Induction of ethylene in avocado fruit in response to chilling stress on tree

Transcription

1 Journl of Plnt Physiology ] (]]]]) ]]] ]]] Induction of ethylene in vocdo fruit in response to chilling stress on tree Ver Hershkovitz,,, Hy Friedmn, Eliezer E. Goldschmidt, Oleg Feygenerg, Edn Pesis Deprtment of Posthrvest Science of Fresh Produce, The Volcni Center, P.O. Box 6, Bet Dgn 525, Isrel The Roert H. Smith Fculty of Agriculture, Food nd Environment, The Herew University of Jeruslem, Rehovot 761, Isrel Received 14 Decemer 28; received in revised form 1 April 29; ccepted 18 My 29 KEYWORDS Ethylene production; Ethylene receptors; Fruit ripening; Gene expression; Perse mericn Summry Chilling of vocdo fruit (Perse mericn cv. Ard) in the orchrd cused drmtic induction of fruit ripening nd prllel increse in ethylene iosynthesis nd receptor genes expression during shelf life. In-orchrd chilling stress stimulted ethylene nd CO 2 production lredy in fruit ttched to the tree, nd these reduced therefter during 2 1C storge. In non-chilled control fruit, ethylene nd CO 2 production strted fter 3 d t 2 1C nd exhiited climcteric pek. In-orchrd chilling stress lso led to memrne destruction expressed s higher electricl conductivity (EC) in chilling stressed (CS) fruit nd ccelerted softening compred with control fruit. The increse in ethylene production on the dy of hrvest in CS fruit ws ccompnied y high expression of two 1-minocyclopropne-1-croxylic CSd (ACC) synthse genes: PACS1 nd PACS2, nd ACC oxidse PACO. The initil gene expressions of PACS1, PACS2, ndpaco in the CS fruit t the dy of hrvest ws similr to the levels reched y the control fruit fter 4 d t 2 1C. The expression levels of oth PETR nd PERS1 in CS fruit on tree were 25 times higher thn the control. In control fruit, expression of ethylene receptor genes ws very low t hrvest nd incresed in prllel to the onset of the climcteric ethylene pek. PCTR1 trnscript levels were less ffected y chilling stress, nd smll chnges (less thn 3-fold) were oserved in CS fruit on the dy of hrvest. Together, our results suggest tht ethylene iosynthesis nd ethylene response-pthwy genes re involved in regultion of ethylene responsiveness in response to in-orchrd chilling stress nd during ripening. & 29 Elsevier GmH. All rights reserved. Arevitions: ACC, 1-minocyclopropne-1-croxylic cid; CS, chilling stressed; PACO, ACC oxidse; PACS, Perse mericn ACC synthse; PCTR1, constitutive triple response; PERS1, ethylene response sensor; PETR, ethylene receptor. Corresponding uthor t: Deprtment of Posthrvest Science of Fresh Produce, The Volcni Center, P.O. Box 6, Bet Dgn 525, Isrel. Tel.: ; fx: E-mil ddresses: vhershko@gri.gov.il (V. Hershkovitz), epesis@gri.gov.il (E. Pesis) /$ - see front mtter & 29 Elsevier GmH. All rights reserved. doi:1.116/j.jplph Plese cite this rticle s: Hershkovitz V, et l. Induction of ethylene in vocdo fruit in response to chilling stress on tree. J Plnt

2 2 Introduction Avocdo fruit (Perse mericn Mill.) is sutropicl climcteric fruit, which unlike other fruits does not produce ethylene nd does not ripen while ttched to the tree (Bile, 1941; Bower nd Cutting, 1988). Aeles coined the term tree fctor to descrie puttive inhiitor of ethylene production in ttched fleshy fruit (Aeles, 1973). Sutropicl fruits, including vocdo, re sensitive to low temperture, nd chilling injury occurs when the plnts re exposed to tempertures elow 7 1C (Aeles et l., 1992). Cold nights efore hrvesting stimulted ethylene production in Cox Ornge Pippin pple (Streif, 1976). Brtlett per from cooler prehrvest temperture t different loctions exhiited higher ethylene production (Agr et l., 1999). Posthrvest cold temperture ( 1 1C, low-temperture conditioning) stimultes ethylene iosynthesis during susequent ripening t room temperture in pers fruit (Knee, 1987). It hs een reported tht in-orchrd chilling conditions increse the rtes of ethylene production in vocdo fruit 1 d fter hrvest, showing physiologicl chnges of vocdo fruit in connection with chilling stress (Fuchs et l., 1975). It ws recently noted tht low temperture dversely ffects plnt growth y inhiition of wter nd nutrient uptke, chnges in memrne fluidity nd protein nd nucleic cid conformtion (Chinnusmy et l., 27). In vocdo, cold storge nd ethylene ppliction reduced memrne integrity, expressed s higher electricl conductivity (EC) levels, leding to injury nd mesocrp discolortion (Hershkovitz et l., 25, 29). The ethylene iosynthesis pthwy is well estlished in higher plnts nd exhiits two-step regultory control. The first step, ctlyzed y the enzyme 1-minocyclopropne-1-croxylic cid (ACC) synthse (ACS), involves the formtion of ACC from S-denosyl-L-methionine. The second step, ctlyzed y ACC oxidse (ACO), converts this intermedite to ethylene. The expression of ACC synthse genes is deferentilly nd tightly regulted y vrious developmentl, environmentl, nd hormonl signls (Kende, 1993). Trce mounts of ACC nd very low ACS ctivity were found in preclimcteric vocdo fruit. This ws followed y mrked increse during the climcteric rise, reching pek shortly efore the ethylene pek (Sitrit et l., 1986). ACO ctivity, on the other hnd, incresed mrkedly only t the upsurge of ripening ethylene (Owino et l., 22). It ws shown tht cold storge stimulted ACO nd ACS gene expression in pples (Tin et l., 22) nd in pers (El-Shrkwy et l., 24; Fonsec et l., 25). The ethylene hormone is perceived y fmily of integrl memrne receptors, which ct s negtive regultors of the ethylene response pthwy (Hu nd Meyerowitz, 1998; Tiemn et l., 2). The study of ethylene response-pthwy elements nd their expression ptterns hs ecome n importnt spect of fruit ripening studies in vrious fruit species (Owino et l., 22; Wiersm et l., 27). The present study ws crried out to investigte the chnges occurring in softening, memrne integrity, respirtion, ethylene production, nd in genes involved in ethylene iosynthesis, perception nd the signl trnsduction pthwy in vocdo fruit in response to in-orchrd chilling stress. Mteril nd methods Plnt mteril Avocdo fruit plnts (Perse mericn Mill. cv. Ard) were otined from the orchrd of Kiutz Mrot in the centrl costl region of Isrel. Fruits were hrvested from two different plots in the orchrd with low nd regulr night tempertures. Chilling stressed (CS) fruits were hrvested from plot locted t lower level in which low night tempertures ( 3 to 6 1C) occurred for six consecutive nights in Jnury 28, 2 weeks efore hrvest. The non-chilled control fruits were hrvested from plot locted in n elevted plot of the orchrd with regulr night tempertures (8 12 1C). Ethylene nd CO 2 production V. Hershkovitz et l. Individul fruits (4 fruits/tretment) were seled in 2 L glss jrs nd held t 2 1C for 1 h. Hedspce gs smples were then withdrwn using 1 ml syringe from ech jr. Ethylene content nd cron dioxide in the gs smple were determined with gs chromtogrph (GC) s descried y Pesis et l. (1994). The sme mesurements were repeted every dy over 3 5 d t 2 1C. Dy represents moment of the hrvest. Fruit firmness nd electricl conductivity (EC) Fruit firmness (N) ws determined on whole, unpeeled fruit using n electronic penetrometer (LTCM, Chtillon, New York, NY, USA) with 6.5-mm conicl proe. Penetrtion for 12 mm ws performed t two equidistnt points on the equtoril regions of ech fruit with speed of 3 mm s 1. Plese cite this rticle s: Hershkovitz V, et l. Induction of ethylene in vocdo fruit in response to chilling stress on tree. J Plnt

3 3 The EC ws mesured on the two opposite sides of the equtoril region of ech fruit, including the peel, s descried previously (Hershkovitz et l., 25). RNA extrction nd isoltion of cdna frgments Smples designted s zero were collected immeditely fter hrvest in the orchrd nd plced in liquid nitrogen. Totl RNA ws extrcted from the frozen mesocrp tissue using phenol-sds s descried y Or et l. (2). The first strnd cdnas were synthesized y reverse trnscriptse (ABgene, Epson, UK) from 1 mg of totl RNA, pretreted with 1.5 units of RQ1 (Promeg, Mdison, WI, USA). The ethylene receptor PERS1 cdna frgment ws mplified using the specific primers designed ginst PERS1 (Owino et l., 22) nd the PCTR1 cdna frgments of the genes were mplified using the degenerte primers designed on the sis of conserved sequence motifs of the CTR genes. The primers were s follows: PERS1 (F) 5 -GAGCAAAACGCTGCCTTAGAT-3, (R)5 -ATTCCTAA- GACCAACAGCCC-3, PCTR1 (F)5 -GGKGCWGGGTC- WTTTGGKACWGT-3, nd (R)5 -CAAATCACGTGGAA- TCTCAAG-3. Rections were crried out y Mstercycler grdient (Eppendorf, Hmurg, Germny) using the following thermocycling profile: 95 1C for 5 min followed y 35 cycles of 95 1C for 1 min, 56 1C for 1.5 min, 1 min for 72 1C, nd finl extension for 7 min t 72 1C. The PCR products were sucloned into pgem-t Esy vector System I (Promeg, Mdison, WI, USA) nd were sequenced using oth SP6 nd T7 primers (Hy-ls Lortory, Rehovot, Isrel). Sequence dt were deposited in the GenBnk dtse for PCTR1 cdna under ccession numer EU Expression nlysis y quntittive rel-time PCR (qrt-pcr) Accumultion of PACS1 (AF5119), PACS2 (AF512), PACO (M ), PETR (EU37699), PERS1 (AF5121), nd PCTR1 (EU417962), ws evluted y qrt-pcr with Asolute QPCR SYBR Green ROX Mix (ABgene, Epson, UK). Rections were crried out using 5 ml of SYBR Green PCR Mster mix, 2 nm of ech primer in Rotor GENE 6 instrument (Corett Life Science, Sydney, Austrli). Specific primers were s reported in Tle 1. PCR rections were performed under the following conditions: 95 1C for 15 min, nd then 4 cycles nd 1 min t 72 1C. Ech cycle included denturtion t 95 1C for 15 s, nneling t 6 1C for 2 s nd extension t 72 1C for 2 s. The mount of specific trnscript ws clculted following the comprtive C T method (Livk nd Schmittgen, 21). Results nd discussion Ethylene nd CO 2 production The high level of ethylene production in CS fruit reched its mximum vlue of 8 mlkg 1 h 1 immeditely t the moment of hrvest (time ), indicting tht ripening processes hd egun lredy while fruits were ttched to the tree (Figure 1A). CS fruit hd significntly higher respirtion rte thn control fruit (Figure 1B). These dt re in greement of those of Fuchs et l., who showed in other vocdo cultivrs, the sme phenomen of high ethylene nd CO 2 production 1 d fter hrvest in chilling exposed vocdo fruit (Fuchs et l., 1975). In contrst, no ethylene production ws detected in control fruit on the dy of hrvest (Figure 1A), supporting the previous finding tht vocdo in norml growth regimes fils to ripen nd to produce ethylene while ttched to the tree (Bile, 1941; Bower nd Cutting, 1988). The typicl climcteric pek of ethylene ppered on dy 4 fter hrvest nd reched mximum vlue of 12 mlkg 1 h 1 (Figure 1A). This suggests tht puttive inhiition of ethylene production in ttched fruit my e replced entirely or in prt Tle 1. Specific primers used for trnscription nlysis y qrt-pcr mrna. Primer reverse (5 3 ) Primer forwrd (5 3 ) Gene TCACCGTACGCTCCTCGTTT TGATCGGCATACCATCTTGTACA PETR CCCGACAACCAGAATCCTTA ATGGCATGTGTTGAAAAGCA PERS1 AATGCGGCATCCAAACATTG TGGCACCAGCTCTATGCAAA PCTR1 TCCGAAACTCGACATCTTTCG GCCTCTCAAAAGATCTGGGCT PACS1 TTGGGACGAGGAATGCATC GTTCAACCCGGATCGAATAGTTA PACS2 TTTCCACGGCCTTCATCTTC CCGAAATTCGTATTCGAGG PACO TTCCTTTAAGTTTCAGCCTTG GTTACTTTAGGACTCCGCC r18s ACCTGCTGTCACCCACCAAGT CAAAGCTGCAATCAAGGAGGA PGAPDH Plese cite this rticle s: Hershkovitz V, et l. Induction of ethylene in vocdo fruit in response to chilling stress on tree. J Plnt

4 4 V. Hershkovitz et l. Ethylene (µl kg -1 h -1 ) CO 2 (mg kg -1 h -1 ) CS Control Dys t 2 C Figure 1. Ethylene (A) nd CO 2 (B) production in vocdo cv. Ard chilling stressed (CS) s compred with control fruit fter hrvest during 3 5 d of storge t 2 1C. Verticl rs represent SD of four smples. y chilling stress in the orchrd, likely vi stimultion of ethylene iosynthesis. Chilling did hve n effect on ethylene production nd led to reduction in the time to rech the onset of utoctlytic ethylene rise t 2 1C in Breurn pple (Tin et l., 22). Exposure of pers to low temperture ( 1 1C) lso promotes ethylene synthesis nd cron dioxide production in numer of cultivrs (Knee, 1987). Moreover, cold requirements for the development of ripening cpcity in per were dependent on growing seson nd loction, nd per fruits with cooler prehrvest tempertures hd higher ethylene production rtes during ripening (Agr et l., 1999). Fruit firmness nd electricl conductivity Firmness (N) EC (ms cm -1 ) CS Control Chnges in vocdo firmness nd EC re illustrted in Figure 2. The softening of CS fruits ws significntly ccelerted compred with their control counterprts. On the dy of hrvest, the firmness vlue of CS fruit ws 117 N compred with 129 N in control (Figure 2A), indicting tht ripening processes in CS fruit hd strted. CS fruits completed their ripening, nd firmness vlues fell to 6 N fter 3 d t 2 1C, wheres control fruits ecme soft fter 6 d (Figure 2A). Vlues of the derived EC in the equtoril region showed mrked differences etween CS nd control fruit. The EC level in CS fruit t time ws significntly higher thn in control, 1. vs..7 ms cm 1 (Figure 2B), respectively. The first step in the plnt response to low temperture is chnge in memrne rigidity (Chinnusmy et l., 27). In vocdo fruit, it hs een shown tht the EC serves s good indictor of memrne permeility, nd tht it is highly correlted with ethylene production nd with softening (Montoj et l., 1994). The increse in EC in CS fruit lredy t time verifies our previous oservtion showing tht cold storge enhnced the process of memrne destruction in vocdo fruit (Hershkovitz et l., 25) nd the induction of higher EC levels y ethylene tretment (Hershkovitz et l., 29) Dys t 2 C Figure 2. Firmness (A) nd electricl conductivity (B) in vocdo chilling stressed (CS) s compred with control fruit fter hrvest during 3 5 d of storge t 2 1C. Columns with different letter within ech tretment re significntly different (Po.5, n ¼ 16). Plese cite this rticle s: Hershkovitz V, et l. Induction of ethylene in vocdo fruit in response to chilling stress on tree. J Plnt

5 PACS1 CS Control in some cultivrs of pers nd pples fter cold storge (Knee, 1987; Tin et l., 22; El-Shrkwy et l., 24; Fonsec et l., 25). In contrst, PACS1, PACS2, nd PACO trnscript levels in control non-chilled vocdo were very low on the dy of hrvest nd incresed mrkedly during ripening, reching high levels fter 4 d t 2 1C, similr to those of CS fruits t time (Figure 3A C). Thus, the current study verifies previous oservtions, which hve shown detectle expression of vocdo ACS nd ACO genes nd very low ctivity of ACS nd ACO t hrvest tht incresed in correltion 1 PACS2 45 CS Control Trnscript ccumultion PETR PACO Trnscript ccumultion PERS Dys t 2 C Figure 3. Trnscript ccumultion of vocdo ACC synthse PACS1 (A), PACS2 (B), nd ACC oxidse PACO (C) in chilling stressed (CS) nd control fruit fter hrvest during 2 4 d of storge t 2 1C. Vlues hve een normlized to control on dy, ritrrily set to 1. Verticl rs represent SD PCTR1 Expression of genes encoding enzymes involved in ethylene iosynthesis In-orchrd chilling stress significntly induced trnscript ccumultion of PACS1, PACS2, nd PACO on the dy of hrvest, which showed 1 1-fold increse in expression compred with controls (Figure 3A C). Chilling-induced ccumultion of oth ACS nd ACO trnscripts ws found Dys t 2 C Figure 4. Trnscript ccumultion of vocdo cv. Ard ethylene receptors PETR (A), PERS1 (B), nd signl trnsduction element PCTR1 (C) in chilling stressed (CS) nd control fruit fter hrvest during 2 4 d of storge t 2 1C. Vlues hve een normlized to control on dy, ritrrily set to 1. Verticl rs represent SD. Plese cite this rticle s: Hershkovitz V, et l. Induction of ethylene in vocdo fruit in response to chilling stress on tree. J Plnt

6 6 with the eginning of the climcteric rise during ripening (Owino et l., 22). The inility of most vocdo vrieties to produce ethylene s long s they re ttched to the tree results minly from repression of ACS ctivity (Sitrit et l., 1986). This repression could e removed y in-orchrd chilling stress, resulting in the strt of fruit ripening due to n increse in ethylene (Figure 1A). It is possile tht on-tree chilling stress cused inhiition of wter uptke from the prent plnt to the ttched fruit (Chinnusmy et l., 27). Wter stress ws shown to increse ethylene iosynthesis ACS nd ACO genes in the clyx of young persimmon fruit modulted y wter loss from the fruit (Nkno et l., 23). In the orchrd plot in which chilled nights occurred, there were fruits on the ground elow the tree tht ws scised erlier ecuse of chilling stress (dt not shown). Ascission of fruits is well-known phenomen tht occurs due to vrious field stresses, which induce expression of genes modulted y ethylene-signling (Mlldi nd Burns, 28). Also, it ws shown tht smll mounts of ethylene cused significnt drop in scission of vocdo fruitlets (Dvenport nd Mnners, 1982). Expression of genes involved in ethylene perception nd signl trnsduction It is widely pprecited tht oth ethylene iosynthesis nd ethylene perception contriute to the regultion of ethylene responses in plnt tissues. Our dt demonstrte tht chilling stress significntly induced levels oftrnscriptccumultion of oth PETR nd PERS1 genes (Figure 4A ndb). Similr up-regultion effects of cold tretment V. Hershkovitz et l. were found in per (El-Shrkwy et l., 23). The expression levels of oth PETR nd PERS1 in CS fruit on the dy of hrvest were 25 times higher thn the control (Figure 4A nd B). In control nonchilled vocdo fruit, PETR nd PERS1 trnscripts were low t time, up-regulted t the onset of norml ripening, nd correlted with the level of climcteric ethylene production (Figure 1A vs. 4A nd B). A similr expression pttern of ethylene receptors during ripening ws shown in tomto (Klee, 22), vocdo (Owino et l., 22) per (El-Shrkwy et l., 23) nd pple (Ttsuki nd Endo, 26). PERS1 gene expression ws ffected y chilling stress more thn y ripening (Figure 4B), while PETR gene expression ws eqully ffected y chilling stress nd norml ripening (Figure 4A). This indictes tht su-zero temperture ctivted genes in ddition to those ctivted in norml ripening. The PETR gene from vocdo is highly homologous to sufmily-ii ethylene receptor genes from other climcteric fruits: the predicted PETR protein displyed 63% identity to tomto LeETR4, 67% to pple MdETR2, 68% to Chinese per PpETR2, nd 67% to melon CmETR2 protein (Tle 2). LeETR4 trnscripts hve previously een shown to e up-regulted in ripening fruits (Tiemn et l., 2) nd to hve specific role in modulting ethylene responses, including fruit mturtion (Kevny et l., 27). The high PETR nd PERS1 trnscription levels t time in CS fruit my indicte tht these genes hve lredy een produced in the vocdo fruit on the tree, nd the receptor protein degrdtion mnifested in our study y the increse in ethylene receptor trnscript levels leds to ethylene production. Ethylene-medited receptor degrdtion ws demonstrted in tomto chnging from the mture Tle 2. Deduced mino cid identity (%) of vocdo isolted frgment PETR (75 ) with the corresponding regions of ETR sequences of tomto (LeETR4), Aridopsis (AtETR2), pple (MdETR2), Chinese per (PpETR2), nd melon (CmETR2). Gene LeETR4, AAD31396 AtETR2, AAC6228 MdETR2, ABI58286 PpETR2, BAD613 CmETR2, BAF91863 PETR Tle 3. Deduced mino cid identity (%) of vocdo isolted frgment PCTR1 (27 ) with the corresponding regions of CTR1 sequences of tomto (LeCTR1), Aridopsis (AtCTR1), pple (MdCTR1), pech (PdCTR1), nd plum (PsCTR1). Gene LeCTR1, AAR89823 AtCTR1, BAE99212 MdCTR1, ABI58288 PpCTR1, AAY2129 PsCTR1, ABU6827 PCTR Plese cite this rticle s: Hershkovitz V, et l. Induction of ethylene in vocdo fruit in response to chilling stress on tree. J Plnt

7 7 green to the reker stge (Kevny et l., 27). The sequence of frgment of CTR1 encoding predicted polypeptide of 27 mino cid residues ws isolted from vocdo. The predicted protein reveled strong homology (89 91% identity) to CTR protein from other climcteric fruits nd Aridopsis (Tle 3). PCTR1 trnscript expression levels were less ffected y chilling stress nd ethylene-dependent ripening compred with PETR nd PERS1 genes; there ws smll increse (less thn 3-fold) for PCTR1 trnscript ccumultion in CS fruits t time, nd in control fruits t dy 4 (Figure 4C). Pulished dt on the CTR-like genes show rnge of expression chnges with ripening. For instnce, PcCTR1 expression incresed during per ripening nd in response to ethylene tretment (El-Shrkwy et l., 23). In conclusion, our present results show tht inorchrd chilling stress leds to n increse in ethylene production vi stimultion of ethylene iosynthesis nd perception genes, cusing ccelerted ripening nd softening processes in storge. Together, our dt suggest tht chilling stress in the orchrd cn eliminte endogenous signl/s nd might inhiit the trnsport of tree fctor leding to vocdo ripening on the tree. Acknowledgements The uthors would like to thnk Ros Ben-Arie for her excellent technicl ssistnce, Him Arditi nd Br Heffetz from Kiutz Mrot for fruit smpling. This work received contriutions from The Volcni Center, ARO, Isrel, no. 538/8. References Aeles F. Ethylene in plnt iology. New York: Acdemic Press; Aeles F, Morgn P, Sltveit M. Fruit ripening, scission, nd posthrvest disorders. In: Aeles F, Morgn P, Sltveit M, editors. Ethylene in plnt iology. Sn Diego, Cliforni: Acdemic Press; p Agr G, Bisi WV, Mitchm EJ. Exogenous ethylene ccelertes ripening responses in Brtlett pers regrdless of mturity or growing region. Posthrvest Biol Technol 1999;17: Bile JB. The climcteric rise in respirtion rte of the Fuerte vocdo fruit. Proc Am Soc Hortic Sci 1941;39: Bower J, Cutting JG. Avocdo fruit development nd ripening physiology. In: Jnick J, editor. Horticulturl reviews. Portlnd: Timer Press; p Chinnusmy V, Jinhu Z, Zhu J-K. Cold stress regultion of gene expression in plnts. Trends Plnt Sci 27;12: Dvenport TL, Mnners MM. Nucellr senescence nd ethylene production s they relte to vocdo fruitlet scission. J Exp Bot 1982;33: El-Shrkwy I, Jones B, Gentzittel L, Pech JC, Ltché A. Differentil regultion of ACC synthse genes in colddependent nd independent ripening in per fruit. Plnt Cell Environ 24;27: El-Shrkwy I, Jones B, Li ZG, Lelièvre LM, Pech JC, Ltché A. Isoltion nd chrcteriztion of four ethylene perception elements nd their expression during ripening in pers (Pyrus communis L.) with/ without cold requirement. J Exp Bot 23;54: Fonsec S, Monteiro LB, Brreiro MG, Pis MS. Expression of genes encoding cell wll modifying enzymes is induced y cold storge nd reflects chnges in per fruit texture. J Exp Bot 25;418: Fuchs Y, Zuermn G, Ynko U. Freeze injuries in vocdo fruit. HortScience 1975;1:64 5. Hershkovitz V, Friedmn H, Goldschmidt EE, Pesis E. The role of the emryo nd ethylene in vocdo fruit mesocrp discolortion. J Exp Bot 29;6: Hershkovitz V, Sguy SI, Pesis E. Posthrvest ppliction of 1-MCP to improve the qulity of vrious vocdo cultivrs. Posthrvest Biol Technol 25;37: Hu J, Meyerowitz EM. Ethylene responses re negtively regulted y receptor gene fmily in Aridopsis thlin. Cell 1998;94: Kende H. Ethylene iosynthesis. Annu Rev Plnt Physiol Plnt Mol Biol 1993;44: Kevny BM, Tiemn DM, Tylor MG, Cin VD, Klee HJ. Ethylene receptor degrdtion controls the timing of ripening in tomto fruit. Plnt J 27;51: Klee H. Control of ethylene-medited processes in tomto t the level of receptors. J Exp Bot 22;53: Knee M. Development of ethylene iosynthesis in per fruits t 1 1C. J Exp Bot 1987;38: Livk KJ, Schmittgen TD. Anlysis of reltive gene expression dt using rel-time quntittive PCR nd the 2 DDCT method. Methods 21;25:42 8. Mlldi A, Burns JK. CsPLD lph 1 nd CsPLD gmm 1 re differentilly induced during lef nd fruit scission nd diurnlly regulted in Citrus sinensis. J Exp Bot 28;59: Montoj M, Plz J, Lopez-Rodriguez V. Reltionship etween chnges in electricl conductivity nd ethylene production in vocdo fruits. Leens Wissen Technol 1994;27: Nkno R, Ogur E, Kuo Y, In A. Ethylene iosynthesis in detched young persimmon fruit is initited in clyx nd modulted y wter loss from the fruit. Plnt Physiol 23;131: Or E, Vilozny I, Eyl Y, Ogrodovitch A. The trnsduction of the signl for grpe ud dormncy reking, induced y hydrogen cynmide, my involve the SNF-like protein kinse GDBrPK. Plnt Mol Biol 2; 43: Plese cite this rticle s: Hershkovitz V, et l. Induction of ethylene in vocdo fruit in response to chilling stress on tree. J Plnt

8 8 V. Hershkovitz et l. Owino W, Nkno R, Kuo Y, In A. Differentil regultion of genes encoding ethylene iosynthesis enzymes nd ethylene response sensor ortholog during ripening nd in response to wounding in vocdos. J Am Soc Hortic Sci 22;127:52 7. Pesis E, Mrinnsky R, Zuermn G, Fuchs Y. Prestorge low-oxygen tmosphere tretment reduces chilling injury symptoms in Fuerte vocdo fruit. HortScience 1994;29: Sitrit Y, Riov J, Blumenfeld A. Regultion of ethylene iosynthesis in vocdo fruit during ripening. Plnt Physiol 1986;81:13 5. Streif J. Einfluss der temperture uf verschiedene reifemerkmte von pfeln. Eiwersostu 1976;18: Ttsuki M, Endo A. Anlyses of expression ptterns of ethylene receptor genes in pple (Mlus domestic Borkh.) fruit treted with or without 1-methylcyclopropene (1-MCP). J Jpn Soc Hortic Sci 26;75: Tin MS, Prksh S, Zhng N, Ross G. Chilling-induced ethylene iosynthesis in Breurn pples. Plnt Growth Regul 22;38: Tiemn DM, Tylor MG, Cirdi JA, Klee HJ. The tomto ethylene receptors NR nd LeETR4 re negtive regultors of ethylene response nd exhiit functionl compenstion within multigene fmily. Proc Ntl Acd Sci USA 2;97: Wiersm PA, Zhng H, Lu C, Quil A, Toivonen PM. Survey of the expression of genes for ethylene synthesis nd perception during mturtion nd ripening of Sunrise nd Golden Delicious pple fruit. Posthrvest Biol Technol 27;44: Plese cite this rticle s: Hershkovitz V, et l. Induction of ethylene in vocdo fruit in response to chilling stress on tree. J Plnt