary s milk was screened for proteolytic isolates able to grow rapidly on agar milk medium. PCR experiments revealed that 74 proteolytic isolates belonged to the genus Lactococcus and harboured the prtp gene encoding the lactococcal cell-surface proteinase. Among these, 85% were able to ferment citrate (Cit + phenotype) and were classified as Lactococcus lactis ssp. lactis biovar. diacetylactis. This classification was confirmed after sequencing of the 16S rdna gene of five Cit + isolates. In contrast to dairy lactococci described in the literature, several Cit + isolates exhibited a tolerance to 50 C (Ther + ) and alkaline ph. Two genetic approaches allowed to show the presence of four independent plasmids (so-called pther, pprt, plac, pcit) associated with the four respective phenotypes: Ther +, cell-surface proteinase activity PrtP (PrtP + ), lactose catabolism (Lac + ) and citrate utilization (Cit + ). Two types of pcit plasmid were amplified by inverse PCR: class 1 was characterized by a 9-kb plasmid harbouring the expected lactococcal citqrp operon and class 2 by a 23-kb plasmid harbouring the Leuconostoc cit cluster (citi- CitMCDEFGRP). Conclusions: This work enlarges knowledge of the biovariety diacetylactis by far mainly limited to the citrate-fermenting ability and suggests that the cit plasmid system of some lactococcal strains could have been acquired from another lactic acid bacteria (Leuconostoc spp.). Significance and Impact of the Study: This study reveals new potential dairy lactococci starters of the biovariety diacetylactis able to grow rapidly in milk at a higher temperature in addition to their casein, lactose and citrate-utilizing abilities. Introduction Lactic acid bacteria (LAB) are natural inhabitants of plants, wine, milk and meat. These nonsporulating grampositive bacteria ferment hexose sugars (lactose in milk) and produce lactic acid as the major metabolic end product. LAB comprise numerous genera, and Lactococcus (L.) is one of the most studied (Stiles and Holzapfel 1997; Schleifer et al. 1985). The genus Lactococcus comprises five species including the well-known Lactococcus lactis containing three subspecies (lactis, cremoris and hordniae) mainly found in milk products. The subspecies lactis and cremoris only differ by a few phenotypic traits (Kelly and Ward 2002). Lactococcus lactis ssp. lactis is able to Journal compilation ª 2009 The Society for Applied Microbiology, Journal of Applied Microbiology 108 (2010)

2 Citrate-fermenting lactococci H. Drici et al. metabolize arginine, is tolerant to 40 C and 4% NaCl, but sensitive to 45 C and 6Æ5% NaCl. In addition, strains of the biovar. diacetylactis can ferment the citrate present in milk, which constitutes a secondary energy source. By contrast, L. lactis ssp. cremoris is usually sensitive to 40 C and 4% NaCl, and most strains do not display the capacity to catabolize arginine. Occasionally, strains may have a lactis genotype with a cremoris phenotype or the reverse. Lactococcus lactis ssp. lactis, its biovar. diacetylactis and L. lactis ssp cremoris are used as starters for many industrial milk fermentations (Daly 1983). In LAB, plasmid-encoded functions were first pointed out by the instability of lactose catabolism and proteinase activity observed in spontaneous Lac ) and Prt ) derivatives of L. lactis (McKay and Baldwin 1974, 1975). Then, other key plasmid-encoded functions were identified: citrate utilization, bacteriocin production and immunity, exopolysaccharide production, antibiotic and heavy metal resistance, conjugation, phage resistance, restriction modification (McKay 1983; Mills et al. 2006). Lactococci can carry between four and seven plasmids per cell, with size ranging from 3 to 130 kb (Davidson et al. 1996). To date, about 30 plasmids have been fully sequenced and can encode several functions. Recently, four plasmids of the industrial strain L. lactis ssp. cremoris strain were sequenced: psk11a (10Æ4 kb; nucleotide sequence accession number DQ149242), psk11b (13Æ3 kb; DQ149243), psk11l (47Æ2 kb; DQ149244) and psk11p (75Æ8 kb; DQ149245) (Siezen et al. 2005). psk11p, or the so-called proteinase plasmid, carries the divergently transcribed genes prtp and prtm coding for the cell surface proteinase PrtP and the lipoprotein PrtM, essential to PrtP maturation. PrtP is responsible for the first step of milk casein degradation (caseinolysis) and is fully expressed during bacterial growth in milk (Kok 1990). The plasmid psk11l, or lactose plasmid because it is associated with the Lac + phenotype, harbours the lac cluster (lacrlacabcdfegx) (de Vos and Vaughan 1994). Three types of dairy starters are known to be able to uptake and metabolize citrate: L. lactis ssp. lactis biovar diacetylactis, Leuconostoc spp. and Weissella paramesenteroides (previously named Leuconostoc paramesenteroides) (Drider et al. 2004). The cometabolism of citrate and lactose leads to carbon dioxide production and C4 aroma compounds such as diacetyl (butter flavour). Divalent citrate is transported into the bacterial cell by the citrate permease (CitP) in exchange with lactate and generates a differential membrane potential; then citrate is cleaved into acetate and oxaloacetate by a citrate lyase complex (CitDEF); oxaloacetate is further decarboxylated into pyruvate by an oxaloacetate decarboxylase (CitM). In several strains of L. lactis ssp. lactis biovar diacetylactis, the citp gene is harboured by an 8-kb plasmid and belongs to the citqrp operon, in which citr codes for a regulatory protein and citq for a leader peptide (Drider et al. 2004; Lopez de Felipe et al. 1995). A citm-citi-cit- CDEFXG cluster can also be present on the lactococcal chromosome and transcribed, as with the plasmid citqrp operon, under natural acidification during bacterial growth (Martin et al. 2004). In Leuconostoc spp. and W. paramesenteroides, the citp gene is very similar to that of lactococci, but is harboured by a 23-kb plasmid and belongs to the cluster citi-citmcdefgrp (Kihal et al. 1996; Martin et al. 1999, 2005; Vaughan et al. 1995). During cheese ripening, residual citrate can also be metabolized by nonstarter lactobacilli (Lactobacillus plantarum, Lactobacillus helveticus), which leads to a succinate production (Dudley and Steele 2005; Torino et al. 2005). In cow s milk, L. lactis ssp. lactis is known to be a dominant LAB and has been extensively analysed, but to our knowledge the biovar. diacetylactis has been more rarely detected (Sandine et al. 1972; Desmasures et al. 1998; Kelly and Ward 2002; Franciosi et al. 2009). However, little is known about the lactococci present in other mammalian milks. Dromedary s milk constitutes an important protein source in pastoral societies; it is traditionally fermented from natural flora that contains a large panel of LAB that have been characterized at the phenotypic and metabolic levels, but not at the genetic level (Hassaïne et al. 2007; Khelid et al. 2009). In particular, the sequence diversity of plasmid-coded traits has not been examined. In this work, lactococci were isolated from dromedary s milk in South Algeria, identified by 16S rdna sequencing and characterized. Our study focused on plasmid-encoded functions associated with four phenotypes: thermotolerance (Ther + ), lactose catabolism (Lac + ), citrate utilization (Cit + ) and cell-surface proteinase activity (PrtP + ). A particular attention was given to plasmid-encoded cit systems. Materials and methods Strains and growth conditions Lactococcus lactis ssp. cremoris SK11, Wg2 and HP are well-known industrial starters used in cheese-making and extensively studied for their proteolytic activity as a result of the cell-surface proteinase PrtP (Vos et al. 1989a; Kok et al. 1988; Christensson et al. 2001). Lactococcus lactis ssp. lactis biovar. diacetylactis CNRZ 124 and CNRZ 126 are citrate-fermenting strains isolated from cow s milk and obtained from the collection of INRA (Jouy-en-Josas, France). Lactococcus strains were routinely grown at 30 C in M17 medium containing 5 g l )1 lactose (agar or broth; Biokar Diagnostics, Beauvais, France); if necessary, 5 g l )1 glucose was added (Terzaghi and Sandine 1975). 648 Journal compilation ª 2009 The Society for Applied Microbiology, Journal of Applied Microbiology 108 (2010)

3 H. Drici et al. Citrate-fermenting lactococci Reconstituted milk broth or agar (10%, w v) was made by adding sterile water to powdered milk G (Standa Industrie, Caen, France) and was routinely used to derepress the biosynthesis of the lactococcal cell-surface proteinases (Lamarque et al. 2004). Bacterial growth was estimated by measuring turbidity of the bacterial cultures at 600 nm. For milk cultures, 1-ml samples were clarified by the addition of 3Æ5 ml EDTA (10 g l )1, ph 12Æ0) before turbidity measurement. In situ cell-surface proteolytic activity Extracellular proteolytic activity was visualized by a transparent halo around bacterial colonies developing on milk agar because of hydrolysis of milk casein. The cell-surface proteolytic activity of bacterial colonies was also required for a fast growth on 3-N-Morpholino propane sulfonic acid (MOPS) casein agar prepared as follows: a 100 ml MOPS medium containing 5 g MOPS, 0Æ1 g ascorbic acid, 1Æ3 g yeast extract and 2Æ0 g casein (Hammarsten; Serva, Heidelberg, Germany) was adjusted to ph 6Æ6 and mixed with 100 ml agar at 55 C. was adjusted to 6Æ6; the medium was further sterilized for 15 min at 115 C and kept at 45 C. Then, 10 ml of two sterilized solutions was added to the medium: solution A containing potassium ferricyanide (10%, w v) and solution B containing sodium citrate (1 g) and ferric citrate (1 g) in 40 ml water. Carbohydrate-fermenting ability Bacterial cells were collected by centrifugation from overnight cultures at 30 C in M17 medium then suspended in API 50 CHL medium (BioMérieux, Marcy-l Etoile, France) to a 0Æ1 final OD 600. Miniaturized API 50 CH systems (BioMérieux) containing 49 different carbohydrates were filled with the suspension. Data were collected after 2, 6, 12 and 18 h of incubation at 30 C. MRSS lac medium allowed the selection of bacterial lactococci able to metabolize lactose. This medium is similar to MRS (de Man et al. 1960), but is devoid of dextrose and beef extract. Lactose and chlorophenol red were added to 0Æ75% (w v) and 0Æ004% (w v) final concentrations respectively. Arginine dihydrolase activity Bacteria were cultivated in Moeller medium adjusted to ph 6Æ8 and containing arginine (10 g l )1 ), yeast extract (3 g l )1 ), Bromocresol purple (0Æ16 mg l )1 ) and NaCl (5 g l )1 ) (Moeller 1955). Colonies were attributed arginine dihydrolase activity if the surrounding yellow colour from acidification reverted to purple as a result of the ph increase. Acetoin production Acetoin was detected after bacterial growth during 48 h at 30 C in filter sterilized Clark and Lubs medium (ph 7Æ5) containing proteose peptone (5 g l )1 ), glucose (5 g l )1 ) and KH 2 P0 4 (5 g l )1 ). Two millilitres of the bacterial culture was mixed in a tube with the two Vosges Proskauer (VP) reagents: 0Æ5 ml of a-naphthol (6%, w v alcohol) and 0Æ5 ml of potassium hydroxide (16%, v v). After min, a pink burgundy ring developed at the liquid surface and was associated with a positive VP reaction. Citrate-fermenting capacity The KMK medium (Kempler and McKay 1980) allows to distinguish between citrate-fermenting colonies (blue colour) and noncitrate fermenting colonies (white colour) after a 48-h incubation at 30 C. This medium contained nonfat milk (10 g l )1 ), casein hydrolysate peptone (2Æ5 gl )1 ), glucose (5 g l )1 ) and agar (15 g l )1 ), and ph PCR amplification of DNA DNA amplification was performed with the 2 PCR master mix (Fermentas, Saint-Rémy les Chevreuse, France), containing DNA Taq polymerase (0Æ05 u ml )1 ), MgCl 2 (4 mmol l )1 ) and dntps (0Æ4 mmol l )1 ). Then, 50 ng purified DNA and 20 pmoles of each appropriate primer (citpsens1 and citprev1 for citp amplification) (Table 1) were added to this mixture. Lactococcal plasmids were amplified by inverse PCR according to the method of Ochman et al. (1990). The PCR mixture (50 ll) contained the following: 0Æ1 U Phusion polymerase (Finnzymes, Epsoo, Finland), 10 ll 5 GC Buffer, 0Æ8 ll of MgCl 2 (50 mmol l )1 ), 2Æ5 ll of dntps (Finnzymes) (10 mmol l )1 ), 500 ng of purified plasmid extract and 2Æ5 ll of primers citpsens2 and citrrev1 (1 lmol l )1 ) for the pcit amplification. The PCR programme used for the pcit amplification was as follows: step 1 (98 C 30 s), 35 cycles of step 2 4 [step 2 (98 C 15 s), step 3 (57 C 30 s), step 4 (72 C 12 min)], step 5 (72 C 10 min), except for the pcit of strain 3A where the hybridization (step 3) was performed at 62 C. Amplicons obtained by inverse PCR were purified with the GeneClean Turbo Ò kit (MP Biomedicals, Illkirch, France). Plasmid DNA extraction and electroporation conditions Plasmid DNA extraction was carried out according to a modified procedure described by Birnboim and Doly (1979). The first step of the procedure was modified as Journal compilation ª 2009 The Society for Applied Microbiology, Journal of Applied Microbiology 108 (2010)

4 Citrate-fermenting lactococci H. Drici et al. Table 1 Primers used in the study Primer Sequence (5 3 ) Gene and sequence origin Y1 tggctcaggacgaacgctggcggc 16S ribosomal RNA DAY2 cctactgctgcctcccgtaggagt gene Lactococcus lactis ssp. cremoris (Ward et al. 1998) prtmsens1 tagcgcatccgcaagatcc prtm of L. lactis ssp. prtmrev1 ttggcaagtaccgcaactgc cremoris SK11 (Vos et al. 1989a) prtpsens1 tcttgttagccggtacagtcgc prtp of L. lactis ssp. prtprev1 aaccggatgttcctgagttcc cremoris SK11 (Vos et al. 1989b) citpsens1 agaaattgggaagctcgatcg citqrp operon citpsens2 ttgtatccggttgaagctgctatt pcit L. lactis ssp. citpsens3 agcaaaggaaatggtcacggt lactis biovar diacetylactis citprev1 ggccaaccctgctgtaatagc CRL1127 (accession citprev2 cccaaatatgagcggaagattg number AF409136) citprev3 cagaatcaaggcaccaccga citqsens1 gcgcacttacaccccacc citrrev1 aaaggcgcgtttaatgttgcat citisens1 cgcttaacactctaaaagcgacc cit I-citMCDEF region citmsens1 taagtgaagcatacaccccagg pcitj1 Weissella citmrev1 gggttcgccagagcaaag mesenteroidesj1 citfsens1 cgccattgaggctggtg (accession number citfrev1 acccggtgtaataaccgtcg AJ132782) (Martin et al. 1999) citrsens1 agtttatacggacgaaggtgatgg citr L. lactis citrrev2 atgctgccagattggagacc ssp. lactis biovar diacetylactis 9B (this work) following: after harvesting by centrifugation, 5 ml overnight-grown lactococcal cultures were treated during 20 min at 37 C in 100 ll solution I (25 mmol l )1 Tris- HCl ph 8Æ0, 0Æ2 gml )1 sucrose, 2 mg ml )1 lysozyme, 40 lg ml )1 mutanolysin). Genomic DNA of LAB was purified as previously described (Atlan et al. 1994). Electrocompetent cells of L. lactis MG1363 were prepared from overnight culture in M17 supplemented with 0Æ5%, (w v) glucose, 1%, (w v) glycine and 0Æ17 mol l )1 sucrose. Bacterial cells were treated according to the procedure of Wells et al. (1993). The conditions for electroporation were 2Æ0 kv, 400 ohms and 25 lf. Pulse field gel electrophoresis (PFGE) The method is similar to that developed by Kahala et al. (2008) with some modifications. Lactococci were harvested by centrifugation from overnight cultures at 30 C in M17 medium; Legionella pneumophila Paris suspension was performed from a 5-day culture at 30 C on agar BCYE medium and centrifuged. The bacterial pellet was washed with 10 mmol l )1 Tris, 10 mmol l )1 EDTA, 10 mmol l )1 EGTA, 1 mol l )1 NaCl (ph 7Æ5) and suspended in 100 ll of lysis buffer (6 mmol l )1 Tris, 100 mmol l )1, EDTA 1 mol l )1, NaCl 0Æ5%, Brij 58 0Æ2%, sodium deoxycholate 0Æ5%, sarcosyl ph 7Æ6) to a final cell density of 1Æ3 1Æ4 (OD 560 nm ). This suspension was mixed with 100 ll of1æ8% agarose at 55 C, 20 ll of lysozyme (20 mg ml )1 ) and 10 ll of mutanolysin (2 units ll )1 ). Agarose was solidified at 4 C for 20 min and then incubated overnight at 37 C in 1 ml of lysis buffer supplemented with 20 ll of lysozyme (20 mg ml )1 ). To hydrolyse the cellular proteins, the agarose block was incubated at 50 C for 18 h in 1 ml of lysis buffer supplemented with 5 ll of proteinase K (20 mg ml )1 ). Then, the agarose block was equilibrated overnight in 5 ml of TE buffer (1 mmol l )1 EDTA, 10 mmol l )1 Tris ph 8Æ0). DNA digestion to SmaI (20 ll) was performed at 25 C by incubation of the agarose block in 200 ll of the SuRE - Cut buffer A ( 1) of Roche Applied Science (Meylan, France). DNA fragments were separated on a 0Æ8% agarose gel in 0Æ5 TBE buffer using a CHEF DRII apparatus (Bio-Rad). Electrophoresis was run at 10 C for 22 : 11 h at a pulse time of s and then 11 h at s. Gels were stained with ethidium bromide, and a digital image was obtained with a Vilber-Lourmat camera and Vision-Capt image acquisition software (Vilber-Lourmat, Marne-la-Vallée, France). GelComparII (Applied Maths, Sint-Martens-Latem, Belgium) software was used for analysis and normalizing the PFGE patterns. Similarity of the PFGE patterns was calculated according to the Dice s correlation coefficient. Dendrograms were performed from the similarity matrix according to unweighted pair group method with arithmetic averages using 2Æ2% optimization and 1Æ5% tolerance for the patterns. Sequence alignments of CitP sequences Multiple alignments of CitP sequences were performed with the clustalw software on the Infobiogen Web site The CitP sequences (with accession number) concerned different LAB: several strains (NCDO 176, CRL1127, CNRZ124 and 9B respectively) of L. lactis ssp. lactis biovar diacetylactis (M58694, AF409136, EF362620, EF362619), Leuconostoc lactis NZ6070 (U28212), Leuconostoc mesenteroides 19D (L29572) and W. paramesenteroides J1 (AJ132782). Nucleotide sequences and sequencing strategy The nucleotide sequences reported in this manuscript have been submitted to GenBank. Sequences of 16S ribosomal genes of strains CNRZ 124, 3A, 3C, 5C, 8B, 9B and 1MD belonging to L. lactis ssp. lactis biovar. diacetylactis have been respectively assigned accession numbers EF362618, EF376186, EU496491, EF362616, EF376185, EF and EF Journal compilation ª 2009 The Society for Applied Microbiology, Journal of Applied Microbiology 108 (2010)

5 H. Drici et al. Citrate-fermenting lactococci The citqrp sequence (1622 bp) (EF362620) of the strain L. lactis ssp. lactis biovar. diacetylactis CNRZ 124 was identified from the 1723-bp amplicon obtained by PCR with the citqsens1 and citprev3 primers. Sequencing of the citg-citr-citp-kat region (3100 bp) (EF and EU80554) from the strains 8B and 9B was obtained from two amplicons. First, a 1242-bp amplicon was obtained with primers citpsens1 and citprev3, and overlapping sequences were performed with the primers citpsens1, citpsens3, citpsens2 and citprev3. Secondly, the pcitd plasmid (23 kb), devoid of a part of citp, was amplified using the primers citprev2 and citpsens2; then, sequencing of the pcitd 5 and 3 termini was performed with the primers citpsens2, citprev2 and citrrev2. Results Morphologic, phenotypic, metabolic and genetic analysis of proteolytic isolates from dromedary s milk Samples of raw milk from Algerian dromedary were spread on milk agar medium. After incubation overnight at 30 C, we observed 180 colonies surrounding by a transparent halo because of hydrolysis of milk proteins (caseins) by extracellular bacterial proteases. Among these 180 proteolytic isolates, 74 were identified as lactococci according to the following characteristics: (i) whitish small size colonies, (ii) gram-positive cocci, (iii) deficiency in catalase activity, (iv) capacity for casein hydrolysis, (v) lactose utilization, (vi) glucose fermentation without gas production, (vii) presence of the plasmid prtp gene encoding the well-known PrtP cell-surface proteinase (revealed by PCR amplification; data not shown). Among these 74 putative lactococci, 63 gave blue colonies on KMK medium demonstrating the capacity to ferment citrate (Cit + phenotype). Thus, our results suggest that the 63 proteolytic Cit + isolates from dromedary s milk belong to L. lactis ssp. lactis biovar. diacetylactis. Five Cit + isolates (3A, 3C, 5C, 8B and 9B) exhibited larger colony size on milk agar and MOPS casein agar, which raised the hypothesis of a high proteolytic activity and was associated with a rapid growth in milk (Fig. 1). Growth of these five proteolytic Cit + isolates was sensitive to 6Æ5% NaCl, which is in agreement with the phenotype of dairy lactococci, but surprisingly appeared resistant to alkaline ph (9Æ6) (Table 2). These five proteolytic Cit + isolates were able to produce acetoin, displayed an arginine dihydrolase activity (Table 2) as well as a wide variety of sugar fermentation (glucose, lactose, galactose, fructose, mannose, maltose, N-acetyl-glucosamine, arbutine, esculine, salicine, cellobiose, threalose and gentiobiose) using API 50 CH strips (data not shown). In addition, isolate 9B could be distinguished from other OD600 nm Time (h) Figure 1 Growth kinetics of four lactococci in milk. Lactococcus lactis ssp. lactis biovar. diacetylactis 9B at (s) 45 C or(d) 30 C; strain 5C at ( h )45 C or( )30 C (long dashes); strain 3A at ( 4 )45 C or ( ) 30 C (double points and dashes); L. lactis ssp. cremoris SK11 at (+) 45 C or( ) 30 C (short dashes). proteolytic isolates by a wider capacity of sugar fermentation; it was also able to ferment ribose, mannitol, amygdaline, melibiose, turanose and tagatose (data not shown). Surprisingly, three proteolytic Cit + lactococci (3A, 8B and 9B) were also able to develop in a temperature range from 10 to 50 C (Table 2). Nevertheless, the thermotolerance level of these three strains was not similar. Interestingly, growth of the isolate 9B in cow s milk at 30 C was as fast as that of the well-known industrial strain L. lactis ssp. cremoris SK11 and was only weakly affected at 45 C in contrast with SK11 (Fig. 1). Growth of the isolate 8B in cow s milk was similar to that of 9B at 30 and 45 C (data not shown). Unlike 9B and 8B, development of the isolate 3A was much less rapid at 45 C, and the bacterial biomass in stationary phase was fivefold lower than that observed at 30 C (Fig. 1). Thus, some isolates of L. lactis ssp. lactis biovar. diacetylactis obtained from dromedary s milk were characterized by a rapid growth in cow s milk and showed new interesting traits compared to biovar. diacetylactis previously described in the literature and known lactococcal starters (Table 2). Molecular identification and plasmid profiles of five proteolytic lactococcal strains The identification of the five Cit + isolates was validated by amplifying and sequencing a 400-bp region of the lactococcal 16S ribosomal RNA gene (rdna) using the chromosomal Journal compilation ª 2009 The Society for Applied Microbiology, Journal of Applied Microbiology 108 (2010)

6 Citrate-fermenting lactococci H. Drici et al. Table 2 Main properties of proteolytic lactococci isolated from raw milk of the Algerian dromedary Gene Growth conditions Lactococcus lactis ADH* Acetoin Citrateà citp prtp prtm 10 C 45 C 50 C ph 9Æ6 NaCl 6Æ5% Biovar. diacetylactis from dromedary s milk 3A ) 3C ) ) + ) 5C ) ) + ) 8B ) 9B ) Biovar. diacetylactis from cow s milk CNRZ ) ) ) ) CNRZ ) ) ) ) Ssp. cremoris from cow s milk SK11 ) + ) ) ) ) ) *ADH, arginine hydrolase activity detected (+) or not detected ()). Acetoin, acetoin production detected (+) or not detected ()). àcitrate, citrate-fermenting capacity (+) or incapacity ()) after growth on KMK agar medium. gene amplification (+) or absence of amplification ()) by PCR with plasmid DNA extracts. Amplicons with expected sizes of 1133, 1137 or 837 bp were obtained using the primer pairs citpsens1 citprev1 (citp), prtpsens1 prtprev1(prtp) or prtmsens1 prtmrev1(prtm) respectively (Table 1). Bacterial growth on M17 agar medium (+) or absence of development ()). DNA with primers Y1 and DAY2. In this region, it is known that the sequences of lactis and cremoris subspecies differ by 10 bp within the first 200 bp of the sequence (Ward et al. 1998). The sequences of isolates 3A, 3C, 5C, 8B and 9B (GenBank accession numbers EF376186, EU496491, EF362616, EF and EF respectively) were identical to those of L. lactis ssp. lactis ATCC (M58837) and biovar. diacetylactis (strain ATCC 13675: AB100805; strain CNRZ124: EF362618, this work) (data not shown). The sequence of 5C displayed an extra substitution (A G) in the first 200 bp (data not shown). The PFGE patterns of lactococci isolated from dromedary s milk clearly differed from those of other reference lactococcal starters (Fig. 2). In a dendrogram based on the PFGE patterns, the cluster I containing the five Cit + isolates from dromedary s milk could be defined at a similarity level of 75%. In this cluster, the subgroups Ia (including 5C and 8B) and Ib (including 3A, 3C and 9B) were defined at similarity levels of 80 and 90% respectively. Only the isolates 3A and 3C exhibited identical restriction patterns, but were shown to differ by their sensitivity to the temperature (Table 2); this phenotypic difference could result from punctual mutation(s), and the isolates 3A and 3C could be variants of a same pulsotype. Thus, combination of phenotypic, genotypic and molecular methods allowed us to distinguish four independent L. lactis ssp. lactis biovar. diacetylactis strains and a possible variant. Besides, plasmid patterns of five proteolytic Cit + lactococci isolated from dromedary s milk appeared very similar and could be easily distinguished from other lactococci even from the biovar. diacetylactis (CNRZ 124 and CNRZ 126) isolated from cow s milk (Fig. 3). Lactococcus lactis ssp. cremoris SK11 is known to harbour four plasmids with sizes ranging from 10Æ4 to 75Æ8 kb and L. lactis ssp. cremoris Wg2 to harbour five plasmids (Siezen et al. 2005; Otto et al. 1982). As plasmids were present in a covalently close circular form but also in an open circular form as a consequence of a DNA nicking during the extraction procedure, it was not possible to determine the actual number and sizes of plasmids present in the five proteolytic Cit + lactococci; nevertheless, these lactococci exhibited a higher number of plasmid DNA bands than strains SK11 and Wg2, and as a consequence probably harbour more than five plasmids. Identification of four independent plasmid functions in Lactococcus lactis ssp. lactis biovar. diacetylactis 9B Two genetic approaches were used to determine the relation between lactococcal plasmids of the thermotolerant strain 9B and the four analysed phenotypes (Lac +, PrtP + and Cit +, Ther + ). First, curing of plasmids of the strain 9B was obtained after 65 generations grown at 30 C in a peptide-rich medium (M17) to avoid a selection pressure towards plasmid genes associated with one of the four analysed phenotypes. The variants could be classified into four types according to their traits (Table 3A); the loss of the four analysed functions in the type 1 variant (Ther ) Lac ) Cit ) PrtP ) ) suggested that these traits are associated 652 Journal compilation ª 2009 The Society for Applied Microbiology, Journal of Applied Microbiology 108 (2010)

7 H. Drici et al. Citrate-fermenting lactococci Similarity % Ia 5 C 8 B Figure 2 Dendrogram representing the relationships of lactococci isolated from dromedary s milk and reference strains from cow s milk. Patterns were generated by pulse field gel electrophoresis of total bacterial DNA after digestion with SmaI and then clustered by unweighted pair group method with arithmetic averages algorithm. 5C, 8B, 3A, 3C and 9B were proteolytic Cit + isolates from dromedary s milk. Lactococci from cow s milk: HP: Lactococcus lactis ssp. cremoris HP; Wg2: L. lactis ssp. cremoris Wg2; 124: L. lactis ssp. lactis biovar. diacetylactis CNRZ 124; 126: L. lactis ssp. lactis biovar. diacetylactis CNRZ 126; SK11, L. lactis ssp. cremoris SK11; Lp Paris, Legionella pneumophila Paris. Ib 3 A Cluster I 3 C 9 B HP Wg2 Cluster II SK11 Lp Paris 10 0 kb 1 0 kb 0 5 kb MM SK11 Wg2 HP 124 with plasmid(s); the phenotypes of type 2 (Ther ) Lac ) Cit + PrtP ) ) and type 4 (Ther + Lac + Cit + PrtP ) ) variants suggested that both phenotypes Cit + and Prt + are associated with two plasmids independent of those harbouring the three other traits; the four types did not reveal if the phenotypes Ther + and Lac + are linked to the same plasmid or two independent plasmids. This question was solved by a second genetic approach, transfer of plasmid DNA. Thus, the plasmid DNA content of strain 9B was transferred by electroporation into the plasmid-free L. lactis MG1363 (Ther ) Lac ) Cit ) PrtP ) ). Transformants showing Lac + or PrtP + phenotypes were selected after growth at 126 3A 3C Figure 3 DNA plasmid content of lactococci. Five micrograms of plasmid DNA of each of the following strains was loaded: SK11, Lactococcus lactis ssp. cremoris SK11; Wg2: L. lactis ssp. cremoris Wg2; HP: L. lactis ssp. cremoris HP; 124: L. lactis ssp. lactis biovar. diacetylactis CNRZ 124; 126: L. lactis ssp. lactis biovar. diacetylactis CNRZ 126; strains 3A, 3C, 5C, 8B and 9B from dromedary s milk; MM: the molecular mass marker was the GeneRuler TM DNA Ladder mix (Fermentas). 8B 9B 5C 30 C (Table 3B). Analysis revealed that both transformants were not associated with the Ther + phenotype. Taken together, these results suggest that the phenotypes Ther +, Lac +, Cit + and PrtP + of the strain 9B are linked to at least four independent plasmids (designated pther9b, plac9b, pcit9b and pprt9b respectively). Lactococcus lactis ssp. lactis biovar. diacetylactis strains from dromedary s milk harbour different plasmids pcit In L. lactis ssp. lactis biovar. diacetylactis, use of the citrate present in milk (Cit + phenotype) requires the presence of the CitP encoded by the plasmid citp gene. This gene was amplified from plasmid extracts of the reference strains L. lactis ssp. lactis biovar. diacetylactis CNRZ 124 and CNRZ 126 as well as from lactococci isolated from dromedary s raw milk (3A, 3C, 5C, 8B, 9B) (data not shown). Surprisingly, two types of amplicon were obtained by inverse PCR (Fig. 4): (i) 8Æ0-kb amplicons from strains 3A and 5C as well as from the reference strains CNRZ124 and CNRZ126, which correspond to 9kb-plasmids taking into consideration a 1Æ44-kb citp-citr not amplified region; (ii) kb amplicons were obtained from 3C, 8B and 9B, which correspond to kb plasmids. So far, citrate-fermenting lactococci were only characterized by an 8-kb cit plasmid (Drider et al. 2004). However, 23-kb plasmids harbouring a cit system have been described in other citrate-fermenting LAB (Leuconostoc spp. and Weissella). Journal compilation ª 2009 The Society for Applied Microbiology, Journal of Applied Microbiology 108 (2010)

8 Citrate-fermenting lactococci H. Drici et al. Table 3 Analysis of spontaneous variants of strain 9B (A) and transformants of Lactococcus lactis MG1363 obtained after transfer of a plasmid extract from 9B (B) A M17 glu* 45 C MRSS lac KMKà Milk glu Phenotype 9B Ther + Lac + Cit + PrtP + Variant (number) Type 1 (1) ) ) ) ) Ther ) Lac ) Cit ) PrtP ) Type 2 (6) ) ) + ) Ther ) Lac ) Cit + PrtP ) Type 3 (6) + + ) ) Ther + Lac + Cit ) PrtP ) Type 4 (2) ) Ther + Lac + Cit + PrtP ) B M17 glu* 45 C MRSS lac KMKà Milk glu Phenotype L. lactis MG1363 ) ) ) ) Ther ) Lac ) Cit ) PrtP ) Transformant (number) Lac + Type A (16) ) Ther ) Lac + Cit + PrtP + PrtP + Type B (41) ) ) + + Ther ) Lac ) Cit + PrtP + *Bacterial growth in M17 supplemented with glucose at 45 C (+) (Ther + phenotype) or absence of development ()) (Ther ) ). Lactose utilization (+) (Lac + phenotype) or absence ()) (Lac ) ) was detected after bacterial growth on MRSS lac medium. àcitrate-fermenting capacity (+) (Cit + phenotype) or incapacity ()) (Cit ) ) was observed after bacterial growth on KMK medium. Cell-surface proteolytic activity (+) (Prt + phenotype) or absence of activity ()) (Prt ) ) was visualized after bacterial growth on milk agar medium supplemented with glucose. Transformants Lac + or PrtP + were selected at 30 C on MRSS lac or Milk glu respectively. 20 kb 10 kb 7 kb 5 kb 4 kb MM A 5C 3C 8B 9B MM Figure 4 pcit plasmids of lactococci obtained by inverse PCR. 124, Lactococcus lactis ssp. lactis biovar. diacetylactis CNRZ 124; 126: L. lactis ssp. lactis biovar. diacetylactis CNRZ 126; strains 3A, 5C, 3C, 8B and 9B from dromedary s milk; MM: the molecular mass marker was the GeneRuler TM DNA Ladder mix (Fermentas). Plasmid-encoded cit cluster of Lactococcus lactis ssp. lactis biovar. diacetylactis 8B and 9B Compared to several lactococcal CitP sequences, that of 9B was characterized by a strain-specific substitution (E261A), as well as three substitutions [I33V, K256D and S257A(D)] also present in CitP sequences from Leuc. lactis NZ6070, Leuc. mesenteroides 19D and W. paramesenteroides J1. This result, combined with the presence of a 23-kb plasmid pcit, as well as the impossibility to amplify a plasmid citq gene, suggested the presence in the strains 8B and 9B of a cit cluster similar to that of Leuconostoc spp. (Weissella). So, the genetic organization of the plasmid cit cluster of both strains 8B and 9B was performed by PCR with primers designed according to the sequence of the plasmid citi-citmcdefgrp cluster from W. paramesenteroides J1 (Martin et al. 1999). The sizes of overlapping cit amplicons were in agreement with the cit cluster organization of W. paramesenteroides J1 (Fig. 5). The citp region of strains 8B and 9B was partially sequenced (3100 bp) (Fig. 5). A 474-bp ORF was revealed downstream and in opposite orientation of citp; this ORF codes for a peptide exhibiting 56 and 59% identity with the N-terminus sequence of the manganese-dependent catalase (MnKat) from Lact. plantarum ATCC14434 and Pediococcus pentasoceus ATCC25745 respectively (Igarashi et al. 1996; Makarova et al. 2006). Nevertheless, L. lactis is known to be deficient for catalase activity because of low Mn intracellular content (1Æ0 mmol l )1 ) (Rochat et al. 2006). As a result, no catalase activity could be expected in the strain 9B, and identification of the gene encoding MnKat just allowed a better knowledge of the flanking cit region. Upstream of citp, the sequence displayed the 3 part of citg (246 bp) and the full citr gene (1329 bp). The deduced 81 amino acid sequences of citg from both strains 8B and 9B did not show any difference with the CitG sequence from W. paramesenteroides J1. Besides, the full citr sequence of 8B and 9B were also identical and encoded a 265-amino acid product that displayed 98Æ5% identity with the CitR sequence from W. paramesenteroides J1. By contrast, citr of L. lactis biovar diacetylactis described in the literature is located downstream of citq and only codes for a 112-amino acid sequence, with a 97-residue sequence closely related to Leuconostoc Weissella CitR C-terminus (91Æ8%). Thus, the citg and citr sequences from the strains 8B and 9B confirmed the hypothesis of a plasmid-encoded cit cluster of the Leuconostoc type. Actually, the citr gene is a good marker to differentiate the plasmid-encoded cit system of Lactococcus from that 654 Journal compilation ª 2009 The Society for Applied Microbiology, Journal of Applied Microbiology 108 (2010)

9 H. Drici et al. Citrate-fermenting lactococci L. lactis subsp. lactis biovar diacetylactis 1127 IS982 QR P (AF409136) L. lactis subsp. lactis biovar diacetylactis CNRZ124 QR P (this work, EF362620) Weissella paramesenteroides JI 1622 bp (AJ132782) I M C D E F G R P repb x Figure 5 Genetic organization of plasmid cit clusters in lactic acid bacteria and sequencing strategies of citp regions. Black bars correspond to two sequenced regions (1622 and 3100 bp; see Materials and methods). Accession numbers of sequences were indicated in brackets. Genetic organization of the citi-citp cluster from strains 8B and 9B was determined by DNA amplifications (grey bars) using primers positioned at amplicon ends. L. lactis subsp. lactis biovar diacetylactis 8B and 9B (this work, EF362619) I M C D E F G R P 2 0 kb 9 6 kb 0 8 kb 4 6 kb 8 3 kb 3100 bp 4 5 kb 1 1 kb Primers: citlsens1citmsens1 citmrev1 citfsens1 citfrev1 citpsens1 citprev1 kat of Leuconostoc spp. (Weissella). A screening of the 63 Cit + lactococci isolated from dromedary s milk by PCR using the couple primer citrsens1 citprev2 showed that a bp amplicon was obtained with 31 Cit + lactococci (data not shown); actually, 49% of L. lactis ssp. lactis biovar diacetylactis isolates from dromedary s milk harboured a plasmid-encoded cit system of the Leuconostoc type. Discussion Our study showed that in contrast to lactococci isolated from cow s milk, most proteolytic lactococci (85%) isolated from the raw milk of Algerian dromedary were able to ferment citrate. Some of these L. lactis ssp. lactis biovar. diacetylactis were also able to grow rapidly in cow s milk and to ferment many carbohydrates and displayed a higher tolerance to high ph values. These latter properties have already been reported for L. lactis ssp. lactis strains and some biovar. diacetylactis strains isolated from plant surfaces (Nomura et al. 2006). In addition, some strains showed a rapid development over a wide temperature range (10 50 C), whereas lactococci have so far been considered as mesophilic. This thermotolerance to 50 C probably reflects an adaptation to the high temperatures of the Algerian desert and is a technological trait very interesting in some cheese-making processes including a step of curd cooking. In addition, the acquisition of the citrate-fermenting capacity by some Algerian lactococci probably resulted from a horizontal transfer of plasmid genes from Leuconostoc species. Actually, plasmid transfer has already been reported from lactococci to Leuconostoc spp., which are known to be present in dromedary s milk (Gasson and Fitzgerald 1994; Tsai and Sandine 1987). The original properties displayed by lactococci isolated from dromedary s milk reflect a diversity unknown in usual dairy lactococcal starters. This work also revealed new potential natural lactococcal starters that combine interesting technological traits that are thermotolerance and the capacity to metabolize lactose, caseins and citrate that can generate aroma compounds. Acknowledgements This work was supported by grants from C.N.R.S. and the Université Claude Bernard-Lyon 1. Habiba Drici was the recipient of fellowships from UNESCO-l Oréal (2005) and then from the French and Algerian governments ( Partenariat Hubert Curien, PHC, PROFAS). The authors thank Florence Forey for skilful technical assistance for the PFGE experiments. References Atlan, D., Gilbert, C., Blanc, B. and Portalier, R. (1994) Cloning, sequencing and characterization of a pepip gene encoding a proline iminopeptidase from Lactobacillus delbrueckii subsp. bulgaricus CNRZ397. Microbiology 140, Birnboim, H. and Doly, J. (1979) A rapid alkaline extraction procedure for screening recombinant plasmid DNA. Nucleic Acids Res 7, Christensson, C., Pillidge, C., Ward, L. and O Toole, P. (2001) Nucleotide sequence and characterization of the cell envelope proteinase plasmid in Lactococcus lactis subsp. cremoris HP. J Appl Microbiol 91, Daly, C. (1983) The use of mesophilic cultures in the dairy industry. Antonie Van Leeuwenhoek 49, Davidson, B.E., Kordias, N., Dobos, M. and J. Hillier, A. (1996) Genomic organization of lactic acid bacteria. Antonie Van Leeuwenhoek 70, Journal compilation ª 2009 The Society for Applied Microbiology, Journal of Applied Microbiology 108 (2010)

10 Citrate-fermenting lactococci H. Drici et al. Desmasures, N., Mangin, I., Corroler, D. and Guéguen, M. (1998) Characterization of lactococci isolated from milk produced in the Camembert region of Normandy. J Appl Microbiol 85, Drider, D., Bekal, S. and Prevost, H. (2004) Genetic organization and expression of citrate permease in lactic acid bacteria. Genet Mol Res 3, Dudley, E.G. and Steele, J.L. (2005) Succinate production and citrate catabolism by Cheddar cheese nonstarter lactobacilli. J Appl Microbiol 98, Franciosi, E., Settanni, L., Cavazza, A. and Poznanski, E. (2009) Biodiversity and technological potential of wild lactic acid bacteria from raw cows milk. Int Dairy J 19, Gasson, M. and Fitzgerald, G.F. (1994) Gene transfer system and transposition. In Genetics and Biotechnology of Lactic Acid Bacteria ed. Gasson, G. and de Vos, W. pp Chapman and Hall: Blackie Academic and Professional. Hassaïne, O., Zadi-Karam, H. and Karam, N.-E. (2007) Technologically important properties of lactic acid bacteria from raw milk of three breeds of Algerian dromedary (Camelus dromedarius). Afr J Biotechnol 6, Igarashi, T., Kono, Y. and Tanaka, K. (1996) Molecular cloning of manganese catalase from Lactobacillus plantarum. J Biol Chem 271, Kahala, M., Mäki, M., Lehtovaara, A., Tapanainen, J.-M., Katiska, R., Juuruskorpi, M., Juhola, J. and Joutsjoki, V. (2008) Characterization of starter lactic acid bacteria from the Finnish fermented milk product vilii. J Appl Microbiol 105, Kelly, W. and Ward, L. (2002) Genotypic vs. phenotypic biodiversity in Lactococcus lactis. Microbiology 148, Kempler, G.M. and McKay, L.L. (1980) Improved medium for detection of citrate-fermenting Streptococcus lactis subsp. diacetylactis. Appl Environ Microbiol 39, Khelid, K., Faid, M., Mokhatari, A., Soulaymani, A. and Zinedine, A. (2009) Characterization of lactic acid bacteria isolated from the one humped camel milk produced in Morocco. Microbiol Res 164, Kihal, M., Prévost, H., Lhotte, M., Huang, D. and Diviès, C. (1996) Instability of plasmid-encoded citrate permease in Leuconostoc. Lett Appl Microbiol 22, Kok, J. (1990) Genetics of the proteolytic system of lactic acid bacteria. FEMS Microbiol Rev 87, Kok, J., Leenhouts, K., Haandrikman, A., Ledeboer, A. and Venema, G. (1988) Nucleotide sequence of the cell wall proteinase gene of Streptococcus cremoris Wg2. Appl Environ Microbiol 54, Lamarque, M., Charbonnel, P., Aubel, D., Piard, J.C., Atlan, D. and Juillard, V. (2004) A multifunction ABC transporter (Opt) contributes to diversity of peptide uptake specificity within the genus Lactococcus. J Bacteriol 186, Lopez de Felipe, F., Magni, C., de Mendoza, D. and Lopez, P. (1995) Citrate utilization gene cluster of the Lactococcus lactis biovar diacetylactis: organization and regulation of expression. Mol Gen Genet 246, Makarova, K., Slesarev, A., Wolf, Y., Sorokin, A., Mirkin, B., Koonin, E., Pavolv, A., Pavlova, N. et al. (2006) Comparative genomics of the lactic acid bacteria. Proc Natl Acad Sci USA 103, de Man, J.C., Rogosa, M. and Sharpe, E. (1960) A medium for the cultivation of lactobacilli. J Appl Bacteriol 23, Martin, M., Corrales, M.A., de Mendoza, D., Lopez, P. and Magni, C. (1999) Cloning and molecular characterization of the citrate utilization citmcdefgrp cluster of Leuconostoc paramesenteroides. FEMS Microbiol Lett 174, Martin, M.G., Sender, P., Peiru, S., de Mendoza, D. and Magni, C. (2004) Acid inducible transcription of the operon encoding the citrate lyase complex of Lactococcus lactis biovar diacetylactis CRL264. J Bacteriol 186, Martin, M.G., Magni, C., de Mendoza, D. and Lopez, P. (2005) CitI, a transcription factor involved in regulation of citrate metabolism in lactic acid bacteria. J Bacteriol 187, McKay, L.L. (1983) Functional properties of plasmids in lactic streptococci. Antonie Van Leeuwenhoek 49, McKay, L.L. and Baldwin, K.A. (1974) Simultaneous loss of proteinase- and lactose-utilizing enzyme activities in Streptococcus lactis and reversal of loss by transduction. Appl Microbiol 28, McKay, L.L. and Baldwin, K.A. (1975) Plasmid distribution and evidence for a proteinase plasmid in Streptococcus lactis C2-1. Appl Microbiol 29, Mills, S., McAuliffe, O.E., Coffey, A., Fitzgerald, G.F. and Ross, R.P. (2006) Plasmids of lactococci - genetic accessories or genetic necessities? FEMS Microbiol Rev 30, Moeller, V. (1955) Simplified tests for some amino acid decarboxylase and for the arginine dihydrolase system. Acta Pathol Microbiol Scand 36, Nomura, M., Kobayashi, M., Narita, T., Kimoto-Nira, H. and Okamato, T. (2006) Phenotypic and molecular characterization of Lactococcus lactis from milk and plants. J Appl Microbiol 101, Ochman, H., Medhora, M., Garza, D. and Hartl, D. (1990) Amplification of flanking sequences by inverse PCR. In PCR Protocols: A Guide to Methods and Applications ed. Innis, M., Gelfand, D., Sninsky, J. and White, T. pp San Diego: Academic Press, Inc. Otto, R., de Vos, W. and Gavrieli, J. (1982) Plasmid DNA in Streptococcus cremoris Wg2: influence of ph on selection in chemostats of a variant lacking a protease plasmid. Appl Environ Microbiol 43, Rochat, T., Gratadoux, J.-J., Gruss, A., Corthier, G., Maguin, E., Langella, P. and van de Guchte, M. (2006) Production of heterologous nonheme catalase by Lactobacillus casei : an efficient tool for removal of H 2 O 2 and protection of Lactobacillus bulgaricus from oxidative stress in milk. Appl Environ Microbiol 72, Journal compilation ª 2009 The Society for Applied Microbiology, Journal of Applied Microbiology 108 (2010)

11 H. Drici et al. Citrate-fermenting lactococci Sandine, W., Radich, P. and Elliker, P. (1972) Ecology of the lactic streptococci a review. J Milk Food Technol 3, Schleifer, K., Kraus, J., Dvorak, C., Kilpper-Balz, R., Collins, M. and Fisher, W. (1985) Transfer of Streptococcus lactis and related streptococci to the genus Lactococcus gen. nov. Syst Appl Microbiol 6, Siezen, R., Renckens, B., van Swam, I., Peters, S., van Kranenburg, R., Kleerebezem, M. and de Vos, W. (2005) Complete sequences of four plasmids of Lactococcus lactis subsp. cremoris SK11 reveal extensive adaptation to the dairy environment. Appl Environ Microbiol 71, Stiles, M. and Holzapfel, W. (1997) Lactic acid bacteria of foods and their current taxonomy. Int J Food Microbiol 36,1 29. Terzaghi, B. and Sandine, W. (1975) Improved medium for lactic streptococci and their bacteriophages. Appl Environ Microbiol 29, Torino, M.I., Taranto, M.P. and Font de Valdez, G. (2005) Citrate catabolism and production of acetate and succinate by Lactobacillus helveticus ATCC Appl Microbiol Biotechnol 69, Tsai, H.J. and Sandine, W. (1987) Conjugal transfer of nisin plasmid genes from Streptococcus lactis 7962 to Leuconostoc dextranicum 191. Appl Environ Microbiol 53, Vaughan, E., David, S., Harrigton, A., Daly, C., Fitzgerald, G. and de Vos, W. (1995) Characterization of plasmidencoded citrate permease (citp) genes from Leuconostoc species reveals high sequence conservation with the Lactococcus lactis citp gene. Appl Environ Microbiol 61, de Vos, W. and Vaughan, E. (1994) Genetics of lactose utilization in lactic acid bacteria. FEMS Microbiol Rev 15, Vos, P., Simons, G., Siezen, R. and de Vos, W. (1989a) Primary structure and organization of the gene for a prokaryotic cell-envelope-located proteinase. J Biol Chem 264, Vos, P., van Asseldonk, M., van Jeveren, F., Siezen, R., Simons, G. and de Vos, W. (1989b) A maturation protein is essential for production of active forms of Lactococcus lactis SK11 serine proteinase located in or secreted from the cell envelope. J Bacteriol 171, Ward, L., Brown, J. and Davey, G. (1998) Two methods for the genetic differentiation of Lactococcus lactis ssp. lactis and cremoris based on differences in the 16S rrna gene sequence. FEMS Microbiol Lett 166, Wells, J., Wilson, P. and Le Page, R. (1993) Improved cloning vectors and transformation procedure for Lactococcus lactis. J Appl Bacteriol 74, Journal compilation ª 2009 The Society for Applied Microbiology, Journal of Applied Microbiology 108 (2010)