Regular Article. Chromosome analysis of tea plant (Camellia sinensis) and ornamental camellia (Camellia japonica) Abstract.

Transcription

1 Chromosome Science 20: 9-15, 2017 Furukawa et al. 9 Regular Article Chromosome analysis of tea plant (Camellia sinensis) and ornamental camellia (Camellia japonica) Kazumi Furukawa, Shohei Sugiyama, Tomoya Ohta and Nobuko Ohmido Received: April 30,2017 / Accepted: January 22, by the Society of Chromosome Research Abstract Chromosome analysis of tea plant (Camellia sinensis), an important commercial crop used to prepare beverages throughout the world, was conducted using fluorescence in situ hybridization (FISH) and chromosome image analyzing system IV (CHIAS IV) software. Chromosomes of C. japonica, a popular woody plant used as an ornamental tree and an important breeding resource for tea plants, were used for comparison with C. sinensis. Both C. sinensis and C. japonica comprised 30 chromosomes. The 5S rdna, a fundamental repeat sequence and a landmark for FISH, was used for Camellia karyotyping. We observed one 5S rdna locus on two chromosomes in both the species and confirmed the presence of bivalents in the meiotic cells of interspecific hybrids between C. japonica and C. sinensis. These results suggest that the two species have homoeologous chromosomes. C. sinensis chromosomes were analyzed using CHIAS IV, which performs quantitative karyotyping. This is the first report on the karyotyping of the Japanese tea plant C. sinensis by FISH and quantitative image analysis using CHIAS IV. This report will accelerate the use of cytological and genetic linkage map analysis in tea breeding. Keywords: Camellia sinensis, Camellia japonica, Camellia sasanqua, 5S rdna, fluorescence in situ hybridization Kazumi Furukawa (*) National Institute of Technology, Numazu College, Ooka 3600, Numazu, Shizuoka , Japan furukawa@numazu-ct.ac.jp Tel: Shohei Sugiyama Faculty of Agriculture, Kobe University, Japan Tomoya Ohta Toyohashi University of Technology, Japan Nobuko Ohmido Graduate School of Human Development and Environment, Kobe University, Kobe , Japan Introduction The tea plant (Camellia sinensis) is a perennial woody plant and its leaves are used for the production of both green and black tea throughout the world. It has a chromosome number of 2n = 30 (Ackerman, 1971; Kato and Shimura, 1971; Zhou et al., 1991, 1992; Liu and Gu, 2009) and a 4-Gbp genome size (Tanaka et al., 2006). The region of origin of C. sinensis is considered to be the southern part of China or southeastern Asia. C. sinensis flowers from September to November. A related species of C. sinensis is the ornamental camellia C. japonica, which is an important horticultural plant. Moreover, its chromosome size and genome size are the same as that of C. sinensis (Tanaka et al., 2006). The northern limit of camellia in Japan is Aomori prefecture (40 N), where it flowers from January to April. Camellia species show similar plant morphology such as similar shape of leaves and flowers (Fig. 1). Ornamental camellia is considered to be a breeding resource for tea plants, because it does not contain the tea metabolite caffeine and is cold tolerant. Some interspecific hybrids or crosses between C. sinensis and C. japonica have been generated to introduce certain favorable traits into tea plant (Bezbaruah and Gogoi, 1972; Kato and Shimura, 1978; Takeda et al., 1987). The flowering time of the two species is different, but overlaps slightly. Artificial pollination yielded low seed production, with only one plant being produced from 11 fruits of 226 pollinated flowers (Kato and Shimura, 1978). Additionally, Camellia requires one year for seed maturation. Although there are some difficulties in growing interspecific hybrids, their existence suggests that these species might have genome-level compatibility. Hence, C. japonica and its interspecific hybrids are expected to be a good genetic resource for tea plants (Fig. 1C). However, Kato and Shimura (1978) observed univalent chromosomes at meiosis I in a hybrid between C. japonica and C. sinensis. For efficient hybridization, chromosome behavior of the hybrids during meiosis, such as the association of the hybrid, should be clarified and observed distinctly from the original genome. This information would assist in understanding the hybrid production in future backcrosses. Thus, individual chromosome identification or/and discrimination is necessary for the investigation of breeding potential of tea plants. Orthodox karyotyping of Camellia has been conducted in a morphological study, based on the squash technique with aceto-orcein or aceto-carmine staining (Ackerman, 1971; Kato and Shimura, 1971; Zhou et al., 1991, 1992;

2 10 Karyotyping of tea plant and ornamental Camellia Rout et al., 1998). The results showed a chromosome ideogram in which the chromosome morphological traits were less diverse in Camellia, based on the chromosome length and arm ratio at the metaphase stage of mitosis. Our study aimed to establish the karyotype of the tea plant in order to define the homologous chromosome pairs, based not only on the morphology but also on the DNA sequence information, so that the chromosome can be characterized according to the particular genes. Discrimination of individual plant chromosomes by fluorescence in situ hybridization (FISH) using DNA sequence markers in genome research is useful because it shows the sequence-based information (Schwarzacher and Heslop-Harrison, 2000; Ohmido et al,. 2010). Karyotyping by FISH has been reported in many plant species, such as wheat, rye, Brassica, cucumber, and kudzu (Schwarzacher and Heslop-Harrison, 2000; Zhang et al., 2012; Ohmido et al., 2013). Some FISH experiments have been conducted previously in Camellia species (Vijayan et al. 2012, Xu et al. 2015). Vijayan et al. (2012) reported that six signals of 45S rdna were detected in individual chromosomes in both C. sinensis and C. japonica. Liu and Gu (2009) applied genomic in situ hybridization using the total C. japonica DNA probe to detect the species of origin of polyploid C. reticulata, thereby successfully characterizing the chromosomes. Heitkam et al. (2015) reported two signals in the chromosome of the oldest European ornamental camellia using a 5S rdna probe. Therefore, we attempted to use 5S rdna of tea plants for FISH and quantitatively analyzed the characteristics of individual chromosomes using chromosome image analyzing system IV (CHIAS IV), an imaging tool associated with Image J software ( for the investigation of chromosomes by determining the condensation patterns and measuring the relative length quantitatively. In several previous chromosome analysis studies, CHIAS software was employed to determine the condensation patterns of chromosomes (Fukui and Iijima, 1991; Iijima et al., 1991; Ito et al., 2000, Akasaka et al., 2002, 2003; Sato et al., 2007). CHIAS III was used to create ideograms based on the condensation patterns of Giemsa-stained chromosomes of spinach (Ito et al. 2000), wild rose species (Akasaka et al., 2002, 2003), and Japanese cucumber (Sato et al., 2007). The ideograms were displayed as black, gray, and white bars, which represented heavy, intermediate, and lightly condensed chromatin regions, respectively. Kato et al., (2009) developed CHIAS IV through the improvements of CHIAS I, II, and III to enable the quantitative measurement of the condensation patterns in the fluorescence images. As a recent application of CHIAS IV, quantitative chromosomal analysis and mapping of 45S and 5S rdna have been performed in Pueraria lobata using CHIAS IV (Ohmido et al., 2013). This report presents the chromosome characteristics determined using CHIAS IV system and the detection of chromosomes by mapping 5S rdna in the tea plant and ornamental camellias. Figure 1. Morphology of the leaves and flowers of three Camellia species. (A) Camellia sinensis var. sinensis cultivar Sayamakaori, (B) C. japonica cultivar, (C) Interspecific hybrid cultivar Robiraki between C. japonica C. sinensis. Materials and Methods Plant materials A green tea cultivar (Camellia sinensis var. sinensis Sayamakaori ), several ornamental camellias (C. japonica), and an ornamental C. sasanqua cultivar (C. sasanqua) were used in this study. The tea cultivar and some of the ornamental camellias were grown in a greenhouse at the National Institute of Technology, Numazu College in Numazu city. Other camellias and the sasanqua camellia were collected from the botanical research garden of the New Technology Development Foundation in Atami city. Chromosome preparation Root tips of plants derived from cuttings were used as mitotic chromosome samples. Cuttings were collected from April to July, and short branches with two leaves were planted in wet granular soil. After two months, fresh root tips were sampled and soaked in ice water at around 0 C for 24 h as a pretreatment, and then transferred to a fixative solution (ethanol: acetic acid = 3:1). For chromosome preparation, the fixed root tips were rinsed in citric acid buffer and treated with an enzyme mixture containing 0.5% (w/v) pectolyase Y-23 (Kyowa Chemical Products Co., Ltd., Osaka, Japan) and 0.2% (w/v) cellulase Onozuka RS (Yakult Honsha Co., Ltd., Tokyo, Japan). These enzymes were dis-

3 Furukawa et al. 11 solved in citric acid buffer composed of 40 mm citric acid and 60 mm trisodium citrate. For meiotic chromosome samples, pollen mother cells were collected from immature buds (7 mm in diameter) and immersed in the fixative. Mitotic cells were squeezed out of the root tips after cutting off the root cap under a stereomicroscope. The cells in one drop of 45% acetic acid were squashed with a coverslip. Then, the coverslip was frozen on dry ice and removed by forceps and used for FISH experiments. DNA probes A 5S rdna probe of C. sinensis was labeled by nick translation using the PCR products amplified from 5S rdna sequence, with the accession number AY PCR was performed using the primer pair 5' tttagtgctggtatgatcgc 3' and 5' tgggaagtcctcgtgt 3', based on the 5S rdna sequence of C. sinensis (516 bp). The PCR products were separated on agarose gels as a wide smear, and then, the probe size was decreased to less than 400 bp using a nick translation mix (Roche Diagnostics GmbH, Mannheim, Germany). The probe was labeled by conjugation with Cy3-dUTP (GE Healthcare UK Ltd., Buckinghamshire, England) or digoxigenin-11-dutp (Roche Diagnostics GmbH, Mannheim, Germany). Digoxigenin was detected by an anti-digoxigenin FITC Fab fragment (Roche Diagnostics GmbH, Mannheim, Germany), following the methods of Schwarzacher and Heslop-Harrison (2000). FISH FISH was performed using the 5S rdna probe according to the method of Schwarzacher and Heslop-Harrison (2000). Chromosomes, which were spread on the slides, were denatured in 0.2 M NaOH and 70% ethanol for 5 min at around 20 C in the room temperature as described by Ishii et al. (2000), and then dehydrated using ethanol series. The probe mixture was denatured at 80 C for 10 min in a hybridization mixture containing 1 µl probe, 50% (v/ v) formamide, 10% (w/v) dextran sulfate, and 2X SSC, and then transferred immediately to ice. A 70-µL aliquot of the mixture was dropped onto a slide and covered with a coverslip. The coverslip was sealed with a PCR film. The slides were incubated in a humidified container at 37 C for 16 to 24 h for hybridization. The DNA was stained with DAPI (1 μg/ml) in Vectashield (Vector Laboratories) after posthybridization washing with SSC and 0.1X SSC. Quantitative karyotype analysis using CHIAS IV The probe signals on the chromosomes were detected under a fluorescence microscope (BX53; Olympus, Japan) and captured by a digital color camera (DP73; Olympus, Japan). CHIAS IV software ( ac.jp/~ohmido/index03.htm) was used to measure the condensation pattern and the length of each chromosome, and to construct an ideogram of the chromosome types. The arm ratio was calculated as the length of the long arm divided by the length of the short arm (Leven et al., 1964). Results and Discussion Karyotyping using CHIAS IV Adventitious roots were produced from the cuttings through June to July, and a higher mitotic index was obtained with rapidly increasing daily temperature. We observed that Camellia somatic chromosome spreads from the root tips, and hence used FISH to investigate 5S rdna loci (Fig. 2). The chromosome number was 2n = 30 in both C. sinensis and C. japonica (Fig. 2A and 2D). The chromosome number of the sasanqua camellia planted at the botanical research garden was 105 (Fig. 2G). Ackerman (1971) reported that the basic number of chromosomes could be 15 in Camellia and some sasanqua contain 90 chromosomes. Our observation suggested that this sasanqua might be a heptaploid (7X = 105). Liu and Gu (2012) have reported that some C. japonica exhibited polyploidy; for example, diploid, tetraploid, and hexaploid types. Our study also indicated polyploidy in case of C. sasanqua. Chromosome morphology data of C. sinensis were analyzed using CHIAS IV. The relative chromosome length was measured and the characteristics and density of DNA stained by DAPI, as well as the condensation pattern of six well-separated chromosome plates were obtained using CHIAS IV. Table 1 shows the mean value of the relative chromosome lengths with standard error (SE) in order. The relative length of C. sinensis Sayamakaori ranged from 2.34 to 4.46 (Table 1), similar to that reported previously for C. sinensis Yabukita (Zhou et al. 1992). Because the tea cultivar Sayamakaori is a seedling of Yabukita, both could have similar karyotypes. Table 1. The relative length of all 30 chromosomes of tea plant SAYAMAKAORI (Camellia sinensis var. sinensis) Chromosome No. Relative length a) (%) Arm ratio b) Chromosome type d) Mean S.E. c) sm m m m sm sm sm sm sm sm sm sm sm m sm sm sm sm sm sm m m sm sm sm m m m m m a) Relative chromosome length is % of total chromosome b) Long arm length / short arm length c) Standard error d) Levan et al. (1964)

4 12 Karyotyping of tea plant and ornamental Camellia Figure 2. FISH images of 5S rdna of the mitotic chromosomes of Camellia species. (A-C) Camellia sinensis Sayamakaori (2n = 30), (D-F) C. japonica garden variety (2n = 30), (G-I) C. sasanqua (7X = 105). A, D, and G show chromosome images stained with DAPI. B, E and H show fluorescent signals of hybridized 5S rdna; and C, F and I show the merged images. Arrowheads indicate 5S rdna signals. (C, F) Bar = 5 μm; (I) Bar = 10 μm. The arm ratios of the smallest chromosomes were stable, with the S.E. around 0.02 to 0.04 (Table 1). Figure 3 shows a representative chromosome ideogram of C. sinensis in the relative length order. The smallest chromosomes were distinguished morphologically only and could be homologous chromosomes. The biggest chromosomes was also discriminated by size; however, several midsized chromosomes appeared to be metacentric or submetacentric (Table 1) based on the classification of Levan et al. (1964). While there was no significant difference in their size or arm ratio (Table 1), the condensation patterns determined by CHIAS IV was tried to find the differentiation of most chromosome pairs (Fig. 3). Regarding the chromosome classification of C. sinensis by Ackerman (1971), 2 pairs were classified as median, 5 pairs were submedian, and 8 pairs were subterminal. Kato et al. (1971) and Zhou et al. (1991, 1992) reported the presence of satellite chromosomes in C. sinensis. They treated the root tips in 8-hydroxyquinoline and stained using Schiff s solution or aceto-orcein. However, there were no subterminal chromosome types or satellite chromosomes observed in our study. These observations might be attributed to the differences in the variety of Camellia species harvested, as well as during sample processing. The density profiles of the chromosomes counterstained with DAPI were assessed (Fig.3 Upper), and a quantitative ideogram by a pseudocolor display was constructed based on the chromosome condensation pattern (Fig.3 Lower) using CHIAS IV (Kato et al., 2009). The chromosome area was displayed as strong blue, green, orange or magenta in the order of density. The condensation pattern of Camellia chromosome observed in this study showed that the whole chromosome was highly condensed (Fig. 3). Furthermore, the morphological traits and condensation pattern were not characteristically distinct for the pairing, except the smallest chromosome pair. Therefore, molecular markers based on particular sequences for FISH are necessary to distinguish the chromosomes. Camellia quantitative ideogram generated by CHIAS IV in Fig. 3 revealed the chromosome pairs based on the characteristics of condensation and chromosome lengths. Chromosome condensation pattern, as an image parameter, had been reported as a useful attribute to identify the 12 chromosomes in rice (Iijima et al., 1991; Fukui and Iijima, 1991). In C. sinensis, each chromosome did not show distinct condensation patterns among the 15 chromosome pairs. However, this quantitative ideogram would be the first demonstration based on the morphological characteristics of tea chromosomes using CHIAS IV. The condensation pattern of Camellia chromosomes measured by CHIAS IV was reported in this study for the first time. However, it was difficult to identify the homologous chromosome pairs using only the length data and arm ratio, because of the similarities in these data. Hence, quantitative karyotyping in combination with the FISH technique using different types of specific probes would lead to the complete chromosome identification.

5 Furukawa et al. 13 Figure 3. Representative ideogram of C. sinensis Sayamakaori constructed by CHIAS IV. (A) Colorgrams, (B) Pseudo-colored ideogram, which indicates the condensation patterns of individual chromosomes. The look up table indicates the level which consists of grey value. Arrows indicate the position of centromere. Figure 4. Shape of the chromosome with 5S rdna signal analyzed by CHIASIV. The vertical axis represents the gray value and the horizontal axis represents the number of pixels along the chromosome. (A) Camellia sinensis var. sinensis Sayamakaori, (B) C. japonica cultivar. Left figures show the density of DAPI (blue) and FITC (green) fluorescence. The positions of 5S rdna, represented by the peak of the green curve on the chromosomes of tea and camellia plants. They appear on the short arm and near the centromeres. Right figures show pseudocolored ideograms of the chromosome with the 5S rdna signal. The look up table indicates the level which consists of grey value. Green circles indicate 5S rdna loci.

6 14 Karyotyping of tea plant and ornamental Camellia 5S rdna loci detection in tea plant and ornamental camellia Two clear FISH signals using the 5S rdna probe were found on the metaphasic chromosomes of C. sinensis and C. japonica (2n = 30) (Fig. 2C, F, and Fig. 4). In C. sinensis, the chromosome containing 5S rdna was submetacentric in all the 6 nuclear plates, and its relative chromosome length ranged from 3.12 to 3.8l and the mean values of 5S rdna labeled chromosomes length was 3.53; however, the chromosome pair with 5S rdna could not be confirmed. Figure 4 shows the chromosome morphology as determined by CHIAS IV fluorescence density measurement. In both species, the two signals were located on the short arm of a midsized metacentric chromosome near the centromere (Fig. 4). In a comparison of the chromosome structure hybridized to the probe, the chromosomes showed similar condensation patterns of the long arm in C. sinensis (Fig. 4A) and C. japonica (Fig. 4B). Heitkam et al. (2015) reported differences in the sequence of 5S rdna in C. sinensis and C. japonica. The monomer length of 5S rdna of C. japonica was reportedly 299 bp, with the existence of some spacer sequences inferred based on the alignments (Heitkam et al., 2015). Furthermore, there were some SNPs and two intergenic spacers in the monomeric 5S rdna among the species (Heitkam et al., 2015). In the present study, a common sequence of 5S rdna in the two species could be hybridized to individual chromosomes because the C. sinensis 5S rdna probe was prepared using PCR products digested by nick translation. Additionally, it was revealed that C. sasanqua also contains the common sequence. In C. sasanqua (7X = 105), at least 34 signals were detected, mostly on the end of the chromosome (Fig. 2H and 2I). The large number of signals is presumed to be because of the polyploidization of Camellia. Furthermore, it is necessary to prepare nuclear plates of sufficient quality to accurately determine the number of signals using CHIAS IV with separated individual chromosomes, because of the large number of chromosomes of this C. sasanqua. Interspecific hybridization and meiotic behavior Based on the observation of pollen mother cells in Robiraki (C. japonica C. sinensis) (Fig. 1C), all chromosomes formed bivalents (Fig. 5). This suggested genetic compatibility of the species at the F1 generation and 2 Camellia species might have homoeologous chromosomes. However, Kato and Shimura (1978) reported low frequency of interspecific hybridization and many univalent, and the incompatibility of C. japonica x C. sinensis hybrids. To better elucidate the presence of unstable bivalent and/or incompatibility in interspecies crossings of Camellia species, it is necessary to investigate the chromosome association in more detail using FISH. In conclusion, the 5S rdna probe derived from the C. sinensis sequence demonstrated the potential to recognize identical chromosomes in C. sinensis and C. japonica. The chromosome pairs containing 5S rdna of C. sinensis and C. japonica were assumed to be homoeologous chromosomes because of the similar structure of the chromosome (Fig. 4) and the existence of bivalents (Fig. 5). The condensation pattern of tea chromosomes was revealed and each chromosome showed comprehensive condensation. The present karyotyping of tea plants was enabled by FISH and CHIAS IV, based on the foundation of previous morphological investigations. In future studies, other probes of Camellia, such as the 45S rdna reported by Vijayan et al. (2012), and those constructed from DNA markers of linkage maps (Taniguchi et al., 2012) will contribute to the complete discrimination of the chromosome pairs. This data will be valuable for clarifying the interspecific hybrid production and for detecting specific functional gene loci of chromosomes and traits. Acknowledgments This research was supported by the plant research grant from the New Technology Development Foundation in Japan. We are grateful to Ms. Erino Takahashi-Araki, Mr. Masahito Watanabe, Mr. Masayuki Nakao, Mr. Seiya Iida, and Ms. Kaori Teramae for the excellent technical support. We are grateful to Dr. Junichi Tanaka, a tea genome researcher, for his valuable advice. We would like to thank Editage ( for English language editing. References Figure 5. Bivalent formation in a pollen mother cell of the interspecific hybrid cultivar Robiraki obtained by natural crossing between C. japonica and C. sinensis. Bar = 10 μm. Ackerman W L (1971) Genetic and cytological studies with Camellia and related genera. Technical bulletin No USDA, US Government Print Office, Washington D. C. Akasaka M, Ueda Y, Koba T (2002) Karyotype analyses of five wild rose species belonging to septet A by fluorescence in situ hybridization. Chromosome Sci 6:17-26 Akasaka M, Ueda Y, Koba T (2003) Karyotype analysis of wild rose species belonging to septets B, C, and D by molecular cytogenetic method. Breeding Sci 53: Bezbaruah HP, Gogoi SC (1972) An interspecific hybrid between tea (Camellia sinensis L.) and C. japonica L. Proc Ind Acad Sci B76: Fukui K, Iijima K (1991) Somatic chromosome map of rice by imaging methods. Theor Appl Genet 81: Heitkam T, Petrasch S, Zakerzewski F, Kögler A, Wenke T, Wanke S, Schmidt T (2015) Next-generation sequencing reveals differentially amplified tandem repeats as a major genome component of Northern Europe s oldest Camellia japonica. Chromosome Res 23: Iijima K, Kaneda K Fukui K (1991) Identification and characterization of somatic rice chromosomes by imaging methods. Theor Appl

7 Furukawa et al. 15 Genet 81: Ishii T, Ueda T, Tanaka H Tsujimoto H (2010) Chromosome elimination by wide hybridization between Triticeae or oat plant and pearl millet: pearl millet chromosome dynamics in hybrid embryo cells. Chromosome Res 189: Ito M, Ohmido N, Akiyama Y, Fukui K, Koba T (2000) Characterization of spinach chromosomes by condensation patterns and physical mapping of 5S and 45S rdnas by FISH. J Amer Soc Hort Sci 125(1):59-62 Kato M, Shimura T (1971) Cytogenetical studies on Camellia species II. The Karyotype analysis in C. sinensis and C. wabisuke. Japan J Breed 21(5): Kato M, Shimura T (1978) Cytogenetical studies on Camellia species III. An interspecific hybrid between Camellia japonica L, and C. sinensis (L.) O. Kuntze. Japan J Breed 28(2): Kato S, Ohmido N, Hira M, Kataoka R, Fukui K (2009) Image analysis of small plant chromosomes by using an improved system, CHIAS IV. Chromosome Sci 12:43-50 Levan A, Fredga K, Sandferg AA (1964) Nomenclature for centromeric position on chromosomes. Hereditas 52: Liu L, Gu Z (2009) Chromosome relationship between Camellia japonica and Camellia reticulata revealed by genomic in situ hybridization. Chromosome Botany 4:1-4 Ohmido N, Fukui K, Kinoshita T (2010) Recent advances in rice genome and chromosome structure research by fluorescence in situ hybridization (FISH). Proc Jpn Acad Ser B Phys Biol Sci 86: Ohmido N, Shimura A, Kato S, Isobe S, Tabata S (2013) Kudzu (Pueraria lobate Ohwi) karyotyping using FISH and Chromosome Image Analysis System IV. Chromosome Sci 16:17-21 Rout GR., Palai SK, Samantaray S, Parta A, Das P (1998) Chromosome variation and cytophotometric investigation of callus culture of the teaplant, Camellia sinensis. Cytobios 93:73-82 Sato H, Kurozumi K, Koba T (2008) Karyotype analysis of a Japanese cucumber cultivar by fluorescence in situ hybridization. Chromosome Sci 10:65-69 Schwarzacher T and Heslop-Harrison P (2000) Practical in situ hybridization. BIOS Scientific publishers Ltd, Oxford. Takeda Y, Yanase Y, Amma S (1987) Breeding of interspecific hybrids between Camellia sinensis (L) O. Kuntze and C. japonica L. and their characteristics. Bull. Natal. Res. Inst. Veg., Ornam. Plants & Tea Japan, Ser. B (Kanaya) 1:11-21 Tanaka J, Taniguchi F, Hirai N, Yamaguchi S (2006) Estimation of the genome size of tea (Camellia sinensis), Camellia (C. japonica), and their interspecific hybrids by flow cytometry. Tea Res J 101:1-7 Taniguchi F, Furukawa K, Ota-Metoku S, Yamaguchi N, Ujihara T, Kono I, Fukuoka H, Tanaka J (2012) Construction of a high-density reference linkage map of tea (Camellia sinensis). Breeding Sci 62: Vijayan K, Chung M, Tsou C (2012) Dispersion of rdna loci and its implications on intragenomic variability and phylogenetic studies in Camellia. Sci Hort 137:59-68 Xu J, Xu Y, Yonezawa T, Li L, Hasegawa M, Lu F, Chen J Zhang W (2015) Polymorphism and evolution of ribosomal DNA in tea (Camellia sinensis, Theaceae). Mol Phylogenet Evol 89:63-72 Zhang C, Kikuchi S, Koba T (2012) Karyotype comparison of Indian and Japanese cucumber cultivars by fluorescence in situ hybridization probed with tandem repeat sequences. Chromosome Sci 15:17-21 Zhou J, Kondo K, Kato M (1991) Karyotypes in wild type and some cultivars of Camellia sinensis var. sinensis (Theaceae). La Kromosomo II-63-64: Zhou J, Kondo K, Kato M (1992) Karyotypes of six strains of Camellia sinensis. La Kromosomo II-66: