Polyphasic identification of yeasts isolated from bark of cork oak during the manufacturing process of cork stoppers

Transcription

1 FEMS Yeast Research 4 (2004) Polyphasic identification of yeasts isolated from bark of cork oak during the manufacturing process of cork stoppers Mercedes Villa-Carvajal a, Juan Jose R. Coque b, Marıa Luısa Alvarez-Rodrıguez b, Federico Uruburu a, Carmela Belloch a, * a Coleccion Espa~nola de Cultivos Tipo (CECT), Universidad de Valencia, Dr. Moliner sn Campus de Burjassot, E-46100, Burjassot, Valencia, Spain b Departamento de Microbiologia, Facultad de Ciencias, Universidad de Extremadura, E Badajoz, Spain Received 18 June 2003; received in revised form 17 October 2003; accepted 28 January 2004 First published online 26 February 2004 Abstract A two-step protocol was used for the identification of 52 yeasts isolated from bark of cork oak at initial stages of the manufacturing process of cork stoppers. The first step in the identification was the separation of the isolates into groups by their physiological properties and RFLPs of the ITS-5.8S rrna gene. The second step was the sequencing of the D1/D2 domains of the 26S rrna gene of selected isolates representing the different groups. The results revealed a predominance of basidiomycetous yeasts (11 species), while only two species represented the ascomycetous yeasts. Among the basidiomycetous yeasts, members representing the species Rhodosporidium kratochvilovae and Rhodotorula nothofagi, that have been previously isolated from plant material, were the most abundant. Yeasts pertaining to the species Debaryomyces hansenii var. fabryii, Rhodotorula mucilaginosa and Trichosporon mucoides were isolated in small numbers. Ó 2004 Federation of European Microbiological Societies. Published by Elsevier B.V. All rights reserved. Keywords: Cork; Yeasts; Identification; Ribosomal DNA; Phenotype 1. Introduction Cork is the bark from the cork oak Quercus suber that grows predominately in countries around the Mediterranean Sea. Cork has been used for manufacturing of stoppers for wine bottles since the 17th century due to its unique physical properties, including longlasting flexibility, hydrophobicity, and gas impermeability [1]. Wine cork stoppers are produced from reproduction cork, which is uniform in texture and density and endows cork stoppers with unique characteristics that provide an excellent closure for wine [2]. The microflora found in association with cork and cork stoppers produces metabolites that affect the quality of the wine. Complex microbial populations on cork are difficult to characterise because they are not * Corresponding author. Tel.: ; fax: address: belloch@uv.es (C. Belloch). constant in time, but can vary depending on the origin, transportation and storage conditions [3]. Most studies suggest that filamentous fungi are the main microorganisms producing undesirable metabolites [4], but some studies have implicated species of the yeast genera Rhodotorula and Candida [5] and also the species Sporidiobolus johnsonii [6]. As filamentous fungi have been suggested as the major agents causing damage in the quality of cork [6,7], no efforts have been devoted to yeast population studies, and almost nothing is known about their role as cork contaminants [8]. Identification of yeasts based on sequence analysis of rrna regions has been established as the most reliable way in the identification of yeasts. Among them, the intergenic transcribed spacers (ITS) 1 and 2 have been demonstrated to be more variable than the D1/D2 26S rrna gene, although strains within the same species present none or few nucleotide differences [9 11] /$22.00 Ó 2004 Federation of European Microbiological Societies. Published by Elsevier B.V. All rights reserved. doi: /j.femsyr

2 746 M. Villa-Carvajal et al. / FEMS Yeast Research 4 (2004) Unfortunately, ITS sequences are not available for all described yeast species, and the cost of routine sequencing as a fast tool for yeast identification is still a burden for laboratories with limited resources, especially when identification of large numbers of yeasts from environments not previously studied is required. Alternatively, several authors have tested the validity of the RFLPÕs of the ITS-5.8S rdna region for identification of ascomycetous yeasts from several food products [12 16]. The identification of yeasts during the manufacturing process of agglomerated cork stoppers followed a twostep protocol. First, conventional tests for yeast identification and RFLPÕs of the PCR product of the ITS-5.8S rrna gene were used for preliminary grouping of the yeast isolates. In the second step, sequencing of the D1/ D2 domains in the 26S rrna gene was used for identification of one representative yeast isolate from each group. Following this methodology, 52 yeasts isolated from cork were identified. 2. Materials and methods 2.1. Isolation of yeasts from cork The manufacturing process of a typical agglomerated cork stopper begins with the removal, once every nine years, of the bark of mature oak trees followed by storage of the planks in the field or the factory to allow them to dry. Stabilized corkwood is then submerged in a water bath at C for up to 60 min. Later, boiled planks are stacked and allowed to mature in a storeroom. The best planks are used to manufacture natural cork stoppers. The remaining planks are stacked in the factory, usually exposed to the environment, and are used to manufacture agglomerated cork stoppers. This material is cleaned and pulverised to a granulated powder consisting of particles of 2 4 mm diameter. The granulated material is mixed with chemical agglutinant compounds such as latex, polyurethane and glue to produce the stopper. Finally, the stopper is polished with an abrasive stone and treated with SO 2 to prevent microbial growth during storage or transport [17]. Yeast strains were isolated from the manufacturing stages before the pulverisation of the cork planks to produce cork stoppers. The isolation protocol started with the suspension of 1 g cork samples (cut into small fragments with a scalpel) in 50 ml of saline solution, which was followed by mixing on an orbital incubator (New Brunswick Scientific, Edison, NJ, USA) at 25 C and 220 rpm for 2 h. Tenfold serial dilutions were made and plated on Rose Bengal Chloramphenicol Agar (RB) (Microkit Laboratories, Madrid, Spain). Rose Bengal dye strongly restricts the growth of invasive fungi, thus allowing the isolation of slow-growing yeast strains. Chloramphenicol prevents bacterial growth. After 3 7 days of incubation at different temperatures (20, 25 and 30 C), individual colonies were subcultured on RB plates. For short-term storage, yeast isolates were maintained on RB or yeast peptone dextrose (YEPD) plates. For long-term storage, yeast strains were frozen in 15% glycerol at )80 C Phenotypic characterisation The yeast isolates were characterised by a few physiological methods, namely splitting of urea, glucose fermentation, inositol assimilation and production of starch-like compounds. Colony colour and form of asexual reproduction were also recorded. All these tests were carried out as described in Yarrow [18] PCR amplification and restriction analysis of the rdna ITS region Yeast cells picked from 48-h-old colonies were directly used in PCR reactions. For amplification of the ITS-5.8S rdna region (ITS-5.8S), the primer pairs used were ITS1 (5 0 TCCGTAGGTGAACCTGCGG 3 0 ) and ITS4 (5 0 TCCTCCGCTTATTGATATGC 3 0 ). For amplification of the 26S rdna the primer pairs used were NL-1 (5 0 GCATATCAATAAGCGGAGG AAAAG) and NL-4 (3 0 GGTCCGTGTTTCAAGACGG). PCR reactions were performed as follows: a first step at 95 C for 5 min, followed by 40 cycles of 94 C for 40 s, 52 C for 40 s and 72 C for 30 s, with a final extension of 10 min at 72 C. PCR products of the ITS-5.8S rdna region were digested without further purification with the restriction endonucleases CfoI, HaeIII and HinfI (Roche Diagnostics, Basel, Switzerland). The PCR products and their restriction fragments (ITS-5.8S RFLPÕs) were separated on 1% and 3% agarose gels, respectively, in 0.5 TBE buffer, and their sizes estimated by comparison against a 100-bp DNA ladder (Gibco-BRL, Carlsbad, CA, USA). The following ITS-5.8S rdna sequences obtained from GenBank: AF444520, AF210326, AF444627, AF444611, AF218991, AF335926, AF444641, AF , AF444660, AF444423, AF444646, AB030325, were subject to in silico restriction analysis using the same enzymes and the DNAMAN programme (Lynnon Corp., Que., Canada) Sequencing and sequence comparison The PCR products of D1/D2 domains of the 26S rrna gene were cleaned with the QIAquick PCR Purification kit (Qiagen, Valencia, CA, USA), and then directly sequenced by using the Taq DyeDeoxy terminator cycle sequencing kit (Perkin Elmer, Wellesley, CA, USA), following manufacturerõs instructions, in an

3 M. Villa-Carvajal et al. / FEMS Yeast Research 4 (2004) Applied Biosystems automatic DNA sequencer, Model 310. The primers NL-1 and NL-4 were used in the sequencing reactions to read both DNA strands. The sequences were directly compared against the GenBank database using the BLASTN tool. 3. Results and discussion The 52 yeast strains, named by a Y for yeast and a number, were isolated from cork samples in the initial stages of the manufacturing process of cork stoppers before the pulverisation of the cork planks. The first step in the identification of the cork isolates was their grouping based on the size of the PCR products and RFLPs of the ITS-5.8S rdna region (ITS-5.8S RFLPÕs), and on the results of selected phenotypic tests [19] (Table 1). After PCR amplification of the ITS-5.8S rdna region and digestion with the enzymes CfoI and HaeIII, the cork isolates were divided into 13 groups (Table 1). The separation in ITS groups was in agreement with the physiological tests. Ascomycetous yeasts within our isolates were present in groups II and VI, both lacking the splitting of urea, and in the case of group VI, they were positive for glucose fermentation. In addition, yeast isolates in group VI produced hat-shaped ascospores. The remaining groups were placed with high probability within the basidiomycetous yeasts, as they were all positive for urea splitting and lacked glucose fermentation. Among the basidiomycetous groups, the highest number of strains occurred in group I with sixteen yeast isolates and group VII with ten isolates (Table 1). Additionally, the isolates pertaining to group VIII assimilated inositol and produced extracellular starch-like compounds. Furthermore, yeasts in groups IV, V and XIII, and group X formed ballistoconidia and arthroconidia, respectively, as propagules for asexual reproduction. The second step in the identification of the cork yeast consisted in the selection of one or two isolates repre- Table 1 Results of PCR amplification and digestion of the ITS-5.8S rdna region, and of phenotypic characterisation of cork isolates Group Isolates ITS-5,8S rdna profiles Phenotypic tests Physiology Morphology AP CfoI HaeIII HinfI U G F I A S P C R I Y2, Y21, ) ) ) Pink B Y23, Y25, Y26, Y30, Y33, Y36, Y37, Y39, Y43, Y44, Y53, Y54, Y56, Y59 II Y ) ) ND ND Cream B III Y5, Y ) ) ) Pink B IV Y6, Y ) ) ) Orange pink B, Ba V Y7, Y ) ) ) Pink B, Ba VI Y13, Y16, ) + ND ND Cream B, H-As Y17, Y18, Y32 VII Y22, Y34, ) ) ) Pink yellow B Y38, Y40, Y41, Y42, Y48, Y51, Y57, Y60 VIII Y27, Y29, ) + + Cream B Y35, Y47, Y52 IX Y ) ) ) Pink B X Y ) + ) Cream Ar XI Y31, Y49, ) ) ) Cream B Y58, Y XII Y1, Y ) ) ) Cream B XIII Y ) ) ) Pink Ba Abbreviations: AP: size of the amplified PCR product; U: urease activity; G F: glucose fermentation; I A: inositol assimilation; S P: starch production; C: colony color; R: observed reproduction mode; B: budding; Ba: ballistoconidia; H-As: hat-shaped ascospores; Ar: arthroconidia.

4 748 M. Villa-Carvajal et al. / FEMS Yeast Research 4 (2004) Table 2 Identification of cork isolates according to ITS-5.8S RFLPs and 26S rrna gene D1/D2 region sequences Group Species GenBank D1/D2 26S rdna a GenBank D1/D2 26S rdna b I Rhodosporidium kratochvilovae Y2: AY % to AF Y21: AY II Debaryomyces hansenii var. fabryi Y3: AY % to U94927 III Rhodotorula slooffiae Y5: AY % to AF IV Sporidiobolus salmonicolor Y6: AY % to AF Y9: AY V Sporidiobolus johnsonii Y7: AY % to AF Y8: AY VI Pichia anomala Y13: AY % to U74592 VII Rhodotorula nothofagi Y22: AY % to AF VIII Cryptococcus albidus Y52: AY % to AF IX Rhodotorula mucilaginosa Y28: AY % to AF X Trichosporon mucoides Y50: AY % to AF XI Rhodotorula sp. new species Y31: AY XII Bullera sp. new species Y1: AY % to AF Y55: AY XIII Sporobolomyces nylandii Y4: AY % to AF a Names of sequenced isolates and corresponding GenBank accession numbers. b Listed values refer to the percentages of sequence similarity after Blast analysis. senting the different ITS-5.8S rdna RFLP groups for sequencing of the D1/D2 region within the 26S rrna gene. Over the last 5 years, a large amount of information on yeast D1/D2 26S rdna sequences has accumulated [9 11,20]. This collection is growing steadily since the majority of authors describing new species are sequencing the D1/D2 26S rrna gene region and deposit the new sequences in public databases. This large database has inestimable value for identification purposes since it can be used for comparison against the sequence of any known or unknown yeast. Results of the comparison of the D1/D2 26S rrna gene sequences of our yeast isolates against the Gen- Bank database, using the BLASTN tool, are presented in Table 2. Two groups pertained to the ascomycetous yeasts. Group II, containing isolate Y3, was identified as Debaryomyces hansenii var. fabryii. D. hansenii var. fabryii can be differentiated from the other variety, D. hansenii var. hansenii, only by two nucleotide substitutions in the 26S sequence, and the ability of the former to grow between 36 and 39 C [21]. The Y3 cork isolate was able to grow at 37 C. The majority of strains of D. hansenii var. fabryii have been isolated from human skin and fermented products, but no strains have been isolated from trees or cork [21]. After sequencing of the isolate Y13, the isolates in group VI were identified as Pichia anomala, which is in agreement with the presence of hat-shaped ascospores. Isolates of the species P. anomala have been recovered from gums and exudates of trees [22]. The remaining 11 groups were placed in the basidiomycetous yeasts. Group I included sixteen yeast isolates pertaining to the species Rhodosporidium kratochvilovae. The two isolates (Y2 and Y21) sequenced yielded identical D1/ D2 26S rdna sequences, which were almost identical to the already known sequences of other strains within this species (Table 2). The species R. kratochvilovae has been studied in detail by Sampaio et al. [23]. They analysed seventeen strains for their sexuality, phenotype, PCR fingerprinting, isoenzyme analysis and rdna sequence analysis, and concluded that the species R. kratochvilovae included homothallic and heterothallic strains. However, no nucleotide differences in both D1/D2 26S rdna and ITS-5.8S rdna sequences could be found irrespective of the different types of sexuality. The analysis by Scorzetti et al. [10] of some of the strains studied in Sampaio et al. [23] yielded similar results, but a unique nucleotide difference was found in one ITS sequence. The strains deposited in the CBS (Centraalbureau voor Schimmelcultures, Utrecht, The Netherlands) came from unknown sources, but the 13 strains in Sampaio et al. [23] deposited in the PYCC (Portuguese Yeast Culture Collection, Caparica, Portugal) were isolated from diverse sources, and the majority of them from plant material. Groups III, VII and IX represented three different species of the genus Rhodotorula. Group III contained two isolates (Y5 and Y14) of the species Rh. slooffiae. Group VII included ten isolates, which were identified as R. nothofagi based on sequence analysis of the D1/D2 26S rdna region of isolate Y22. Finally, group X had only one isolate, Y50, which was identified as Rh. mucilaginosa. Fell et al. [9] and Scorzetti et al. [10] observed none or one nucleotide difference in the D1/D2 26S rdna and ITS sequences among five strains of Rh. slooffiae, and between two strains of Rh. nothofagi. Additionally, they observed three nucleotide substitutions in the ITS region among fifteen strains of Rh.

5 M. Villa-Carvajal et al. / FEMS Yeast Research 4 (2004) mucilaginosa. Strains of Rh. slooffiae have been isolated from human sources (CBS database), while strains of Rh. nothofagi have been reported only from decayed wood. On the other hand, Rh. mucilaginosa has been found in a variety of substrates [24]. Groups IV and V represented two species in the genus Sporidiobolus. The isolates in these groups produced ballistoconidia as asexual form of reproduction. Isolates Y6 and Y9 were identified as S. salmonicolor while isolates Y7 and Y8 were identified as S. johnsonii. The D1/D2 26S rdna sequence alignment (data not shown) of these two species yielded a difference of seven (1%) nucleotide substitutions. The alignment of ITS- 5.8S rdna sequences (data not shown) showed more than 4% nucleotide differences. Significant differences were observed in the ITS-5.8S rdna RFLPs, which constituted a more reliable tool for identification of strains in these two species. Strains from both species have been isolated from plant material, although not from cork [25]. The five starch-producing isolates in group VIII were identified as Cryptococcus albidus based on sequence analysis of the D1/D2 26S rdna region of isolate Y52. Strains representing this species have been found in fermented products like wine or sake, air, water, leaves and human sources [26]. Group X contained the sole yeast isolate Y50 that produced arthroconidia. This strain showed an identical D1/D2 26S rdna region sequence to that of the type strain of the species Trichosporon mucoides. Strains of this species have been recovered almost exclusively from human origins [27]. Group XIII, represented by isolate Y4, was identified as Sporobolomyces nylandii. Strains of this species have been isolated almost exclusively in Thailand from leaves of Oryza sativa, Saccharum spontaneum and Phragmites karka [28]. Group XII included isolates Y1 and Y55. These isolates showed identical D1/D2 26S rdna sequences. This sequence did not correspond to any described species, but was identical to the sequence of Cryptococcus sp. strain CBS 8507 which, according to Scorzetti et al. [10], clustered with Bullera dendrophila, and may constitute a new species in a new genus (J.W. Fell, pers. comm.). Isolates Y31, Y49, Y58 and Y61 constituted group XI. The D1/D2 26S rdna sequence of strain Y31 could not be ascribed to a known species sequence. BLAST analysis yielded the highest similarity value, 95%, with three strains of Rhodotorula sp. CBS 8445, CBS 8446, and CBS 8447, and the species Rhodotorula philyla and Colacogloea peniophorae. Scorzetti et al. [10] placed these species in a tight cluster (96% bootstrap) in the Microbotryum lineage. Formal description of this species will require a standard phenotypic characterization, which is not part of this study. Following the identification of the isolates, the ITS- 5.8S rdna sequences of the species present in GenBank were analysed using the DNAMAN programme. Cleavage sites for CfoI, HaeIII and HinfI were located and sequence fragments generated. The size of these fragments was always in accordance with the size of the fragments obtained by enzymatic restriction of the nonpurified PCR product of the ITS-5.8S rdna from our cork isolates. Identification of the isolates based solely on RFLPs of the ITS-5.8S rdna by comparison against data from other authors was not always possible. This technique has been used with success for the identification of ascomycetous yeasts isolated from food products. However, not sufficient information is available to identify all basidiomycetous yeasts isolated in this study by this method [29 31]. One objective of this study was the identification of yeasts present on bark of cork oak during the manufacturing process of wine cork stoppers. Of special importance was the isolation of Pichia anomala and Cryptococcus albidus since both species have been isolated from wine, although their role as possible contaminants in bottled wine has not been studied. Groups represented by a large number of isolates were identified as species that are common on wood, trees and in soil or air. On the other hand, some of the groups present with few isolates corresponded to species commonly isolated from human sources. The first steps of the manufacturing process of cork stoppers involve the manual labour of human workers. A possible origin of these few isolates may therefore be attributed to human sources. However, there is not yet enough evidence to confirm this hypothesis. Acknowledgements The authors are indebted to Prof. Federico Uruburu for his support during the realization of this work. Unfortunately, Prof. Uruburu passed away during the course of the review of this manuscript. References [1] Fischer, C. and Fischer, U. (1997) Analysis of cork taint in wine and cork material at olfactory subthreshold level by solid phase microextraction. J. Agric. Food Chem. 45, [2] Preston, W.A. (1983) Cork and Wine. Illuminations Press, St. Helena, CA, USA. [3] Silva Pereira, C., Figueiredo Marques, J.J. and San Romao, M.V. (2000) Cork taint in wine: scientific knowledge and public perception a critical review. Crit. Rev. Microbiol. 26, [4] Daly, N.M., Lee, T.H. and Fleet, G.H. (1984) Growth of fungi on wine corks and its contribution to corky taints in wine. Food Technol. Aust. 36,

6 750 M. Villa-Carvajal et al. / FEMS Yeast Research 4 (2004) [5] Bureau, G., Charpentier-Massonnat, M. and Pansu, M. (1974) Etude des go^uts anormaux apportes par le bouchon sur le vin de Champagne. Rev. Fr. dõenologie 56, [6] Danesh, P., Velez Caldas, F.M., Figueiredo Marques, J.J. and San Romao, M.V. (1997) Mycobiota in Portuguese normal and green cork throughout the manufacturing process of stoppers. J. Appl. Microbiol. 82, [7] Lee, T.H. and Simpson, R.F. (1993) Microbiology and chemistry of cork taints in wine. In: Wine Microbiology and Biotechnology (Fleet, G.H., Ed.), pp Harwood Academic Publishers, Chur, Switzerland. [8] Alvarez-Rodrıguez, M.-L., Belloch, C., Villa, M., Uruburu, F., Larriba, G. and Juan-Jose, R.C. (2003) Degradation of vanillic acid and production of guaiacol by microorganisms isolated from cork samples. FEMS Microbiol. Lett. 220, [9] Fell, J.W., Boekhout, T., Fonseca, A., Scorzetti, G. and Statzell- Tallman, A. (2000) Biodiversity and systematics of basidiomycetous yeasts as determined by large-subunit rdna D1/D2 domain sequence analysis. Int. J. Syst. Evol. Microbiol. 20, [10] Scorzetti, G., Fell, J.W., Fonseca, A. and Statzell-Tallman, A. (2002) Systematics of basidiomycetous yeasts: a comparison of large-subunit D1/D2 and internal transcribed spacer rdna regions. FEMS Yeast Res. 2, [11] Kurtzman, C. and Robnett, C. (2003) Phylogenetic relationships among yeasts of the Saccharomyces complex determined from multigene sequence analysis. FEMS Yeast Res. 3, [12] Arias, R.C., Burns, J.K., Friedrich, L.M., Goodrich, R.M. and Parish, M.E. (2002) Yeast species associated with orange juice: evaluation of different identification methods. Appl. Environ. Microbiol. 68, [13] Guillamon, J.M., Sabate, J., Barrio, E., Cano, J. and Querol, A. (1998) Rapid identification of wine yeast species based on the RFLP analysis of the ribosomal internal transcribed spacer (ITS) region. Arch. Microbiol. 169, [14] Caggia, C., Restuccia, C., Pulvirenti, A. and Giudici, P. (2001) Identification of Pichia anomala isolated from yoghurt by RFLP of the ITS region. Int. J. Food Microbiol. 4, [15] Deak, T., Chen, J. and Beuchat, L.R. (2000) Molecular characterization of Yarrowia lipolytica and Candida zeylanoides isolated from poultry. Appl. Environ. Microbiol. 66, [16] Pramateftaki, P.V., Lanaridis, P. and Typas, M.A. (2000) Molecular identification of wine yeasts at species or strain level: a case study with strains from two vine-growing areas of Greece. J. Appl. Microbiol. 89, [17] Alvarez-Rodrıguez, M.-L., Lopez-Oca~na, L., Lopez-Coronado, J.M., Rodriguez, E., Martinez, M.J., Larriba, G. and Juan-Jose, R.C. (2002) Cork taint of wines: Role of the filamentous fungi isolated from cork in the formation of 2,4,6-trichloroanisole by O- methylation of 2,4,6-trichlorophenol. Appl. Environ. Microbiol. 68, [18] Yarrow, D. (1998) Methods for the isolation, maintenance and identification of yeasts. In: The Yeasts A Taxonomic Study (Kurtzman, C. and Fell, J.W., Eds.), 4th ed, pp Elsevier, Amsterdam. [19] Kurtzman, C.P. and Fell, J.W. (1998) Definition, classification and nomenclature of the yeasts. In: The Yeasts A Taxonomic Study (Kurtzman, C.P. and Fell, J.W., Eds.), 4th ed, pp Elsevier, Amsterdam. [20] Kurtzman, C.P. and Robnett, C.J. (1998) Identification and phylogeny of ascomycetous yeasts from analysis of nuclear largesubunit (26S) ribosomal DNA partial sequences. Antonie van Leeuwenhoek 73, [21] Nakase, T., Suzuki, M., Phaff, H.J. and Kurtzman, C.P. (1998) Debaryomyces. In: The Yeasts A Taxonomic Study (Kurtzman, C.P. and Fell, J.W., Eds.), 4th ed, pp Elsevier, Amsterdam. [22] Kurtzman, C.P. (1998) Pichia. In: The Yeasts A Taxonomic Study (Kurtzman, C.P. and Fell, J.W., Eds.), 4th ed, pp Elsevier, Amsterdam, The Netherlands. [23] Sampaio, J.P., Gadanho, M., Santos, S., Duarte, F.L., Pais, C., Fonseca, A. and Fell, J.W. (2001) Polyphasic taxonomy of the basidiomycetous yeast genus Rhodosporidium: Rhodosporidium kratochvilovae and related anamorphic species. Int. J. Syst. Evol. Microbiol. 51, [24] Fell, J.W. and Statzell-Tallman, A. (1998) Rhodotorula. In: The Yeasts A Taxonomic Study (Kurtzman, C.P. and Fell, J.W., Eds.), 4th ed, pp Elsevier, Amsterdam. [25] Statzell-Tallman, A. and Fell, J.W. (1998) Sporidiobolus. In: The Yeasts A Taxonomic Study (Kurtzman, C.P. and Fell, J.W., Eds.), 4th ed, pp Elsevier, Amsterdam. [26] Fell, J.W. and Statzell-Tallman, A. (1998) Cryptococcus. In: The Yeasts A Taxonomic Study (Kurtzman, C.P. and Fell, J.W., Eds.), 4th ed, pp Elsevier, Amsterdam. [27] Gueho, E., Smith, M.Th. and de Hoog, G.S. (1998) Trichosporon. In: The Yeasts A Taxonomic Study (Kurtzman, C.P. and Fell, J.W., Eds.), 4th ed, pp Elsevier, Amsterdam. [28] Takashima, M. and Nakase, T. (2000) Four new species of the genus Sporobolomyces isolated from leaves in Thailand. Mycoscience 41, [29] Esteve-Zarzoso, B., Belloch, C., Uruburu, F. and Querol, A. (1999) Identification of yeasts by RFLP analysis of the 5.8S rrna gene and the two ribosomal internal transcribed spacers. Int. J. Syst. Bacteriol. 49, [30] Fernandez-Espinar, M.T., Esteve-Zarzoso, B., Querol, A. and Barrio, E. (2000) RFLP analysis of the ribosomal internal transcribed spacer and the5.8s rrna gene region of the genus Saccharomyces: a fast method for species identification and the differentiation of flor yeasts. Antonie van Leeuwenhoek 78, [31] Esteve-Zarzoso, B., Peris-Toran, M.J., Ramon, D. and Querol, A. (2001) Molecular characterisation of Hanseniaspora species. Antonie van Leeuwenhoek 80,