A sap alien: breaking news of Xylellafastidiosa, an emerging plant pathogen in France. Marie-Agnès Jacques
|
|
|
- Maurice Weaver
- 6 years ago
- Views:
Transcription
1 A sap alien: breaking news of Xylellafastidiosa, an emerging plant pathogen in France Marie-Agnès Jacques
2 American origin 6 subspecies >350 host plants fastidiosa sandyi morus multiplex pauca tashke undescribed subspecies Schaadet al., 2004; Randall et al., 2009; Nunneyet al., 2010, 2012, 2014a, 2014b
3 American origin 6 subspecies >350 host plants fastidiosa sandyi morus multiplex pauca tashke undescribed subspecies Schaadet al., 2004; Randall et al., 2009; Nunneyet al., 2010, 2012, 2014a, 2014b
4 France(Summer 2015) Recent emergences in Asia and Europe Italy(Fall 2013) Taiwan (Winter 2012) Iran (Summer 2014) Reports fromindia, Lebanon, Turkeyand China werenot confirmedor were invalidated. Saponariet al., 2013; Su et al., 2013; Amanifaret al. 2014; Jindal and Sharma, 1987; Chu 2001; Güldür et al., 2005; Habib, 2016.
5 : Several interceptions of coffee plants infected by X. fastidiosa in France Ornamental plants: imported from Central America Production plants: voluntary-based survey on imported material from Latin America
6 Assignation of coffee isolates to X. fastidiosa subspecies Multiprimer PCR test (3 genes) Hernandez-Martinez et al., 2006 Control (+) fastidiosa multiplex pauca sandyi (-) MLSA (7 genes) fastidiosa fastidiosa sandyi multiplex pauca (-) sandyi morus MLSA: Partial sequences of 7 housekeeping genes: cysg, gltt, holc, leua, malf, nuol, petcas described in Concatenated dataset; ML, 1000 bootstraps multiplex pauca = isolates from intercepted infected coffee plants Jacques et al., 2016; Unpublished data
7 New variants of coffee-infecting X. fastidiosa in France MLST scheme (7 genes; Date Country Strain cysg gltt holc leua mal F nuol petc ST subsp 2012 Mexico CFBP Costa Rica?? CFBP 8356 COF160 COF198.1 fastidiosa (sandyi) * sandyi 2015 Honduras COF * sandyi Ecuador Ecuador CFBP 8072 CFBP pauca 2015? COF * pauca Coffee plants trade Novel alleles and STs * Identical STs detected in France and Italy Giampettruzzi et al., 2015; Jacques et al., 2015; Loconsole et al., 2016; Unpublished data
8 Phylogenetic network of Xylella fastidiosa sequence types fastidiosa multiplex morus sandyi Intercepted isolates reveal additional genetic diversity Concatenated dataset Jacques et al., 2016; Unpublished data pauca
9 L affaire se Corse : X. fastidiosa outbreak in Corsica July 22 nd 2015 Symptomatic Polygala myrtifolia infected by X. fastidiosa were detected in Propriano Phytosanitary measures were applied And on Oct. 8 th, in Mainland France
10 Xf detection in plants SRAL, FREDON, DSF, DDSCPP Accredited labs French reference method: Anses-LSV MA039 version sample= 5 to 100 petioles= 0.5 to 1 g 2 DNA extractions / sample AutomatedDNA extraction QuickPick Plant DNA kit (Bio-Nobile) and KingFisher ml 4 amplifications Real-time PCR Harper et al., 2010
11 Xf detection in plants Perfomance criteria of the method Performance criteria Pure strain cultures Inclusivity Exclusivity Matrix 100% (23 targeted strains representing the 4 major subsp.) 100% (29 non-targeted strains: Xylophilus, Xanthomonas, Liberibacter, sap saprophytes) Plant matrix ( 10² bact./ml,15 samples) Orange tree + X. f. paucacfbp8072 Grappe + X. f. fastidiosacfbp7970 Olive tree + X. f.multiplex CFBP8173 Sensitivity 100% 94% 67% Specificity 100% 100% 100% Repetability 100% 96% 100% Reproductibility 98% Detection threshold (with detection probability of 100%) 10² bact./ml 10 3 bact./ml 10 5 bact./ml A performant method The presence of inhibitors (polyphenol, secondary metabolites, ) in some plant matrix (olive tree, oak) limits its sensitivity.
12 PACA: Provence, Alpes, Côte d azur 12 foci Situation in France - March 2016 Corsica 242 foci highestfocus: 530m Isolated from 2 plant species -Polygala myrtifolia -Spartium junceum foci buffer area sampled Isolated from 21 plant species
13 X. fastidiosacontaminatedplants in France Polygala myrtifolia Lavendula sp. Pelargonium graveolens Spartium junceum Cistus sp. Myrtus communis Hebe sp. Cytisus racemosus Metrosideros excelsa Acer pseudoplatanus Quercus suber Prunus cerasifera Rosa x floribunda Asparagus acutifolius Genista hephredoides Rosmarinus officinalis Total Nb analyzed samples Nb positive samples Nb negative samples % positive samples Acer(total) ,5 % Asparagus(total) ,1 % Cistus(total) ,6 % Citrus(total) % Cytisus racemosus % Genista ephedroides % Hebe(total) ,3 % Lavandula(total) ,7 % Metrosideros(total) ,9 % Myrtus communis ,8 % Olea europaea % Pelargonium(total) ,8 % Polygala myrtifolia ,2 % Prunus(total) ,4 % Quercus(total) ,3 % Rosa(total) ,3 % Rosmarinus(total) ,7 % Spartium junceum % Vitis(total) % Autres ,4 % Total ,7 % 4,990 sampleson the 4 th of March 2016
14 Plants never found infected in France, so far # samples Olea europaea 548 Oleander spp. 111 Quercus spp. (other than Q. suber) 335 Citrus
15 Corsica/PACA regions: X. fastidiosa subsp. multiplex Multiprimer PCR test Control (+) MLSA7 HK genes Low bootstrap (63): 2 groups with high genetic promiscuity A Polygala myrtifolia 6 Cistus monspeliensis 2 Cystisus racemosus 1 Myrtus communis 1 Pelargonium sp. 1 Quercus suber 1 Rosa sp. 1 B 638bp 521bp 412bp A fastidiosa multiplex pauca sandyi (-) MLSA (7 genes) High bootstrap (96): subspecies multiplex B Polygala myrtifolia 22 Pelargonium sp. 9 Cistus sp. 4 Spartium junceum 3 Cystisus racemosus 2 Hebe sp. 2 Lavandula sp. 2 Artemisia arborencens1 Coronilla valentina 1 Metrosideros sp. 1 Prunus cerasifera 1 subsp. multiplex Hernandez-Martinez et al., Plant Dis (2006) No host specificity of the lineages >400 samples
16 Corsica/PACA strains share identities to US strains MLST(7 genes): 2 STs identical to subsp. multiplex US strains M12 (Prunus dulcis) Griffin-1 (Quercus rubra) ST cysg gltt holc leua malf nuol petc A B High genetic promiscuity: 1 SNP (G152A) at a single locus Occurrence of ST6 and ST7 isolates ST isolate country host species name year 6 ALS0003 USA almond Prunus dulcis 1990s 6 ALS0013 USA almond Prunus dulcis 2000s 6 ALS0015 USA almond Prunus dulcis ALS0073 USA almond Prunus dulcis ALS0091 USA almond Prunus dulcis ALS0092 USA almond Prunus dulcis OLV0029 USA olive Olea europaea SM0053 USA black sage Salvia mellifera SM0054 USA black sage Salvia mellifera SM0056 USA black sage Salvia mellifera ALS0206 USA almond Prunus dulcis. 7 ALS0299 USA almond Prunus dulcis ALS0361 USA almond Prunus dulcis. 7 OLV00471 USA olive Olea europaea 2011 Dixon ST6: Almond; USA ST7: Almond, black sage, olive, red oak; USA
17 Genome sequencing of 3 strains isolated in Corsica Isolation on PWG Illumina MiSeq: (Plateforme Génomique de Nantes, Biogenouest) CATI BBRIC analytic tools Strain Host, location ST Contigs CFBP 4616 CFBP 4617 CFBP 4618 Polygala myrtifolia, Propriano Spartium junceum, Alata Spartium junceum, Alata N50 (bp) Genome size (bp) GC% Genes Prot nc Genes ,891 2,466, ,419 2,504, ,035 2,513, Data similar to those of other X. fastidiosa genomes publicly available
18 Average nucleotide identity (ANIb) multiplex morus sandyi fastidiosa pauca PLS 229 ATCC Sy-VA M12 Griffin-1 LSV CFBP Dixon LSV CFBP LSV CFBP Mul-MD Mul0034 ANIb PLS ATCC Sy-VA M Griffin CFBP 4616 LSV Dixon LSV LSV Mul-MD Mul Ann CFBP CO Temecula M GB EB ATCC a5c c CFBP CoDiRO CFBP 4617 CFBP 4618 Ann-1 CFBP 8073 CO33 Temecula1 M23 GB514 EB92.1 ATCC a5c 6c 32 CFBP 8072 CoDiRO Corsica strains: >99% identity vs. X. fastidiosa subsp. multiplex.
19 CGview: Pairwise genome comparisons (1kb fragments) CFBP4617 ST6, Sjvs. -CFBP4618 ST6, Sj(ext) -CFBP4616 ST7, Pm (int) ST7 M12 (P. dulcis) CFBP 4616 (P. myrtifolia) ST6 BLAST hit = 100% identical BLAST hit >= 98% identical BLAST hit >= 96% identical BLAST hit >= 94% identical Dixon (P. dulcis) CFBP 4617, CFBP 4618 (S. junceum) Comparison among Corsica strains: - CFBP 4617 vs. CFBP 4618: nearly 100% identical. - CFBP 4617 vs. CFBP 4616: strong genetic promiscuity but lower identities. White stripes: specific fragments of CFBP 4617
20 CGview: Pairwise genome comparisons (1kb fragments) Dixon vs. -CFBP4618 ST6, Sj(ext) -CFBP4617 ST6, Sj -M12 ST7, Pd -CFBP4616 ST7 Pm -Griffin-1 ST7 Qr(int) ST7 ST6 M12 (P. dulcis) CFBP 4616 (P. myrtifolia) BLAST hit = 100% identical BLAST hit >= 98% identical BLAST hit >= 96% identical BLAST hit >= 94% identical Dixon (P. dulcis) CFBP 4617, CFBP 4618 (S. junceum) -CFBP 4617 and CFBP 4618: highest identities with the Dixon strain. White stripes: sequences of one plasmid from Dixon are missing in other strains No ORFs from pxf-riv5 in strains from Corsica, M12 and Griffin-1
21 Ongoing: 1. pathogenicity assays Aim:Getting knowledgeon Xfstrains from French outbreak hostrange and fulfilling Koch postulates Pays de la Loire region: Grapevine -Apple -Pear -Prunus Corsica region: Citrus - Olive - Polygala X. fastidiosa strains Subsp. fastidiosa, sandyi, multiplex, pauca US French Italian isolates Positive Controls: Coffee - Olive - Oleander
22 19 wpi Ongoing: 1. pathogenicity assays CoDiRO Nerium oleander CFBP 8072 Coffea arabica CoDiRO = ST53, first described for Coffee and Oleander isolates in Costa Rica Ongoing: Bacterial isolation and qpcr detection tests
23 Ongoing: 1. pathogenicity assays Aim:Getting knowledgeon Xfstrains from French outbreak hostrange and fulfilling Koch postulates Pays de la Loire region: Grapevine -Apple -Pear -Prunus Corsica region: Citrus - Olive - Polygala X. fastidiosa strains Subsp. fastidiosa, sandyi, multiplex, pauca US French Italian isolates Positive Controls: Coffee - Olive - Oleander Tibicina Corsica ssp. corsica Cicadetta fangoana Ongoing: 2. insect analyses Philaenus spumarius Cicada orni Ledra aurita Cicadella viridis Elaborate the reference method Aphrophora alni Aphrophora pectoralis Test insects sampled in Corsica last summer: Neophilaenus lineatus Lepyronia coleoptrata
24 Acknowledgments Sap Alien project Bruno Legendre Valérie Olivier Françoise Poliakoff Amandine Cunty Nicolas Denancé Martial Briand Sophie Cesbron Perrine Portier InEMteamfortestsonplants: Rémi Gardet Daniel Sochard Département SPE Muriel Bahut Maria Saponari Yannick Blanchard Claire de Boisséson Fabrice Touzaint Pauline de Jerphanion Dominique Crouzillat Stelly Mississipi Emmanuelle Morel
Les émergences de maladies des
Les émergences de maladies des plantes : Le cas de Xylella fastidiosa et de candidatus Liberobacter solanacearum 1 Détecter et anticiper les émergences Veille phytosanitaire OEPP Promed mail list Fiche
Information on Xylella fastidiosa in Germany (update) Xylella fastidiosa in Germany, information PAFF,
Information on Xylella fastidiosa in Germany (update) Xylella fastidiosa in Germany, information PAFF, 2016-07-15 1 Surveillance Survey on specified plants in 100m radius Survey and record keeping on specified
Xylella fastidiosa A biosecurity threat to Australia
Xylella fastidiosa A biosecurity threat to Australia Why we are concerned about Xylella Xylella causes significant environmental and economic impacts, and many commercial and ornamental plant species are
Xylella fastidiosa. Funded by the EU s LIFE programme
Xylella fastidiosa Xylem-inhabiting fastidious bacteria Introduction The bacteria multiplies in the vessels and these become blocked, and water can not reach all parts of the plant from the roots and infected
Biology and pathogenicity of Xylella fastidiosa associated to olive quick decline syndrome
Biology and pathogenicity of Xylella fastidiosa associated to olive quick decline syndrome Maria Saponari, PhD Institute for Sustainable Plant Protection, CNR - Bari Investigation on the host range and
State of the art of the research on X. fastidiosa in Apulia
International Workshop on Xylella fastidiosa & the Olive Quick Decline Syndrome (OQDS) 19-22 April, 2016 State of the art of the research on X. fastidiosa in Apulia Maria Saponari, PhD Consiglio Nazionale
First Report of Pierce s Disease in New Mexico
2007 Plant Management Network. Accepted for publication 20 April 2007. Published. First Report of Pierce s Disease in New Mexico Jennifer J. Randall and Maxim Radionenko, Department of Entomology, Plant
Reasons for the study
Systematic study Wittall J.B. et al. (2010): Finding a (pine) needle in a haystack: chloroplast genome sequence divergence in rare and widespread pines. Molecular Ecology 19, 100-114. Reasons for the study
Suzanne Rooney Latham
Suzanne Rooney Latham C. L. Blomquist, Y. Y. Guo, M. C. Soriano, K. L. Kosta, T. J. Swiecki, E. A. Bernhardt, and S. J. Frankel APS Annual Meeting of the California Forest Pest Council November 5, 2015
Natural history of Trichinella britovi in the neighboring Mediterranean islands of Corsica and Sardinia
Workshop of National Reference Laboratories for Parasites Istituto Superiore di Sanità, Rome, Italy, 24-25 May, 2018 Natural history of Trichinella britovi in the neighboring Mediterranean islands of Corsica
SYSTEMS USED TO COMBAT OTHER VECTOR TRANSMITTED BACTERIA, PIERCE S DISEASE IN GRAPES. Don Hopkins Mid Florida REC, Apopka
SYSTEMS USED TO COMBAT OTHER VECTOR TRANSMITTED BACTERIA, PIERCE S DISEASE IN GRAPES Don Hopkins Mid Florida REC, Apopka Vascular Diseases Caused by Fastidious Prokaryotes Fastidious Phloem-Limited Bacteria
Coffee Berry Borer, Hypothenemes hampei Ferrari (Coleoptera: Scolytidae)- Microbial Interactions
Coffee Berry Borer, Hypothenemes hampei Ferrari (Coleoptera: Scolytidae)- Microbial Interactions Sayaka Aoki, Mark G Wright, Ania Wieczorek, Russell Messing, Gordon Bennett and Fernando Vega Department
GRAPEVINE PINOT GRIS DISEASE: an emerging issue for viticulture
Centro di Ricerca Viticoltura ed Enologia Aspetti eziologici ed epidemiologici della malattia del Pinot grigio GRAPEVINE PINOT GRIS DISEASE: an emerging issue for viticulture Nadia Bertazzon nadia.bertazzon@crea.gov.it
SHORT TERM SCIENTIFIC MISSIONS (STSMs)
SHORT TERM SCIENTIFIC MISSIONS (STSMs) Reference: Short Term Scientific Mission, COST Action FA1003 Beneficiary: Bocharova Valeriia, National Scientific Center Institute of viticulture and winemaking named
Title: Genetic Variation of Crabapples ( Malus spp.) found on Governors Island and NYC Area
Title: Genetic Variation of Crabapples ( Malus spp.) found on Governors Island and NYC Area Team Members: Jianri Chen, Zinan Ma, Iulius Sergiu Moldovan and Xuanzhi Zhao Sponsoring Teacher: Alfred Lwin
Unravelling the taxonomy of the Colletotrichum species causing anthracnose in chili in Australia and SE Asia
Unravelling the taxonomy of the Colletotrichum species causing anthracnose in chili in Australia and SE Asia Dilani de Silva Prof. Paul Taylor, Prof. Pedro Crous, Prof. Peter Ades Faculty of Veterinary
Museum Victoria CRC National Plant Biosecurity
1. PaDIL Species Factsheet Scientific Name: Ralstonia solanacearum (Smith 1896) Yabuuchi et al. 1996 race 2 (Bacteria: Proteobacteria: Burkholderiales: Burkholderiaceae) Common Name Moko disease of banana
PROFICIENCY TESTS NO 19 AND EURL-Campylobacter National Veterinary Institute
PROFICIENCY TESTS NO 19 AND 20 2017 EURL-Campylobacter National Veterinary Institute NO OF NRLS PARTICIPATING IN THE PROFICIENCY TESTS 2017 PT 19 2016 PT 17 2015 PT 15 2014 PT 13 2013 PT 11 2012 PT 9 2011
Genomics: cracking the mysteries of walnuts
Review Article Genomics: cracking the mysteries of walnuts Fei Chen 1*#, Junhao Chen 2*, Zhengjia Wang 2, Jiawei Zhang 1, Meigui Lin 1, Liangsheng Zhang 1# 1 State Key Laboratory of Ecological Pest Control
Abstract RESEARCH ARTICLE
RESEARCH ARTICLE Molecular Diversity of Anthracnose Pathogen Populations Associated with UK Strawberry Production Suggests Multiple Introductions of Three Different Colletotrichum Species Riccardo Baroncelli
First Occurence and Susceptibility of Prunus Species to Erwinia amylovora in Hungary
First Occurence and Susceptibility of Prunus Species to Erwinia amylovora in Hungary László Palkovics and Anita Végh Department of Plant Pathology, Faculty of Horticultural Sciences, Corvinus University
Mapping and Detection of Downy Mildew and Botrytis bunch rot Resistance Loci in Norton-based Population
Mapping and Detection of Downy Mildew and Botrytis bunch rot Resistance Loci in Norton-based Population Chin-Feng Hwang, Ph.D. State Fruit Experiment Station Darr College of Agriculture Vitis aestivalis-derived
Organization, diversity, expression and evolutionary dynamics of the NB resistance gene family in grapevine and related species
Organization, diversity, expression and evolutionary dynamics of the NB resistance gene family in grapevine and related species guillaume.barnabe@inra.fr Rustenholz Camille camille.rustenholz@inra.fr Merdinoglu
Wine Yeast Population Dynamics During Inoculated and Spontaneous Fermentations in Three British Columbia Wineries
Wine Yeast Population Dynamics During Inoculated and Spontaneous Fermentations in Three British Columbia Wineries MSc Candidate: Jessica Lange Supervisor: Dr. Daniel Durall July 7 th, 22 Please note: Darryl
History, Etiology and Worldwide Situation of Huanglongbing. J. V. da Graça
History, Etiology and Worldwide Situation of Huanglongbing J. V. da Graça Greening/HLB What s in a Name? Huanglongbing (Yellow shoot disease) China Greening or Yellow branch (South Africa) Likubin (drooping
The importance and implications of high health planting material for the Australian almond industry
The importance and implications of high health planting material for the Australian almond industry by Brendan Rodoni, Mirko Milinkovic and Fiona Constable (Victorian DPI) Plant viruses and Perennial fruit
Coffee market remains volatile but lacks direction
Coffee market remains volatile but lacks direction Prices fluctuated significantly during August, with the ICO composite indicator dropping by 10 cents before jumping back up another 12 cents by the end
3.5 Citrus Greening (Huanglongbing) Disease in India : Present Status and Diagnostic Efforts
Page 129 3.5 Citrus Greening (Huanglongbing) Disease in India : Present Status and Diagnostic Efforts Das A. K. National Research Centre for Citrus, Amravati Road, Nagpur 440010, India. Among all diseases
(Definition modified from APSnet)
Development of a New Clubroot Differential Set S.E. Strelkov, T. Cao, V.P. Manolii and S.F. Hwang Clubroot Summit Edmonton, March 7, 2012 Background Multiple strains of P. brassicae are known to exist
Two New Verticillium Threats to Sunflower in North America
Two New Verticillium Threats to Sunflower in North America Thomas Gulya USDA-Agricultural Research Service Northern Crop Science Laboratory, Fargo ND 58105 gulyat@fargo.ars.usda.gov ABSTRACT A new strain
WP Board 1054/08 Rev. 1
WP Board 1054/08 Rev. 1 9 September 2009 Original: English E Executive Board/ International Coffee Council 22 25 September 2009 London, England Sequencing the genome for enhanced characterization, utilization,
Eukaryotic Comparative Genomics
Detecting Conserved Sequences Eukaryotic Comparative Genomics June 2018 GEP Alumni Workshop Charles Darwin Motoo Kimura Barak Cohen Evolution of Neutral DNA Evolution of Non-Neutral DNA A A T C T A A T
IMPORTATION OF NELUMBO NUCIFERA
IMPORTATION OF NELUMBO NUCIFERA GAERTNER (WATERLILY, LOTUS) AS ROOTS FROM EL SALVADOR, GUATEMALA, HONDURAS AND NICARAGUA INTO THE CONTINENTAL UNITED STATES A Qualitative, Pathway-Initiated Risk Assessment
Opportunities with disease-resistant cultivars
Opportunities with disease-resistant cultivars Ian Dry & Mark Thomas CSIRO Agriculture ASVO, Mildura - July 2015 Genetic improvement of winegrapes: 6000 BC present Vitis vinifera ssp. sylvestris (wild
Construction of a Wine Yeast Genome Deletion Library (WYGDL)
Construction of a Wine Yeast Genome Deletion Library (WYGDL) Tina Tran, Angus Forgan, Eveline Bartowsky and Anthony Borneman Australian Wine Industry AWRI Established 26 th April 1955 Location Adelaide,
Shazia Mannan COMSATS Institute of Information Technology Sahiwal Campus, Pakistan
Shazia Mannan COMSATS Institute of Information Technology Sahiwal Campus, Pakistan Citrus is one of the major export commodities of Pakistan and is grown in an area of 160,000 ha. Annual production of
PEEL RIVER HEALTH ASSESSMENT
PEEL RIVER HEALTH ASSESSMENT CONTENTS SUMMARY... 2 Overall River Health Scoring... 2 Overall Data Sufficiency Scoring... 2 HYDROLOGY... 3 Overall Hydrology River Health Scoring... 3 Hydrology Data Sufficiency...
Current status of virus diseases in Washington State vineyards
Current status of virus diseases in Washington State vineyards Naidu A. Rayapati Department of Plant Pathology Washington State University Irrigated Agriculture Research & Extension Center Prosser, WA
Supplemental Data. Jeong et al. (2012). Plant Cell /tpc
Suppmemental Figure 1. Alignment of amino acid sequences of Glycine max JAG1 and its homeolog JAG2, At-JAG and NUBBIN from Arabidopsis thaliana, LYRATE from Solanum lycopersicum, and Zm- JAG from Zea mays.
Etiology of Thousand Cankers Disease in the Eastern US
Etiology of housand Cankers Disease in the Eastern US A Disease Complex Becomes More Complex Melanie Moore, USDA Forest Service Northern Research Station Partners Dr. Jenny Juzwik, Research Plant Pathologist
Screening of olive germplasm for resistance to Xylella fastidiosa ST53: the state of the art
Screening of olive germplasm for resistance to Xylella fastidiosa ST53: the state of the art Donato Boscia CNR, Istituto per la Protezione Sostenibile delle Piante, Bari (IT) GENETIC RESISTANCE TO PATHOGENS
Reshaping of crossover distribution in Vitis vinifera x Muscadinia rotundifolia interspecific hybrids
Reshaping of crossover distribution in Vitis vinifera Muscadinia rotundifolia interspecific hybrids Marion Delame, Emilce Prado, Sophie Blanc, Guillaume Robert-Siegwald, Christophe Schneider, Pere Mestre,
CAMPYLOBACTER IN MILK ( OR: CHERCHEZ LES CAMPYLOBACTERS IN MILK ) Eva Olsson Engvall
CAMPYLOBACTER IN MILK ( OR: CHERCHEZ LES CAMPYLOBACTERS IN MILK ) Eva Olsson Engvall 12th EURL Campylobacter workshop Nantes, France, 14-15 September, 2017 WHY SAMPLE MILK? Outbreak situations, search
Eukaryotic Comparative Genomics
Eukaryotic Comparative Genomics Detecting Conserved Sequences Charles Darwin Motoo Kimura Evolution of Neutral DNA A A T C TA AT T G CT G T GA T T C A GA G T A G CA G T GA AT A GT C T T T GA T GT T G T
Coffee market trends Kristina Sorby, RDV
Public Disclosure Authorized Public Disclosure Authorized Public Disclosure Authorized Public Disclosure Authorized Background paper to World Bank Agricultural Technology Note 30, Toward more sustainable
Differences in virulence of Phytophthora capsici isolates from a worldwide collection on tomato fruits
Euro. J. Plant Pathol. DOI:10.1007/s10658-011-9873-4 Online First Differences in virulence of Phytophthora capsici isolates from a worldwide collection on tomato fruits Dr. Leah Granke Dr. Lina Quesada-Ocampo
JUNPERUS VIRGINIANA IN THE SERRANIAS DEL BURRO MOUNTAINS, COAHUILA, MEXICO: A PLEISTOCENE RELICT
168 Phytologia (August 2011) 93(2) JUNPERUS VIRGINIANA IN THE SERRANIAS DEL BURRO MOUNTAINS, COAHUILA, MEXICO: A PLEISTOCENE RELICT Robert P. Adams Biology Department, Baylor University, Box 97388, Waco,
Identification of haplotypes controlling seedless by genome resequencing of grape
Identification of haplotypes controlling seedless by genome resequencing of grape Soon-Chun Jeong scjeong@kribb.re.kr Korea Research Institute of Bioscience and Biotechnology Why seedless grape research
Unraveling Pierce s Disease in Its Ancient Environment
Unraveling Pierce s Disease in Its Ancient Environment With hopes of decreasing the widespread death of wine grapes, Texas researchers seek answers in the vectors and bacterial pathogens that fuel Pierce
Title: Development of Simple Sequence Repeat DNA markers for Muscadine Grape Cultivar Identification.
Title: Development of Simple Sequence Repeat DNA markers for Muscadine Grape Cultivar Identification. Progress Report Grant Code: SRSFC Project # 2018 R-06 Research Proposal Name, Mailing and Email Address
Coffee: World Markets and Trade
United States Department of Agriculture Foreign Agricultural Service June 2017 Coffee: World Markets and Trade 2017/18 Forecast Overview World coffee production for 2017/18 is forecast at 159 million bags
Pierce's Disease Overview & Management Guide A Resource for Grape Growers in Texas and Other Eastern U.S. Growing Areas
Pierce's Disease Overview & Management Guide A Resource for Grape Growers in Texas and Other Eastern U.S. Growing Areas Contents Page Preface 4 Introduction History of Pierce's Disease in Texas 5 Pierce's
Tree diversity effect on dominant height in temperate forest
Tree diversity effect on dominant height in temperate forest Patrick Vallet, Thomas Pérot Irstea Nogent-sur-Vernisson CAQSIS, 28 29 March 2017, Bordeaux 2 Overyielding in mixed forest Context For many
Tom Kuhar & D. Ames Herbert Dept. of Entomology Virginia Tech
Tom Kuhar & D. Ames Herbert Dept. of Entomology Virginia Tech Aigner, J.D. and T.P. Kuhar. 214. Using Citizen Scientists to Evaluate Light Traps for Catching Brown Marmorated Stink Bugs in Homes in Virginia.
Santa Barbara County Agricultural Commissioner
Santa Barbara County Agricultural Commissioner Plant Pest and Disease Diagnostic Services Plant Pathology Heather Scheck Entomology Brian Cabrera Santa Barbara: 681-5600 Santa Maria: 934-6200 Plant Pest
Mem. Faculty. B. O. S. T. Kindai University No. 38 : 1 10 (2016)
Mem. Faculty. B. O. S. T. Kindai University No. 38 : 1 10 (2016) 1 2 Memoirs of The Faculty of B. O. S. T. of Kindai University No. 38 2016 In recent years, several papers were published on microflora
Coffee Season 2013/14 Finishes in Balance but Deficit Expected Next Year
Coffee Season 2013/14 Finishes in Balance but Deficit Expected Next Year Coffee prices were volatile again over the course of September, mostly reacting to weather news from Brazil. Daily prices fell initially
Fruit and berry breeding and breedingrelated. research at SLU Hilde Nybom
Fruit and berry breeding and breedingrelated research at SLU 2014-11-11 Hilde Nybom Plant breeding: cultivar development Relevant breeding-related research Fruit and berry breeding at Balsgård Apple (Malus
SNP discovery from amphidiploid species and transferability across the Brassicaceae
SNP discovery from amphidiploid species and transferability across the Brassicaceae Jacqueline Batley University of Queensland, Australia j.batley@uq.edu.au 1 Outline Objectives Brassicas Genome Sequencing
Effect of a protectant copper application on Psa infection of kiwifruit trap plants
310 Effect of a protectant copper application on Psa infection of kiwifruit trap plants J.L. Tyson 1, S.J. Dobson 2 and M.A. Manning 1 1 The New Zealand Institute for Plant & Food Research Limited, Private
Selecting Disease Resistant Transgenic Grapevine for Field Tests
Selecting Disease Resistant Transgenic Grapevine for Field Tests D. J. Gray, Z. T. Li, S. A. Dhekney, M. Dutt, M. Van Aman, J. Tattersall & K. T. Kelley Mid-Florida Research & Education Center Pierce s
Molecular identification of bacteria on grapes and in must from Small Carpathian wine-producing region (Slovakia)
Molecular identification of bacteria on grapes and in must from Small Carpathian wine-producing region (Slovakia) T. Kuchta1, D. Pangallo2, Z. Godálová1, A. Puškárová2, M. Bučková2, K. Ženišová1, L. Kraková2
Global Trade in Mangoes
Global Trade in Mangoes October 2014 Jim Lang Managing Director TradeData International Pty Ltd jim.lang@tradedata.net www.tradedata.net COUNTRIES WITH MONTH IMPORT STATISTICS 1. The global market is just
Jonathan H. Crane, Tropical Fruit Crop Specialist and Wanda Montas, Sr. Biologist
Jonathan H. Crane, Tropical Fruit Crop Specialist and Wanda Montas, Sr. Biologist 5-15-14 University of Florida, IFAS Tropical Research and Education Center Homestead, FL » Michael J. Davis, Plant Pathologist
Final Progress Reports due April 14, 2006 USDA APHIS Texas Pierce s Disease Research and Education Program
Final Progress Reports due April 14, 2006 USDA APHIS Texas Pierce s Disease Research and Education Program Title of project: Pierce s disease risk factors in Texas (FY05-06) Principal investigator: Mark
Controlling Pierce s Disease with Molecular and Classical Breeding
Controlling Pierce s Disease with Molecular and Classical Breeding M. Andrew Walker Professor Louise Rossi Endowed Chair in Viticulture University of California, Davis Funding from CDFA PD/GWSS Board and
Coffee prices rose slightly in January 2019
Coffee prices rose slightly in January 2019 In January 2019, the ICO composite indicator rose by 0.9% to 101.56 US cents/lb as prices for all group indicators increased. After starting at a low of 99.16
Fresh Deciduous Fruit (Apples, Grapes, & Pears): World Markets and Trade
Million MT United States Department of Agriculture Foreign Agricultural Service December 21 Fresh Deciduous Fruit (Apples, Grapes, & Pears): World Markets and Trade 21/11 Forecast: World Apple Trade Declines;
Outlook for the. ASEAN INTERNATIONAL SEMINAR ON COFFEE June 2012 Kuta, Bali, Indonesia
Outlook for the World Coffee Market ASEAN INTERNATIONAL SEMINAR ON COFFEE 12 13 June 212 Kuta, Bali, Indonesia José Sette Head of Operations ICO Composite Indicator Price (in current terms) Monthly averages:
Global Protein-Based Multiplex Assay Market Research Report 2021
Published on Market Research Reports Inc. (https://www.marketresearchreports.com) Home > Global Protein-Based Multiplex Assay Market Research Report 2021 Global Protein-Based Multiplex Assay Market Research
Thousand Cankers Disease (TCD) Simeon Wright Forest Pathologist Missouri Dept. of Conservation November 6, 2015
Thousand Cankers Disease (TCD) Simeon Wright Forest Pathologist Missouri Dept. of Conservation November 6, 2015 Outline Background Monitoring for TCD Survey challenges Experience and research in other
Virginia Wine Board Project # Annual Progress Report - July 2015
Virginia Wine Board Project #14-1675- 02 Annual Progress Report - July 2015 Botrytis cinerea fungicide itivity evaluation in Virginia crops Investigators Anton Baudoin, Associate Professor, email: abaudoin@vt.edu
July marks another month of continuous low prices
July marks another month of continuous low prices In July 2018, the ICO composite indicator price decreased by 2.9% to an average of 107.20 US cents/lb, which is the lowest monthly average for July since
LUISA MAYENS VÁSQUEZ RAMÍREZ. Adress: Cl 37 # 28-15, Manizales, Caldas, Colombia. Cell Phone Number:
LUISA MAYENS VÁSQUEZ RAMÍREZ Adress: Cl 37 # 28-15, Manizales, Caldas, Colombia. Cell Phone Number: 3013978734 E-mail: luisamayens@gmail.com PROFILE Agronomical engineer, Universidad de Caldas, Colombia.
Introduction. Keywords: Actinidia chinensis, Actinidia deliciosa, bacterial canker of kiwifruit, multilocus sequence analysis, pathogenicity
Doi: 10.1111/ppa.12297 Characterization of Pseudomonas syringae pv. actinidiae (Psa) isolated from France and assignment of Psa biovar 4toade novo pathovar: Pseudomonas syringae pv. actinidifoliorum pv.
United Nations Conference on Trade and Development. TRADE AND DEVELOPMENT BOARD (62nd session)
United Nations Conference on Trade and Development TRADE AND DEVELOPMENT BOARD (62nd session) Geneva, 14-25 September 2015 Item 6: Evolution of the international trading system and its trends from a development
De novo genome assembly
De novo genome assembly @HWI ST765:7:1101:1318:2091#0/1 GGCCACCTATGACCGGCTCGCGCCGCTCGTCGGGGAGCGGCTGCTCGTCGTCACCGGGGGCGCGCCCGCGGACGCCGTCCGCGGCCCGCTCCGCGCGCCCC + cccccggggghhhhhh^b^^c UZFLZWacdBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
IMPACT OF RED BLOTCH DISEASE ON GRAPE AND WINE COMPOSITION AND QUALITY
IMPACT OF RED BLOTCH DISEASE ON GRAPE AND WINE COMPOSITION AND QUALITY ANITA OBERHOLSTER Foothills Grape Day 2016: Healthy Vines, Fine Wines Amador County Fairgrounds, Spur Emporium Building May 18 th,
Persea and Phytophthora in Latin America
Proc. of Second World Avocado Congress 1992 pp.61-66 Persea and Phytophthora in Latin America George A. Zentmyer Department of Plant Pathology, University of California, Riverside, CA 92521, USA Eugenio
Growing divergence between Arabica and Robusta exports
Growing divergence between Arabica and Robusta exports In April 218, the ICO composite indicator decreased by.4% to an average of 112.56, with the daily price ranging between 11.49 and 114.73. Prices for
Spotted wing drosophila in southeastern berry crops
Spotted wing drosophila in southeastern berry crops Hannah Joy Burrack Department of Entomology entomology.ces.ncsu.edu facebook.com/ncsmallfruitipm @NCSmallFruitIPM Spotted wing drosophila Topics Biology
Catalogue of published works on. Maize Lethal Necrosis (MLN) Disease
Catalogue of published works on Maize Lethal Necrosis (MLN) Disease Mentions of Maize Lethal Necrosis (MLN) Disease - Reports and Journals Current and future potential distribution of maize chlorotic mottle
of Vitis vinifera using
Characterisation of the pan-genome of Vitis vinifera using Next Generation Sequencing Plant Biology Europe 2018 - June 18-21 - Copenhagen Gabriele Magris (gmagris@appliedgenomics.org) Genetic variation
MONTHLY COFFEE MARKET REPORT
E MONTHLY COFFEE MARKET REPORT February 2014 February 2014 has seen significant developments in the coffee market, with prices shooting upwards at a startling rate. The ICO composite daily price has increased
Project Justification: Objectives: Accomplishments:
Spruce decline in Michigan: Disease Incidence, causal organism and epidemiology MDRD Hort Fund (791N6) Final report Team leader ndrew M Jarosz Team members: Dennis Fulbright, ert Cregg, and Jill O Donnell
A Rapid One Week Response
A Rapid One Week Response Salmonella Braenderup in Potato Salad Melanie Harris, MPA IA RRT Coordinator Iowa Department of Inspections and Appeals Iowa Food Protection Rapid Response Team (RRT) FDA-funded
Indicate (X) client(s) to whom this final report is submitted. Replace any of these with other relevant clients if required. FINAL REPORT FOR 2012
PlCFPA Canning Fruit Producers Assoc. Submit to: Wiehahn Victor Tel: +27 (0)21 872 1501 inmaak@mweb.co.za SAAPPA / SASPA / SAT Fruitgro Science Submit to: Louise Liebenberg Tel: +27 (0)21 882 8470/1 louise@fruitgro.co.za
MONTHLY COFFEE MARKET REPORT
1 E MONTHLY COFFEE MARKET REPORT March 2014 Ongoing uncertainty over the Brazilian coffee crop has caused significant fluctuations in coffee prices during March, with monthly volatility of the International
Citrus Canker. Nian Wang 11/20/2017
Citrus Canker Nian Wang 11/20/2017 Citrus canker disease and pathogen Xanthomonas citri subsp. citri fruit drop, defoliation, yield losses 5-30%, fruit marketability quarantine restrictions Gottwald 2002
1 Draft Notification of Ministry of Agriculture and Cooperatives Re : Specification of plants from certain sources as prohibited articles, of exceptions and conditions under the Plant Quarantine Act B.E.
Developing Long Term Management Options for Pierce s Disease
Developing Long Term Management Options for Pierce s Disease Jim Kamas Associate Professor & Extension Specialist Texas A&M Agrilife Extension Viticulture & Fruit Lab Fredericksburg, TX Jim Kamas Texas
4C Association: the global platform for sustainable coffee November 14th, 2014 Sintercafe 2014, San Jose, Costa Rica
4C Association: the global platform for sustainable coffee November 14th, 2014 Sintercafe 2014, San Jose, Costa Rica NTENT he 4C Association: Vision and Mission ur 3 main functions & key elements he Entry
Downward correction as funds respond to increasingly positive supply outlook
Downward correction as funds respond to increasingly positive supply outlook Coffee prices fell sharply at the end of April as institutional investors sold off their positions. The coffee market continues
Field and analytical protocol for the evaluation of novel non-lethal techniques in the Japanese whale research programs
Technical Reports of the Institute of Cetacean Research (2018) pp. 50 55 Technical Report (not peer reviewed) Field and analytical protocol for the evaluation of novel non-lethal techniques in the Japanese
MONITORING WALNUT TWIG BEETLE ACTIVITY IN THE SOUTHERN SAN JOAQUIN VALLEY: OCTOBER 2011-OCTOBER 2012
MONITORING WALNUT TWIG BEETLE ACTIVITY IN THE SOUTHERN SAN JOAQUIN VALLEY: OCTOBER 11-OCTOBER 12 Elizabeth J. Fichtner ABSTRACT Walnut twig beetle, Pityophthorus juglandis, is the vector of thousand cankers
Contrasting susceptibilities to Flavescence dorée in wild Vitis species, Vitis vinifera
Contrasting susceptibilities to Flavescence dorée in wild Vitis species, Vitis vinifera cultivars and progenies suggest segregation of genetic traits involved in disease response S. Eveillard, C. Jollard,
Biological impacts caused by the release of the imported manila clam, Ruditapes philippinarum, in Japan
Tidal flat in Japan Biological impacts caused by the release of the imported manila clam, Ruditapes philippinarum, in Japan Naoaki TEZUKA and Masami HAMAGUCHI(FEIS) P-1 Sea grass bed in Japan 1955 1957
Salmonella Chailey outbreak associated with coconut, British Columbia, Canada, 2017
Salmonella Chailey outbreak associated with coconut, British Columbia, Canada, 2017 Marsha Taylor Epidemiologist, British Columbia Centre for Disease Control Salmonella Chailey Salmonella Chailey is a
SEED BREEDING: QUALITY AS AN ASSET
1 ST EUROPEAN SORGHUM CONGRESS WORKSHOP INNOVATIVE RESEARCH TOWARDS GENETIC PROGRESS SEED BREEDING: QUALITY AS AN ASSET Maximising results through genetic diversity, innovation and seed quality Christophe
Information sources: 1, 5
1 The twolined chestnut borer (Agrilus bilineatus) is a pest in the eastern and central United States and some southeastern parts of Canada. They were first noted in the 1900 s due to their infestation