Supplemental Information

Transcription

1 Supplemental Information Table S1. Primers Used in this Study Vector Primer ID Sequence a ACS-2 GFP ACS-3 GFP ACS-4 GFP ACS-6 GFP RF NCU03929 Fwd RF NCU03929 Rev RF NCU04380 Fwd RF NCU04380 Rev RF NCU00608 Fwd RF NCU00608 Rev RF NCU06032 Fwd RF NCU06032 Rev TCACAGAAATCAAAGCGGCCGCATGGCGAACACAGGGCCC ACAGCTCCTCGCCCTTGCTCACTTTCCCATCAAGACAATCCGA TCACAGAAATCAAAGCGGCCGCATGGTCATCCCAACGTTGA ACAGCTCCTCGCCCTTGCTCACCTGCTTGGGGCCATAAGC TCACAGAAATCAAAGCGGCCGCATGCTCTGCCGACCTCGG ACAGCTCCTCGCCCTTGCTCACGCCCTTGTTCTCCGCAAT TCACAGAAATCAAAGCGGCCGCATGGCTTCAAGTAAGTTCAGATCC ACAGCTCCTCGCCCTTGCTCACAAGCTTCACATTACCTGCATTAAGC - Geno csr1 Fwd CCGCGGTAGTCGTTGTTGGAAG - Geno csr1 Rev GTACATCAAGGCGAACCTACGTCC - Geno NCU 'Flank CACACGTACTGTTCTCAACC - Geno NCU 'Flank CTACTACTGCTCATGCCAGG - Geno NCU 'Flank GGAGGAAGAAGAAGAGAAGG - Geno NCU 'Flank GTGTCACTTCCCTTGATACC - hygr CTATGCATCAAGCTTGGTAC a Underlined nuclotides are sequence complementary to the vector Table S2. Protein Identifiers for Fungal ACSs Identified in this Study Protein Identifier Organism Tree Designation (Accession Number, JGI Protein ID, or Broad ID Number) Aspergillus nidulans AN0609 XP_ Aspergillus nidulans AN4397_fatD XP_ Aspergillus nidulans AN4659 XP_ Aspergillus nidulans AN5192_fatA XP_ Aspergillus nidulans AN5272 XP_ Aspergillus nidulans AN5877_fatB XP_ Aspergillus nidulans AN6014_faaA XP_ Aspergillus nidulans AN6649_fatC XP_ Aspergillus nidulans AN8280_faaB XP_ Botryotinia fuckeliana BC1G_01108 XP_ Botryotinia fuckeliana BC1G_05285 XP_ Botryotinia fuckeliana BC1G_07013 XP_ Botryotinia fuckeliana BC1G_07557 XP_ Botryotinia fuckeliana BC1G_09986 XP_ Botryotinia fuckeliana BC1G_10629 XP_ Botryotinia fuckeliana BC1G_13246 XP_ Botryotinia fuckeliana BC1G_14541 XP_ Candida albicans CAL XP_ Candida albicans CAL XP_ Candida albicans CAL XP_ Candida albicans CAL XP_ Candida albicans CAL XP_ Candida albicans CAL XP_ Coccidioides immitis CIMG_01434 EAS36200

2 Coccidioides immitis CIMG_03350 EAS32445 Coccidioides immitis CIMG_04118 EAS33304 Coccidioides immitis CIMG_07552 EAS29100 Coccidioides immitis CIMG_07819 EAS29383 Coccidioides immitis CIMG_10134 EAS27221 Coccidioides immitis CIMG_11724 EAS31087 Coccidioides immitis CIMG_12069 EAS29597 Cochliobolus heterostrophus CocheC5_ Cochliobolus heterostrophus CocheC5_ Cochliobolus heterostrophus CocheC5_ Cochliobolus heterostrophus CocheC5_ Cochliobolus heterostrophus CocheC5_ Cochliobolus heterostrophus CocheC5_ Cochliobolus heterostrophus CocheC5_ Cochliobolus heterostrophus CocheC5_ Cochliobolus heterostrophus CocheC5_ Cochliobolus heterostrophus CocheC5_ Fusarium graminearum FGSG_01419 FGSG_01419 Fusarium graminearum FGSG_03363 FGSG_03363 Fusarium graminearum FGSG_04333 FGSG_04333 Fusarium graminearum FGSG_06462 FGSG_06462 Fusarium graminearum FGSG_07539 FGSG_07539 Fusarium graminearum FGSG_08543 FGSG_08543 Fusarium graminearum FGSG_09424 FGSG_09424 Fusarium graminearum FGSG_10362 FGSG_10362 Botryotinia fuckeliana gi XP_ Cryptococcus neoformans gi XP_ Cryptococcus neoformans gi XP_ Cryptococcus neoformans gi XP_ Magnaporthe grisea MGG_01551 EHA54718 Magnaporthe grisea MGG_02862 EHA46131 Magnaporthe grisea MGG_04956 EHA5264 Magnaporthe grisea MGG_05025 EHA52724 Magnaporthe grisea MGG_06199 EHA52279 Magnaporthe grisea MGG_07197 EHA55599 Magnaporthe grisea MGG_08257 EHA56022 Magnaporthe grisea MGG_08288 EHA55987 Neurospora crassa NCU00608 XP_ Neurospora crassa NCU01654 XP_ Neurospora crassa NCU03929 XP_ Neurospora crassa NCU04380 XP_ Neurospora crassa NCU06032 XP_ Neurospora crassa NCU06063 XP_ Neurospora crassa NCU06836 XP_ Neurospora crassa NCU08935 XP_ Puccinia graminis PGTT_ ^ Puccinia graminis PGTT_ ^

3 Puccinia graminis PGTT_ ^ Phanerochaete chrysosporium Phchr * Phanerochaete chrysosporium Phchr * Phanerochaete chrysosporium Phchr * Phanerochaete chrysosporium Phchr * Phanerochaete chrysosporium Phchr * Phanerochaete chrysosporium Phchr * Rhizopus oryzae RO3G_01463 EIE76759 Rhizopus oryzae RO3G_02096 EIE77392 Rhizopus oryzae RO3G_02325 EIE77621 Rhizopus oryzae RO3G_04608 EIE79903 Rhizopus oryzae RO3G_05368 EIE80663 Rhizopus oryzae RO3G_05462 EIE80757 Rhizopus oryzae RO3G_09111 EIE84401 Rhizopus oryzae RO3G_11794 EIE87083 Rhizopus oryzae RO3G_14338 EIE89627 Rhizopus oryzae RO3G_14417 EIE89706 Rhizopus oryzae RO3G_15980 EIE91269 Saccharomyces cerevisiae Sc_Faa1p NP_ Saccharomyces cerevisiae Sc_Faa2p NP_ Saccharomyces cerevisiae Sc_Faa3p NP_ Saccharomyces cerevisiae Sc_Faa4p NP_ Saccharomyces cerevisiae Sc_Fat1p NP_ Saccharomyces cerevisiae Sc_Fat2p NP_ ^ *

4 Figure S1. Biomass accumulation of Δacs-5 single mutant in VM supplemented with 1.5mM FeSO 4 and refreshed spent VM. Prolonged lag phenotype of Δacs-5 is recovered in the iron-replete (1.5mM FeSO 4 ) medium and refreshed spent medium containing secreted coprogen.

5 Figure S2. Growth of single and double ACS deletion strains on even chain number, saturated fatty acids as the sole carbon source. Fatty acids are provided to VM at a concentration of 25mM of carbon. 1% Tergitol NP-40 is used to disperse the fatty acid.

6 Figure S3. Growth of single acs deletion strains on even chain number, saturated fatty acids and lactose. Fatty acids are provided to VM/0.5% lactose at a concentration of 25mM of carbon. 1% Tergitol NP-40 is used to disperse the fatty acid.

7 Figure S4. Growth of single acs deletion strains on even chain number, saturated fatty acids and lactose in the presence of fatty acid biosynthesis inhibitor cerulenin. Fatty acids are provided to VM/0.5% lactose at a concentration of 25mM of carbon. 1% Tergitol NP-40 is used to disperse the fatty acid. Working concentration of cerulenin is 10μg/mL.

8 Figure S5. Phenotypical complementation of Δacs-3 and Δacs-5 strains with respective GFP gene fusion strains. (A) Biomass accumulation (B) FAME analysis. Figure S6. Phenotypic analysis of N. crassa Δacs-3 and Δacs-5 strains with FA supplemented medium. (A) Biomass accumulation of submerged liquid culture growth in VM/2% TWEEN 80. (B) GC-FID quantification of fatty acid methyl esters derived from total lipids over growth time course in VM/2% TWEEN 80. Lipid was quantified per mg of lyophilized biomass. All values are representative of triplicate biological samples. Error bars indicate standard deviations.