De novo genome assembly

Transcription

1

2

3 De novo genome assembly

4 SAM files

5 Convert to fastq

6 Convert to fastq

7 De novo genome ST765:7:1101:1318:2091#0/1 GGCCACCTATGACCGGCTCGCGCCGCTCGTCGGGGAGCGGCTGCTCGTCGTCACCGGGGGCGCGCCCGCGGACGCCGTCCGCGGCCCGCTCCGCGCGCCCC + cccccggggghhhhhh^b^^c ST765:7:1101:1628:2156#0/1 TCTTCGCGAGTATGTCTGTTGATGGCGCTGTGTCCTATCTGCTCAAGGAAAGCAGCCCAACTCAATGTGTTACGCATTAGCGGCATTTGCTACATAATCCG + ST765:7:1101:2627:2192#0/1 ATTATGAAGACTGGAGAAAGCCCTATATTTATTGTATTTCTTTTCTGGATCACAAAATCCTCCCCTCTGAAACAAAAGATGTAGTTGGAATAAATAAAAGG + ST765:7:1101:3236:2246#0/1 GCGGAAAGAGGGCTTGAGGATGACTTCCCTCATAGACTGGGACCCCCACTTTGAGGTGGCTGACGTAGCCTTTAAACGGAGTCCCCGCATTCCCGGTATCT + ST765:7:1101:3400:2241#0/1 GCGGACAGCTAATGCGTTCCACTTATTGAACAGGGTTCTATGGTCGGTCCGTGACCCCCGGATGCCGAAGGCGTCCTTGGGGTAATCTCGTAGTTCCTACG + ST765:7:1101:4139:2060#0/1 NCTTCTCTCTTCATCAGAGAGTAGAGGTTGGGGCAATTGTGGGATCACGACGGGGACAGGGGCAGGTGCGGGCGGCGTCTCCGGTTGAGGAAGAGGCTGCC + BS\cceeegggggiiiiiihifgiiiiffhiiiiiiiiighiihiiiiiiiiggecccccccccccT ST765:7:1101:4188:2089#0/1 ACAAGATATATTTGATATACTAAGATGATAGCTAGAGACTAGAGATGAGAGTGCAGGATCTAGATTTGTAACAAATATTCGACTTTGCTTATGCAAACTGT + bbbeeeeegggggiiiiiiiiiiiiiiiiiiiiiihifghiiiihiiiiiifghiiiiiiiiihiiiiiihiiihhiihiihhggggeeeeeeddddddcc

8 De novo genome assembly

9 DNA extraction, sequencing, assembly

10 Number of contigs vs. genome coverage

11 DNA extraction, sequencing, assembly

12 Repeats can cause challenges

13 Assembly algorithms Overlap-layout-consensus

14 Assembly algorithms De Bruin graph

15 What is a k-mer? A k-mer is a string (sequence of letters) of length k ATGTAATAATG ATGT TGTA GTAA TAAT AATA ATAA TAAT AATG

16 Assembly algorithms it was the best of times, it was the worst of times, it was the age of wisdom, it was the age of foolishness

17 Assembly algorithms it was the best of times, it was the worst of times, it was the age of wisdom, it was the age of foolishness it was the best was the age of it was the age it was the age of foolishness wisdom, it was it was the worst was the best of times, it was the best of times

18 Joining reads with k-mers It was the best was the best of the best of times the of It best was times

19 Joining reads with k-mers It was the best was the best of the best of times the of It best was times

20 Joining reads with k-mers It was the best was the best of the best of times the of It best was times

21 Joining reads with k-mers It was the best was the best of the best of times the of It best was times

22 Joining reads with k-mers It was the best was the best of the best of times the of It best was times

23 Joining reads with k-mers It was the best was the best of the best of times the of It best was times

24 Joining reads with k-mers It was the best was the best of the best of times the of It best was times

25 Joining reads with k-mers It was the best was the best of the best of times It was the best of times

26 Assembly algorithms it was the best of times, it was the worst of times, it was the age of wisdom, it was the age of foolishness it was the best was the age of it was the age it was the age of foolishness wisdom, it was it was the worst was the best of times, it was the best of times

27

28 Assembly algorithms It was the best of times, it was the worst of times, it was the age of wisdom, it was the age of foolishness, it was the epoch of belief, it was the epoch of incredulity, it was the season of Light, it was the season of Darkness, it was the spring of hope, it was the winter of despair, we had everything before us, we had nothing before us, we were all going direct to Heaven, we were all going direct the other way

29 De novo genome assembly

30

31

32 K-mers connect reads -> assembly

33 K-mers connect reads -> assembly

34 Repeats can cause errors

35

36 Evaluating the assembly is it right? Which assembly is better?

37 Assembly: varying kmer size