Nordic Journal of Botany

Transcription

1 Nordic Journal of Botany NJB Tendal, K., Larsen, B., Ørgaard, M. and Pedersen, C Recurrent hybridization events between Primula vulgaris, and P. elatior (Primulaceae, Ericales) challenge the species boundaries: Using molecular markers to re-evaluate morphological identifications. - Nordic Journal of Botany 2018: e01778 Appendix 1. Map of collection locations. The map shows the eastern part of Denmark and a bit of Sweden with a single location in Scania. Most samples were from the Islands and in the southern Denmark. The label for Kisserup is partly covered by the label for Lejre. Map was drawn using

2 Appendix 2. List of Primula accessions with precise indication of collection location, flower morph, ITS-type (HaeIII and RsaI-digestion profile) and chloroplast type (trnl-type). The accessions from which the trnl-fragments were sequenced are indicated. Accession Species 101 P. digenea 102 P. elatior 103 P. elatior 104 P. digenea 105 P. digenea 106 P. digenea P. elatior 109 P. digenea 110 P. elatior 111 P. elatior P. digenea 114 P. elatior 201 P. elatior 202 P. elatior 203 P. elatior 204 P. elatior 205 P. elatior 206 P. elatior 207 P. elatior P. digenea 210 P. elatior 211 P. digenea 212 P. digenea Locatio n s Klint (MK), Geographica l coordinates Morph HaeIII RsaI for >5 SSR markers for trnl Thrum A CD Homostyle A D Pin D P. elatior Pin A D Thrum A CD Thrum A CD Thrum A C A Pin A CD A D P. elatior Thrum A D Pin A C Thrum A CD Thrum A CD Sanger sequenced Thrum A D P. elatior A D P. elatior P. elatior A D P. elatior A D P. elatior Thrum A D P. elatior Pin A D P. elatior Thrum A C Pin A D Pin A D Thrum Thrum A CD A C Thrum A C

3 Accession Species Location 215 P. elatior 216 P. digenea 217 P. digenea 218 P. elatior 219 P. elatior P. elatior 222 P. digenea P. elatior 302 P. elatior 303 P. elatior 304 P. digenea 305 P. digenea 306 P. elatior 307 P. digenea 308 P. digenea 309 P. digenea P. digenea 313 P. elatior P. elatior 316 P. polyantha 402 P. polyantha 403 P. polyantha 404 P. polyantha 405 P. polyantha 406 P. polyantha Geographical coordinates 54 58'15.8''N 12 33'02.0''E 54 58'15.8''N 12 33'02.0''E 54 58'15.8''N 12 33'02.0''E 54 58'15.8''N 12 33'02.0''E 54 58'15.8''N 12 33'02.0''E 54 58'23.1''N 12 33'02.1''E 54 58'59.9''N 12 31'51.6''E 54 58'59.9''N 12 31'51.6''E 54 58'59.9''N 12 31'51.6''E 54 58'59.9''N 12 31'51.6''E 54 58'59.9''N 12 31'51.6''E Morph HaeIII RsaI for >5 SSR markers for trnl Pin A D P. elatior Pin A CD P. elatior A D P. elatior A D P. elatior Thrum A C Thrum P. elatior A CD P. elatior A CD A D P. elatior P. elatior Thrum A D P. elatior Thrum A CD P. elatior Thrum A CD P. elatior Thrum A D P. elatior Pin A CD P. elatior Pin Pin A CD P. elatior Pin C P. elatior Sanger sequenced Thrum A Thrum A CD Thrum A D P. elatior Pin A C Thrum A D P. elatior Thrum B CD Thrum B CD Homostyle Homostyle B CD B B CD Pin CD

4 Accession Species Location 501 Lejre 502 P. elatior Lejre Købelev Skov (KS), Geographical coordinates 55 35'46.7"N 11 56'06.8"E 55 35'46.7"N 11 56'06.8"E 54 55'57.4"N 11 05'46.0"E 54 55'57.4"N 11 05'46.0"E 54 55'57.4"N 11 05'46.0"E 54 55'57.4"N 11 05'46.0"E 54 55'57.4"N 11 05'46.0"E 54 55'57.4"N 11 05'46.0"E 54 55'57.4"N 11 05'46.0"E 54 55'57.4"N 11 05'46.0"E 54 55'57.4"N 11 05'46.0"E 54 55'57.4"N 11 05'46.0"E Morph HaeIII RsaI for >5 SSR markers for trnl B D P. elatior C A C A C B D B D B D B D B D B D B D B D B B D C C A C Sanger sequenced

5 Accession Species Location P. polyantha P. digenea P. polyantha 539 P. polyantha P. polyantha 542 P. digenea 543 P. elatior Tjennemarke Skov (TS), 544 P. elatior TS, 545 P. elatior TS, 546 P. elatior TS, 547 P. elatior TS, 548 P. elatior TS, 549 P. elatior TS, 550 P. elatior TS, 551 P. elatior TS, 552 P. elatior TS, P. polyantha 707 P. polyantha Kisserup, Zealand Kisserup, Zealand Geographic al coordinates 54 55'58.0"N 11 05'45.5"E 54 56'02.6"N 11 05'43.0"E 54 48'32.9"N 11 20'47.6"E 54 48'32.9"N 11 20'47.6"E 54 48'32.9"N 11 20'47.6"E 54 48'32.9"N 11 20'47.6"E 54 48'32.9"N 11 20'47.6"E 54 48'32.9"N 11 20'47.6"E 54 48'32.9"N 11 20'47.6"E 54 48'32.9"N 11 20'47.6"E 54 48'32.9"N 11 20'47.6"E 54 48'32.9"N 11 20'47.6"E 55 35'39.1"N 11 56'46.0"E 55 35'39.1"N 11 56'46.0"E 54 58'15.5''N 12 33'04.1''E 54 58'15.5''N 12 33'04.1''E 54 58'16.0''N 12 33'04.7''E 54 58'16.0''N 12 33'04.7''E 54 58'16.0''N 12 33'04.7''E 54 58'17.7''N 12 33'02.4''E 54 58'17.7''N 12 33'02.4''E Morph HaeIII RsaI Homostyle for >5 SSR markers for trnl CD Thrum A C Pin Pin A Pin CD Pin B CD Pin C Thrum B CD Pin Pin A D P. elatior P. elatior Sanger sequenced A D P. elatior P. elatior A D P. elatior A D P. elatior P. elatior A D P. elatior A D P. elatior B D D B Pin B CD

6 Accession Species Location P. polyantha 714 P. polyantha 715 P. polyantha 716 P. polyantha 717 P. polyantha 718 P. polyantha Nexelø 802 Nexelø 803 Nexelø 901 Samsø 902 Samsø 903 Samsø 904 Samsø Geographical coordinates 54 58'17.7''N 12 33'02.4''E 54 58'17.4''N 12 33'02.1''E 54 58'17.4''N 12 33'02.1''E 54 58'22.9''N 12 33'02.6''E 54 58'22.9''N 12 33'02.6''E 54 58'22.9''N 12 33'02.6''E 54 58'22.9''N 12 33'02.6''E 54 58'22.9''N 12 33'02.6''E 54 58'22.9''N 12 33'02.6''E 54 58'23.2''N 12 33'02.0''E 54 58'23.2''N 12 33'02.0''E 54 58'23.2''N 12 33'02.0''E 54 58'36.7''N 12 32'53.8''E 54 58'36.7''N 12 32'53.8''E 54 59'24.3''N 12 32'26.9''E 54 59'23.0''N 12 32'20.1''E 54 59'23.0''N 12 32'20.1''E 54 59'23.0''N 12 32'20.1''E 54 59'23.0''N 12 32'20.1''E 54 59'23.0''N 12 32'20.1''E 54 59'23.0''N 12 32'20.1''E 54 59'23.0''N 12 32'20.1''E 54 59'23.0''N 12 32'20.1''E 54 59'23.0''N 12 32'20.1''E 54 59'23.0''N 12 32'20.1''E 55 46'31.9"N 11 17'30.6"E 55 46'21.8"N 11 17'36.7"E 55 46'22.0"N 11 17'40.2"E 55 46'11.4"N 10 33'04.9"E 55 46'11.4"N 10 33'04.9"E 55 46'11.4"N 10 33'04.9"E 55 46'11.4"N 10 33'04.9"E Morph HaeIII RsaI for >5 SSR markers for trnl Sanger sequenced B D Thrum B D Thrum Pin CD Pin B CD Thrum CD Pin B Pin Pin B Pin B Pin B B B B D D B B B

7 Accession Species Location 905 Samsø 906 Samsø 907 Samsø 908 Samsø 909 Samsø 910 Samsø 1001 Tågarp, Scania, Sweden (Scania) 1002 Scania 1003 Scania 1004 Scania 1005 Scania 1006 Scania P. elatior 1202 P. elatior Tokkekøb Hegn (TK), Zealand TK, Zealand TK, Zealand Vestvolden, Zealand Vestvolden, Zealand Geographical coordinates 55 46'11.4"N 10 33'04.9"E 55 46'11.4"N 10 33'04.9"E 55 46'11.4"N 10 33'04.9"E 55 46'11.4"N 10 33'04.9"E 55 46'11.4"N 10 33'04.9"E 55 46'11.4"N 10 33'04.9"E 55 56'16.7"N 13 01'10.3"E 55 56'16.7"N 13 01'10.3"E 55 56'16.7"N 13 01'10.3"E 55 56'16.7"N 13 01'10.3"E 55 56'16.7"N 13 01'10.3"E 55 56'16.7"N 13 01'10.3"E 55 53'33.9"N 12 23'17.9"E 55 53'33.5"N 12 22'56.2"E 55 53'28.8"N 12 23'02.6"E 55 39'06.0"N 12 25'33.9"E 55 39'06.0"N 12 25'33.9"E Morph HaeIII RsaI for >5 SSR markers for trnl B B B B B B B B B B D B D P. elatior A D P. elatior Sanger sequenced

8 Appendix 3. Development of a species-specific TrnL-marker. Alignment of TrnL-sequences from Primula vulgaris, P. elatior and with the primers sites for amplification of the part including the InDels indicated. The length of the PCR products with the two indicated primers are as follows: : bp, P. elatior: bp and : bp. When the M13-tail is added to the forward primer and the M13-primer is included for fluorescence detection the final products are about 20 bp longer. The sequences were obtained from NCBI ( and the accessions are described in Mast et al. (2001), Bremer et al. (2002), Schneeweiss et al (2004), Trift et al. 2004), Mast et al. (2004), Suteu et al. (2011), and Kajtoch et al. 2015). Alignment was done with Multalin ( ATTTCAGAAAGGATGCAAAGAT AGAAGAATTGTTGCGAATCGA

9 Appendix 4. PCR-primer list Primers Use Sequence (5' 3') ITS1 CAPS 1 TCCGTAGGTGAACCTGCGG ITS4 CAPS CTCCGCTTATTGATATGC M13- tail 4 Annealing temperature C Repeat motif (bp) Expected product length (bp) 5 Source No 55 C (undigested) White et al. (1990) No 55 C White et al. (1990) TrnL196-F LP 2) ATTTCAGAAAGGATGCAAAGAT 55 C Ve: , Vu , E: GenBank sequences TrnL325-R LP TCGATTCGCAACAATTCTTCT 55 C GenBank sequences PRIV-4-F SSR 3 CACGACGTTGTAAAACGACACTCTTCTTGTTCCTCTCCCA 55 C GT Vu: ; E: Van Geert et al. (2006) PRIV-4-R SSR ACCTAGTTCCTCGCTCCACA Van Geert et al. (2006) PRIV-6-F SSR CACGACGTTGTAAAACGACATCTGTTTCTTAGGTGTGTGG 55 C GT Vu: Van Geert et al. (2006) PRIV-6-R SSR ACAAGTAACAACACAATGATG Van Geert et al. (2006) PRIV-7-F SSR CACGACGTTGTAAAACGACGATTCCAACAACTACGGTTCA 55 C GT Vu: ; E: Van Geert et al. (2006) PRIV-7-R SSR CAATGAAAATCTACATGTTACG Van Geert et al. (2006) Paca-11-F SSR CACGACGTTGTAAAACGACTTCGTGATGAAGTTGACTTTTATG TC Vu: ; E: 94-98; Ve: Seino et al. (2014) Paca-11-R SSR AAACAGCAATATCAGAGTCCAGA Seino et al. (2014) Paca-78-F SSR CACGACGTTGTAAAACGACTGTGCGACTGCCTCTATCTC CT Vu: ; E: ; Ve: Seino et al. (2014) Paca-78-R SSR GACTGAGAAGACATATGTTGAAAGA Seino et al. (2014) PV23424-F SSR CACGACGTTGTAAAACGACGCAGTGGATGGGTATGAAAG 10 60s at 57 C; 28 30s at 55 C CAA 170 Bickler et al. (2013) PV23424-R SSR GTGGTAGCTTCTTGTTCAGGG Bickler et al. (2013) PV4767-F SSR CACGACGTTGTAAAACGACTGGTATTTCTTCTGCTTCTTTGC 10 60s at 57 C; 28 30s at 55 C CTT 116 Bickler et al. (2013) PV4767-R SSR ACGGCTAAAGTACCACCACC Bickler et al. (2013) PV279-F SSR CACGACGTTGTAAAACGACGTCCACCACCCTCTTATCCG 10 60s at 57 C; 28 30s at 55 C TG 134 Bickler et al. (2013) PV279-R SSR CCTCGAGTTGGAGTACTTGC Bickler et al. (2013) PV26720-F SSR CACGACGTTGTAAAACGACACTCGGCCAATGAAAGCAAC 10 60s at 57 C; 28 30s at 55 C TG 243 Bickler et al. (2013) PV26720-R SSR AGTCTTGACACACCTTTTGCC Bickler et al. (2013) PV19773-F SSR CACGACGTTGTAAAACGACTTCAATTTCTGTGAAGGCTGG 10 60s at 57 C; 28 30s at 55 C GTT 220 Bickler et al. (2013) PV19773-R SSR TCGGGATATGCCAATCAATGC Bickler et al. (2013) 1 CAPS: Cleaved amplified polymorphic sequence, 2 LP: Length Polymorphism, 3 SSR: Simple sequence repeat, 4 M13-tail: CACGACGTTGTAAAACGAC, 5 Vu:, E: P. elatior, Ve:

10 Appendix 5. Development of ITS-CAPS markers for species and hybrid identification. Alignment of three ITS sequences representing Primula vulgaris, and P. elatior with the SNPs developed into CAPS-markers (underlined) using the enzymes HaeIII recognising GGCC (in red) and RsaI recognising GTAC in blue. HaeIII HaeIII RsaI RsaI Abbreviations used on the following pages for the subspecies: Pvu: ssp. vulgaris Pvu-sib: ssp. sibthorpii Pvu-bal: ssp. balearica Pvu-het: ssp. heterochroma Pve: ssp. veris Pve-col: ssp. columnae Pve-mac: ssp. macrocalyx Pve-can: ssp. canescens Pe: P. elatior ssp. elatior Pe-pse: P. elatior ssp. pseudoelatior Pe-leu: P. elatior ssp. leucophylla Pe-lof: P. elatior ssp. lofthousei Pe-int: P. elatior ssp. intricata Pe-cor: P. elatior ssp. cordifolia Pe-pal: P. elatior ssp. pallasii

11 Appendix 5-continued. Development of ITS-CAPS markers for species and hybrid identification. Partial alignment of 118 ITS sequences from Primula vulgaris, and P. elatior and their subspecies. The SNP marked with an arrow is converted into a CAPSmarker with the restriction enzyme HaeIII recognising GGCC. All sequences obtained from NCBI ( acc. numbers indicated.

12 Appendix 5-continued. Partial alignment of 118 ITS sequences from Primula vulgaris, and P. elatior and their subspecies. The SNP marked with an arrow can be converted into a CAPS-marker with the restriction enzyme RsaI recognising GTAC. All sequences obtained from NCBI ( acc. numbers indicated.

13 Appendix 6. List of references for PCR-primers and DNA sequences Bickler, C., A Hara, S., Cottrell, J., Rogers, L., and Bridle, J Characterisation of thirteen polymorphic microsatellite markers for cowslip (Primula veris L.) developed using a 454 sequencing approach. Conservation Genetic resources 5: Bremer, B., Bremer, K., Heidari, N., Erixon, P., Olmstead, R.G., Anderberg, A.A., Kallersjo, M. and Barkhordarian, E Phylogenetics of asterids based on 3 coding and 3 non-coding chloroplast DNA markers and the utility of non-coding DNA at higher taxonomic levels. Mol. Phylogenet. Evol. 24: Mast, A., Kelso, S., Richards, A., Lang, D., Feller, D., & Conti, E Phylogenetic Relationships in Primula L. and Related Genera (Primulaceae) Based on Noncoding Chloroplast DNA. International Journal of Plant Sciences, 162: Mast, A. R., Feller, D. M. S., Kelso, S. and Conti E Buzz-pollinated Dodecatheon originated from within the heterostylous Primula subgenus Auriculastrum (Primulaceae): a seven-region cpdna phylogeny and its implications for floral evolution. Am. J. Bot. June 91: Schneeweiss, G.M., Schönswetter, P., Kelso, S. and Niklfeld, H Complex biogeographic patterns in Androsace (Primulaceae) and related genera: Evidence from phylogenetic analyses of nuclear internal transcribed spacer and plastid trnl-f sequences. Systematic Biology 53: Seino, M.M., de Vega, C., Bazaga, P., Jacquemyn, H. and Herrera, C. M Development and characterization of microsatellite loci for the primrose Primula vulgaris and successful cross-amplification in the congeneric P. elatior and. Conservation Genet Resour 6: Şuteu, D., Puşcaş, M., Băcilă, I., Coste, A., Filipaş, L., Stoica, A., Hurdu, B.-I., Ursu, T. and Coldea, G Does Primula intricata Gren. Et Godr. Merit Species Rank? A Taxonomic Revision Based on nrdna, cpdna and AFLP Data. Notulae Botanicae Horti Agrobotanici Cluj-Napoca 39: Trift, I., Liden, M. and Anderberg, A.A.A Phylogeny and Biogeography of Dionysia (Primulaceae). Int. J. Plant Sci. 165: Van Geert, A., Van Rossum, F., Stiers, I., Sierens, T., Barker, J., and Triest, L Isolation and characterization of microsatellite loci in primrose (Primula vulgaris). Belgian Journal of Botany 139: White, T.J., Bruns, T., Lee, S. and Taylor, J Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics. In: Innis, M., Gelfand, D., Sninsky, J. and White, T.J. (eds.) PCR protocols: a guide to methods and application. Academic Press, San Diego, California, USA.

14 Appendix 7. ITS-markers. The table summarizes the distribution of alleles for the two CAPS-markers for the ITS-locus among the Primula species and subspecies. It shows that the markers are suitable for species identifications, but there are some accessions with deviating types. HaeIII-CAPS marker G A Identity of exceptions ) 1) ssp. vulgaris: 1 4 2) 35 2) ssp. veris: 3 ssp. columnae: 1 P. elatior ) 3) P. elatior ssp. pseudoelatior: 1 P. elatior ssp. pallasii: 2 P. elatior ssp. intricata: 1 P. elatior ssp. leucophylla: 1 P. elatior ssp. elatior: 1 RsaI-CAPS marker C A T Y Identity of exceptions ) 9 2) 1 1) ssp. vulgaris 2) ssp. sibthorpii: 6 ssp. vulgaris: 3 2 3) 37 3) ssp. veris: 2 P. elatior 13 4) 24 4) P. elatior ssp. pseudoelatior: 5 P. elatior ssp. meyeri: 7 P. elatior ssp. cordifolia: 1

15 Appendix 8. SSR-markers. Number of alleles, expected heterozygosity and polymorphic information content in species and hybrids for each SSR marker P. P. P. P. H PIC elatior vulgaris digenea polyantha Paca Paca PRIV PRIV PRIV PV PV PV PV PV Ʃ

16 Appendix 9. PCoAs of species and hybrids. A: and it hybrid P. polyantha, B: and its hybrids and C: P. elatior and its hybrid, P. digenea. Principal coordinates (PCoA) of and P. polyantha Coord A veris veris Samsø veris polyantha Scania veris polyantha Coord. 1

17 Appendix 9 B and C Principal coordinates (PCoA) of and hybrids vulgaris vulgaris B Coord. 2 polyantha polyantha digenea Coord. 1 Principal coordinates (PCoA) of P. elatior and digenea Digenea elatior elatior C Coord Coord. 1

18 Appendix 10. Analyses of molecular variance (AMOVAs) for P. polyantha (A) and for each Primula species (B E) showing how the molecular variance is distributed within and among populations. Percentages of Molecular Variance P. polyantha A Among Pops 16% Percentages of Molecular Variance P. elatior B Among Pops 13% Within Pops 84% Within Pops 87% Percentages of Molecular Variance, and only Percentages of Molecular Variance, all populations C Among Pops 25% D Among Pops 22% Within Pops 75% Within Pops 78% Percentages of Molecular Variance E Among Pops 10% Within Pops 90%

19 Appendix 11. Genomic cline plots from the INTROGRESS analysis for 10 SSRmarkers for P. digenea with the parental species P. elatior as parent 1 set as 0 and as parent 2 set as 1. Locus designation and P-values for each locus are indicated. Solid coloured regions represent the 95% confidence intervals for the P. elatior (dark green and solid line) and the P. digenea (light green and dashed line) genotypes. The circles indicate the raw genotypic data (P1/P1 on the top line, P1/P2 in the middle and P2/P2 on the bottom line) with the numbers shown to the right. The hybrid index (x-axis) quantifies the fraction of alleles from the population across all 10 markers. Hybrid index Hybrid index Hybrid index Hybrid index Hybrid index Hybrid index Hybrid index Hybrid index Hybrid index Hybrid index

20 Appendix 11. Genomic cline plots from the INTROGRESS analysis for 10 SSRmarkers for P. polyantha with the parental species as parent 1 set as 0 and as parent 2 set as 1. Locus designation and P-values for each locus are indicated. Solid coloured regions represent the 95% confidence intervals for the (dark green and solid line) and the P. polyantha (light green and dashed line) genotypes. The circles indicate the raw genotypic data (P1/P1 on the top line, P1/P2 in the middle and P2/P2 on the bottom line) with the numbers shown to the right. The hybrid index (x-axis) quantifies the fraction of alleles from the population across all 10 markers. Hybrid index Hybrid index Hybrid index Hybrid index Hybrid index Hybrid index Hybrid index Hybrid index Hybrid index Hybrid index