Genetic variation of dipterocarps: from molecular phylogenies to the identification of the origin of timber

Transcription

1 Genetic variation of dipterocarps: from molecular phylogenies to the identification of the origin of timber Reiner Finkeldey, Oliver Gailing, Iskandar Siregar, Ulfah Siregar, Randy Villarin, Cuiping Cao, Nga Phi Nguyen, Hani Nuroniah, Yanti Rachmayanti 1 Büsgen Institute Forest Genetics and Forest Tree Breeding

2 Structure of presentation l Background Dipterocarpaceae l Interspecific variation: molecular phylogeny of Dipterocarpaceae l Intraspecific variation of selected Shorea spp. l Application: Molecular methods to trace the origin of wood l Conclusions and outlook l Literature 2

3 Background: Dipterocarpaceae The pantropical distribution of Dipterocarpaceae Monotoideae Dipterocarpoideae Pakaraimoideae 3 3 Genera; 40 Species 13 Genera; 470 Species 1 Genus; 1 Species

4 Background: Dipterocarpaceae Dipterocarpoideae in insular Southeast-Asia Phylogenie der Dipterocarpaceae 4 Number of endemic species Number of non-endemic species

5 Background: Dipterocarpaceae Dipterocarpoideae in Southeast-Asia 5 l l l l Widely distributed Mainland and insular SE-Asia Dominating lowland rainforests and monsoon forests in SE-Asia 50-80% of wood volume Keystone group Important timber species Trade name: Meranti, Balau, Keruing, Kapur Many endangered taxa Dipterocarp forest on Borneo

6 Background: Dipterocarpaceae Dipterocarp: growth habit l Medium-sized emergent trees Mainly climax species Often long, straight boles Slow to fast growth 6 Dipterocarpus condoriensis Shorea selanica (<60 years)

7 Background: Dipterocarpaceae Dipterocarpaceae Reproductive biology l Hermaphrodites l Zoogamous (mainly insect- pollinated) Bees, butterflies Thrips l Self compatible, mixed mating system t typical 60-90% 7 Dipterocarpus condoriensis

8 Background: Dipterocarpaceae Dipterocarp fruits l Typical 2 (0-5) winged diaspores Medium-sized to very large l recalcitrant l No efficient means of seed dispersal 8

9 Background: Dipterocarpaceae Exploitation of dipterocarps Local International 9

10 Hintergrund: Dipterocarpaceae Use of dipterocarps By-products Wood window frames charcoal furniture plywood 10 resin

11 Phylogeny of Dipterocarpaceae Order: Malvales; Family Dipterocarpaceae l l l l Blume (1825): related to Tiliaceae Cronquist (1968) & Takhtajan (1969): Theales Dahlgren (1975): Malvales Maguire et al. (1977), Dayanandan et al. (1999): Malvales (Sarcolaenaceae) l Chase et al. (1993); Alverson et al. (1998); Bayer et al., (1999): Malvales (Bombacaceae, Tiliaceae, Sterculiaceae and Malvaceae) 11

12 Phylogeny of dipterocarps Malvales; family Dipterocarpaceae rbcl sequences 12 (nach CHASE et al., 1993)

13 Material Material for studies on inter- and intraspecific variation l l Over 3000 samples from dipterocarps in SE-Asia Dried leaves l Silica gel l Long-term storage at -60 C Extracted DNA Herbarium material maintained l Mainly with partners Total of 116 species All genera of Dipterocarpoideae From six countries l More than 40 locations l Focus on Indonesia (>2500 samples) Mainly natural forests (>80%), few plantations, arboreta, botanical gardens 13

14 Phylogeny of Dipterocarpaceae Methods: cpdna polymorphisms (Indrioko et al., 2006) PCR-RFLP ofcpdna regions : trnlf, rbcl, petb, psba, psaa (Tsumura et al., 1996) cpssrs (Microsatellites): ccmp2, ccmp6, ccmp10 (Weising et al., 1999) Sequences: trnl; trnlf trnl region 14 PCR RFLPs cpssrs Sequences

15 Outgroup: Upuna Outgroup: Monotes < < Upuna borneensis Cotylelobium lanceolatum Vatica bantamensis Vatica bella Vatica granulata Vatica pauciflora Vatica rassak Vatica venulosa Anisoptera costata Anisoptera marginata Anisoptera reticulata Dipterocarpus grandiflorus Dipterocarpus oblongifolius Dipterocarpus retusus Dipterocarpus rigidus Dipterocarpus tempehes Dryobalanops aromatica Dryobalanops lanceolata Hopea bancana Hopea celebica Hopea odorata Hopea sangal Hopea dryobalanoides Hopea nigra Hopea griffithii Hopea mengarawan Parashorea lucida Parashorea globosa Shorea blumutensis Shorea guiso Shorea montigena Shorea scaberrima Shorea seminis Shorea acuminata Shorea andulensis Shorea javanica Shorea johorensis Shorea leprosula Shorea macroptera Shorea mecistopteryx Shorea ovalis Shorea palembanica Shorea parvifolia Shorea platyclados Shorea xanthophylla Shorea balangeran Shorea selanica Shorea splendida Shorea macrophylla Shorea pinanga Shorea stenoptera Shorea acuminatissima Shorea dasyphylla Shorea faguetiana Shorea multiflora Shorea fallax Shorea materialis Shorea virescens < < < < Monotes kerstingii Cotylelobium lanceolatum Upuna borneensis Anisoptera costata Anisoptera marginata Anisoptera reticulata Vatica bantamensis Vatica bella Vatica granulata Vatica pauciflora Vatica rassak Vatica venulosa Dipterocarpus grandiflorus Dipterocarpus oblongifolius Dipterocarpus retusus Dipterocarpus rigidus Dipterocarpus tempehes Dryobalanops aromatica Dryobalanops lanceolata Hopea bancana Hopea celebica Hopea odorata Hopea sangal Hopea dryobalanoides Hopea nigra Hopea griffithii Hopea mengarawan Parashorea lucida Parashorea globosa Shorea blumutensis Shorea guiso Shorea montigena Shorea scaberrima Shorea seminis Shorea acuminata Shorea andulensis Shorea javanica Shorea johorensis Shorea leprosula Shorea macroptera Shorea mecistopteryx Shorea ovalis Shorea palembanica Shorea parvifolia Shorea platyclados Shorea xanthophylla Shorea balangeran Shorea selanica Shorea splendida Shorea macrophylla Shorea pinanga Shorea stenoptera Shorea acuminatissima Shorea dasyphylla Shorea faguetiana Shorea multiflora Shorea fallax Shorea materialis Shorea virescens

16 Phylogeny of Dipterocarpaceae Diagnostic characters of endemic species < <50 < < Monotes kerstingii Cotylelobium lanceolatum Upuna borneensis Anisoptera costata Anisoptera marginata Anisoptera reticulata Vatica bantamensis Vatica bella Vatica granulata Vatica pauciflora Vatica rassak Vatica venulosa Dipterocarpus grandiflorus Dipterocarpus oblongifolius Dipterocarpus retusus Dipterocarpus rigidus Dipterocarpus tempehes Dryobalanops aromatica Dryobalanops lanceolata Hopea bancana Hopea celebica Hopea odorata Hopea sangal Hopea dryobalanoides Hopea nigra Hopea griffithii Hopea mengarawan Parashorea lucida Parashorea globosa Shorea blumutensis Shorea guiso Shorea montigena Shorea scaberrima Shorea seminis Shorea acuminata Shorea andulensis Shorea javanica Shorea johorensis Shorea leprosula Shorea macroptera Shorea mecistopteryx Shorea ovalis Shorea palembanica Shorea parvifolia Shorea platyclados Shorea xanthophylla Shorea balangeran Shorea selanica Shorea splendida Shorea macrophylla Shorea pinanga Shorea stenoptera Shorea acuminatissima Shorea dasyphylla Shorea faguetiana Shorea multiflora Shorea fallax Shorea materialis Shorea virescens Upuna borneensis Anisoptera reticulata Shorea fallax

17 Phylogeny of Dipterocarpaceae Phylogeny of tribe Dipterocarpae l Based on sequence variation of two cpdna regions trnl Intron trnl-f intergenic spacer 17 (Nga, 2009)

18 Phylogeny of Dipterocarpaceae Molecular phylogeny based on AFLPs 18 1 Dipterocarpus retusus Dipterocarpus oblongifolius Dipterocarpus rigidus Dipterocarpus tempehes Dipterocarpus glandiflorus 1 Dipterocarpus glandiflorus 2 Anisoptera reticulata Anisoptera marginata Anisoptera costata 1 Anisoptera costata 2 Cotylelobium lanceolatum Upuna borneensis Vatica bantamensis 1 Vatica bantamensis 2 Vatica venulosa Vatica bella Vatica granulata Vatica rassak Vatica pauciflora 1 Vatica pauciflora 2 Hopea celebica Hopea bancana 1 Hopea bancana 2 Hopea sangal 1 Hopea sangal 2 Hopea griffithii Hopea nigra Hopea dryobalanoides 1 Hopea dryobalanoides 2 Hopea mengarawan 1 Hopea mengarawan 2 Parashorea lucida Parashorea globosa Hopea odorata 1 Hopea odorata 2 Shorea seminis Shorea macroptera Shorea montigena Shorea andulensis Shorea balangeran Shorea selanica 1 Shorea selanica 2 Shorea xanthophylla 1 Shorea xanthophylla 2 Shorea materialis Shorea macrophylla 1 Shorea macrophylla 2 Shorea splendida 1 Shorea splendida 2 Shorea mecistopteryx 1 Shorea mecistopteryx 2 Shorea mecistopteryx 3 Shorea scaberrima Shorea palembanica 1 Shorea palembanica 2 Shorea leprosula 1 Shorea leprosula 2 Shorea parvifolia 1 Shorea parvifolia 2 Shorea guiso 1 Shorea guiso 2 Shorea platyclados 1 Shorea platyclados 2 Shorea ovalis 1 Shorea ovalis 2 Shorea faguetiana Shorea acuminatissima Shorea javanica Shorea johorensis 1 Shorea johorensis 2 Shorea blumutensis 1 Shorea blumutensis 2 Shorea acuminata 3 Shorea acuminata 1 Shorea acuminata 2 Dryobalanops aromatica Dryobalanops lanceolata 1 Dryobalanops lanceolata 2 Shorea virescens 1 Shorea virescens 2 The phylogeny based on morphology and cpdna variation is also reflected at AFLPs, indicating genome-wide differentiation pattern congruent with variation at cpdna (from CAO et al., 2006a)

19 Intraspecific diversity in Indonesian Shorea spp. Sampling locations Indonesia Sumatra Borneo SLB (7, 8, 9, 10, 11) NS (1, 2, 3, 4, 5, 6) Java 19

20 Diversity within Shorea species Genetic diversity within populations of nine Shorea species in Indonesia at AFLP loci Pop. ID Distribution Sample size Polymorphic loci PPL n a n e H e I 1. Spar_NS common % Sacu_NS common % Sdas_NS scattered % Sblu_NS rare % Slep_NS common % Smac_NS common % Mean % Spar_SLB common % Slep_SLB common % Spal_SLB common % Splat_SLB common % Sjoh_SLB common % Mean % Notes: Information of species distribution on islands was obtained from Newman et al. (1996a; 1996b). PPL, percentage of phenotypically polymorphic loci; n a, observed number of alleles per locus; n e, effective number of alleles per locus; H e, Nei s (1973) gene diversity; I, Shannon's information index [Lewontin (1972)]. (from Cao et al., 2009)

21 Intraspecific variation Intraspecific diversity common, widespread species Shorea leprosula and S. parvifolia BB IB TJS TS NS PS AS KB SB SmB BaB TB BkB MtB WkB HJ, DJ 21 CJ

22 Intraspecific variation Variation within species Species N PPL (%) H e H t H s G st S. parvifolia S. leprosula ,1973 0,3062 0,1973 0,1362 0, ,64 0,2404 0,3788 0,2404 0,1814 0, N: sample size PPL. Percentage of polymorphic loci H e : Nei's (1973) gene diversity Shannon's Information index H t : Total variation H S : Variation within populations G ST : Differentiation among populations (Cao et al, 2006b)

23 Intraspecific variation Genetic differentiation among populations G st for AFLP markes in Shorea leprosula 0,8 0,6 0,4 0, G st for AFLP markers in Shorea parvifolia ,8 0,6 0,4 0,

24 Intraspecific variation Conversion of AFLP bands to SCAR markers SUMATRA 427 GATACAGGGCAGCAATCACATGGATAGACTCAGCAGCTAATGGATAATTTTAGGCTTAAAGGGGGCTATCACATACCAAAAGTTCAGCAAGTAAGGCCGG BORNEO 421 GATACAGGGCAGCAATCACATGGATAGACTCAGCAGCTAATGGATAATTTTAGGCTTAAAGGGGGCTATCACATACCAAAAGTTCAGCAAGTAAGGCCGG BORNEO 418 GATACAGGGCAGCAATCACATGGATAGACTCAGCAGCTAATGGATAATTTTAGGCTTAAAGGGGGCTATCACATACCAAAAGTTCAGCAAGTAAGGCCGG BORNEO 409 GATACAGGGCAGCAATCACATGGATAGACTCAGCAGCTAATGGATAATTTTAGGCTTAAAGGGGGCTATCACATACCAAAAGTTCAGCAAGTAAGGCCGG SUMATRA 427 AGCTGGCAGGTTTGGGGGAGAGCCGGCGGGAAGTGCTGGGAAATTTAGGGGAATCTACCGAAAATTGGGWGGAACCAAGAGAAATTAGAGTAAACCCAAG BORNEO 421 AGCTGGCAGGTTTGGGGGAGAGCCGGCGGGAAGTGCTGGGAAATTTAGGGGAATCTACCGAAAATTGGGAGGAACCAAGAGAAATTAGAGTAAACCCAAG BORNEO 418 AGCTGGCAGGTTTGGGGGAGAGCCGGCGGGAAGTGCTGGGAAATTTAGGGGAATCTACCGAAAATTGGGAGGAACCAAGAGAAATTAGAGTAAACCCAAG BORNEO 409 AGCTGGCAGGTTTGGGGGAGAGCCGGCGGGAAGTGCTGGGAAATTTAGGGGAATCTACCGAAAATTGGGAGGAACCAAGAGA AAACCCAAG SUMATRA 427 CTAATTCAAGGAAGAACAAAGGAATTAGTGGCTGTTTCTTACCCAAAAATTTGAAGAATTCACACCCACACAATGAAGAGCAGTRGATAGAAATAGAAGT BORNEO 421 CTAATTCAAGGAAGAACAAAGGAATTAGTGGCTGTTTCTTACCCAAAAATTTGAAGAATTCACACCCACACAATGAAGAGCAGTAGATAGAA------GT BORNEO 418 CTAATTCAAGGAAGAACAAAGGAATTAGTGGCTGTTTCTTACCCAAAAAT---AAGAATTCACACCCACACAATGAAGAGCAGTAGATAGAA------GT BORNEO 409 CTAATTCAAGGAAGAACAAAGGAATTAGTGGCTGTTTCTTACCCAAAAAT---AAGAATTCACACCCACACAATGAAGAGCAGTAGATAGAA------GT EcoRI SUMATRA 427 AACAGAGCAGAGCAGATCCTGAATTTCTCTGCAGGGGGGAGGTTTCAAGGCTCCAAATCTTGTTCTTGAACAAGAAAAGAAAGGAAAAATCAAGCTCTCT BORNEO 421 AACAGAGCAGAGCAGATCCTGAATTTCTCTGCAGGGGGGAGGTTTCAAGGCTCCAAATCTTGTTCTTGAACAAGAAAAGAAAGGAAAAATCAAGCTCTCT BORNEO 418 AACAGAGCAGAGCAGATCCTGAATTTCTCTGCAGGGGGGAGGTTTCAAGGCTCCAAATCTTGTTCTTGAACAAGAAAAGAAAGGAAAAATCAAGCTCTCT BORNEO 409 AACAGAGCAGAGCAGATCCTGAATTTCTCTGCAGGGGGGAGGTTTCAAGGCTCCAAATCTTGTTCTTGAACAAGAAAAGAAAGGAAAAATCAAGCTCTCT SUMATRA 427 TACCGTTTCTTGAGGGTGGGTGCTGTGTCGA BORNEO 421 TACCGTTTCTTAAGGGTGGGTGCTGTGTCGA BORNEO 418 TACCGTTTCTTAAGGGTGGGTGCTGTGTCGA BORNEO TACCGTTTCTTAAGGGTGGGTGCTGTGTCGA MseI (Nuroniah et al in prep.)

25 Intraspecific variation Shorea leprosula: Allele frequency at a co-dominant SCAR marker BORNEO BB IB TjS NS TS PS AS KB SB MtB SmB TB WkB BkB / / / / / 418 (Nuroniah et al., 2010; Finkeldey et al., 2010) JAVA

26 Application: Timber identification Genetic fingerprints to trace the origin of tropical timber 26 l Wood from tropical forests is (and will continue to be) traded on international markets origin l illegal logging l sustainably managed forests certified forests l How to trace the origin of wood and wood products? Confirm or reject the origin from particular enterprises, regions, countries,... Only the best is good enough!

27 Application: Timber identification The chain of custody Transport Processing Harvest 27 End user Further processing Export & Import

28 Application: Timber identification Material for DNA extraction from wood: Dipterocarps l N = from countries of origin l Indonesia l Thailand l Philippines l Vietnam 151 processed wood l Germany l Indonesia 28

29 Application: Timber identification DNA Extraction method l Based on DNeasy plant mini kit (Qiagen) with modifications mg of wood shavings Addition of PVP l RACHMAYANTI et al. (2006, 2009) 27-a. first eluat 27-a. second eluat 29

30 Results: Extraction Success of DNA extraction and amplification l Main impact Species Age and processing of wood Inhibitory substances Location on stem disk (outer inner) Size and genomic origin of PCR fragment 30

31 Results: Extraction Impact of fragment size and position on disk PCR success a m i Ccmp2 (150 bp) trnl (0.6 kbp) trnlf (1.1 kbp) fragment length (kb) 1 first eluat of a. second eluat of a. first eluat of m. second eluat of m. first eluat of i. second eluat of i. 31 (Rachmayanti et al., unpublished)

32 Results: Extraction Inhibitory tests: PVP and position on disk High-quality DNA (from leaves) and diluted or undiluted wood extracts as PCR template Wood extract dilution (x10 time) inhibitory rate first eluat DNA extraction : 1. without PVP addition 2. with 2.6% PVP 3. with 5.0% PVP wood extract ( x10 times dilution) inner heartwood (i) rings transition wood (m) outer sapwood (a) 32 (Rachmayanti et al., unpublished)

33 Results: Extraction Summary: Success of extraction and amplification 1 PCR analysis of dipterocarp wood DNA short fragment (ccmp2, 150 bp; PS, bp; G3, bp) middle length fragment (trnl, ca. 600 bp) long fragment (trnlf, ca. 1.1 kb) Amplification success Vietnam (40) Indonesia (38) Thailand (53) Philippine (50) Enterprises Tectona Eusideroxylon Prunus StrombosiaTriplochiton (151) grandis (12) zwageri (2) arborea (1) ceylanica (1) scleroxylon (7) Populus sp. Costa Rica (25) wood (3) Taxus baccata (2) Salix spp. Pinus Picea abies (1) sylvestris (12) L (8) Dipterocarp wood Non-dipterocarp tropic wood non-tropic wood 33 (Rachmayanti et al., unpublished)

34 Conclusion and outlook Conclusions and outlook I 34 l Molecular genetic tools are in principle suitable to infer the origin of tropical wood DNA extraction from wood is feasible l but: limitations (age, inhibitors, processing,...) Development of informative markers is demanding l Problems are taxa specific l Different marker types often necessary Development of sufficient information (data bases) is costly, time consuming 27-a. first eluat Monotes kerstingii Cotylelobium lanceolatum Upuna borneensis Anisoptera costata Anisoptera marginata Anisoptera reticulata Vatica bantamensis Vatica bella Vatica granulata 99 Vatica pauciflora Vatica rassak Vatica venulosa Dipterocarpus grandiflorus Dipterocarpus oblongifolius 71 Dipterocarpus retusus 100 Dipterocarpus rigidus Dipterocarpus tempehes Dryobalanops aromatica 99 Dryobalanops lanceolata Hopea bancana Hopea celebica Hopea odorata 85 Hopea sangal <50 Hopea dryobalanoides Hopea nigra <50 Hopea griffithii 66 Hopea mengarawan 100 Parashorea lucida Parashorea globosa Shorea blumutensis Shorea guiso Shorea montigena Shorea scaberrima Shorea seminis Shorea acuminata Shorea andulensis Shorea javanica 67 Shorea johorensis Shorea leprosula Shorea macroptera Shorea mecistopteryx 63 Shorea ovalis Shorea palembanica Shorea parvifolia Shorea platyclados <50 Shorea xanthophylla Shorea balangeran 59 Shorea selanica Shorea splendida Shorea macrophylla 55 Shorea pinanga <50 Shorea stenoptera Shorea acuminatissima Shorea dasyphylla 77 Shorea faguetiana Shorea multiflora Shorea fallax Shorea materialis Shorea virescens 27-a. second eluat trnl region

35 Conclusion and outlook Conclusions and outlook II l The dipterocarps are a suitable model group to further develop and to apply molecular methods to infer the origin of wood Ecologically relevant keystone species Conservation need (endangered species) Important timber species (national, international) Some knowledge on molecular genetic variation 35

36 See also: Selected relevant literature from the group 36 Tsumura, Y., Kado, T., Yoshida, K., Abe, H., Ohtani, M., Taguchi, M., Fukue, Y., Tani, N., Ueno, S., Yoshimura, K., Kamiya, K., Harada, K., Takeuchi, Y., Diway, B., Finkeldey, R., Na iem, M., Indrioko, S., Ng, K.K.S., Muhammad, N., Lee, S.L. (2011). Molecular database for classifying Shorea species (Dipterocarpaceae) and techniques for checking the legitimacy of timber and wood products. Journal of Plant Research 124: Nuroniah, H.S., Gailing, O, Finkeldey, R. (2010). Development of SCAR markers for species identification in the genus Shorea (Dipterocarpaceae). Silvae Genetica 59: Finkeldey, R., Leinemann, L., Gailing, O. (2010). Molecular genetic tools to infer the origin of forest plants and wood. Applied Microbiology and Biotechnology 85: Open Access review: Cao, C.P., Gailing, O., Siregar, I.Z., Siregar, U., Finkeldey, R. (2009) Genetic variation in nine Shorea species revealed by AFLPs. Tree Genetics and Genomes 5: Rachmayanti, Y., Leinemann, L., Gailing, O., Finkeldey, R. (2009) DNA from processed and unprocessed wood: factors influencing the isolation success. Forensic Science International, Genetics 3: Cao, C.P., Finkeldey, R., Siregar, I.Z., Siregar U.J., Gailing, O. (2006). Genetic diversity within and among populations of Shorea leprosula Miq. and Shorea parvifolia Dyer (Dipterocarpaceae) in Indonesia detected by AFLPs. Tree Genetics and Genomes 2: Cao, C.P., Gailing, O., Siregar, I., Indrioko, S., Finkeldey, R. (2006). Genetic variation at AFLPs for the Dipterocarpaceae and its relation to molecular phylogenies and taxonomic subdivisions. Journal of Plant Research 119: Indrioko, S., Gailing, O., Finkeldey, R. (2006). Molecular phylogeny of Dipterocarpaceae in Indonesia based on chloroplast DNA. Plant Systematics and Evolution 261: Rachmayanti, Y., Leinemann, L., Gailing, O., Finkeldey R. (2006). Extraction, amplification and characterization of wood DNA from Dipterocarpaceae. Plant Molecular Biology Reporter 24: 45-55

37 Acknowledgements l The main sponsors l The main partners Dr. Paciencia Milan, Dr. Tony Quimio, Leyte State University, Philippines Prof. Le-Cong Kiet, Vietnam Natl. University Dr, Suchitra Changtragoon, RFD Thailand Dr. Nyan Htun, UoF, Burma Thank You for Your attention! 37

38 Results: Marker development Intraspecific Variation at cpdna (cpssrs and PCR-RFLPs) 38 Haplotype distribution in Shorea parvifolia (Indrioko, 2005)

39 Results: Marker development Poor geographic structure at cpdna markers Why? Sea level in SE-Asia approx years ago 39 (SATHIAMURTY and VORIS, 2006)