Genetic variation of dipterocarps: from molecular phylogenies to the identification of the origin of timber
|
|
- Margaret James
- 6 years ago
- Views:
Transcription
1 Genetic variation of dipterocarps: from molecular phylogenies to the identification of the origin of timber Reiner Finkeldey, Oliver Gailing, Iskandar Siregar, Ulfah Siregar, Randy Villarin, Cuiping Cao, Nga Phi Nguyen, Hani Nuroniah, Yanti Rachmayanti 1 Büsgen Institute Forest Genetics and Forest Tree Breeding
2 Structure of presentation l Background Dipterocarpaceae l Interspecific variation: molecular phylogeny of Dipterocarpaceae l Intraspecific variation of selected Shorea spp. l Application: Molecular methods to trace the origin of wood l Conclusions and outlook l Literature 2
3 Background: Dipterocarpaceae The pantropical distribution of Dipterocarpaceae Monotoideae Dipterocarpoideae Pakaraimoideae 3 3 Genera; 40 Species 13 Genera; 470 Species 1 Genus; 1 Species
4 Background: Dipterocarpaceae Dipterocarpoideae in insular Southeast-Asia Phylogenie der Dipterocarpaceae 4 Number of endemic species Number of non-endemic species
5 Background: Dipterocarpaceae Dipterocarpoideae in Southeast-Asia 5 l l l l Widely distributed Mainland and insular SE-Asia Dominating lowland rainforests and monsoon forests in SE-Asia 50-80% of wood volume Keystone group Important timber species Trade name: Meranti, Balau, Keruing, Kapur Many endangered taxa Dipterocarp forest on Borneo
6 Background: Dipterocarpaceae Dipterocarp: growth habit l Medium-sized emergent trees Mainly climax species Often long, straight boles Slow to fast growth 6 Dipterocarpus condoriensis Shorea selanica (<60 years)
7 Background: Dipterocarpaceae Dipterocarpaceae Reproductive biology l Hermaphrodites l Zoogamous (mainly insect- pollinated) Bees, butterflies Thrips l Self compatible, mixed mating system t typical 60-90% 7 Dipterocarpus condoriensis
8 Background: Dipterocarpaceae Dipterocarp fruits l Typical 2 (0-5) winged diaspores Medium-sized to very large l recalcitrant l No efficient means of seed dispersal 8
9 Background: Dipterocarpaceae Exploitation of dipterocarps Local International 9
10 Hintergrund: Dipterocarpaceae Use of dipterocarps By-products Wood window frames charcoal furniture plywood 10 resin
11 Phylogeny of Dipterocarpaceae Order: Malvales; Family Dipterocarpaceae l l l l Blume (1825): related to Tiliaceae Cronquist (1968) & Takhtajan (1969): Theales Dahlgren (1975): Malvales Maguire et al. (1977), Dayanandan et al. (1999): Malvales (Sarcolaenaceae) l Chase et al. (1993); Alverson et al. (1998); Bayer et al., (1999): Malvales (Bombacaceae, Tiliaceae, Sterculiaceae and Malvaceae) 11
12 Phylogeny of dipterocarps Malvales; family Dipterocarpaceae rbcl sequences 12 (nach CHASE et al., 1993)
13 Material Material for studies on inter- and intraspecific variation l l Over 3000 samples from dipterocarps in SE-Asia Dried leaves l Silica gel l Long-term storage at -60 C Extracted DNA Herbarium material maintained l Mainly with partners Total of 116 species All genera of Dipterocarpoideae From six countries l More than 40 locations l Focus on Indonesia (>2500 samples) Mainly natural forests (>80%), few plantations, arboreta, botanical gardens 13
14 Phylogeny of Dipterocarpaceae Methods: cpdna polymorphisms (Indrioko et al., 2006) PCR-RFLP ofcpdna regions : trnlf, rbcl, petb, psba, psaa (Tsumura et al., 1996) cpssrs (Microsatellites): ccmp2, ccmp6, ccmp10 (Weising et al., 1999) Sequences: trnl; trnlf trnl region 14 PCR RFLPs cpssrs Sequences
15 Outgroup: Upuna Outgroup: Monotes < < Upuna borneensis Cotylelobium lanceolatum Vatica bantamensis Vatica bella Vatica granulata Vatica pauciflora Vatica rassak Vatica venulosa Anisoptera costata Anisoptera marginata Anisoptera reticulata Dipterocarpus grandiflorus Dipterocarpus oblongifolius Dipterocarpus retusus Dipterocarpus rigidus Dipterocarpus tempehes Dryobalanops aromatica Dryobalanops lanceolata Hopea bancana Hopea celebica Hopea odorata Hopea sangal Hopea dryobalanoides Hopea nigra Hopea griffithii Hopea mengarawan Parashorea lucida Parashorea globosa Shorea blumutensis Shorea guiso Shorea montigena Shorea scaberrima Shorea seminis Shorea acuminata Shorea andulensis Shorea javanica Shorea johorensis Shorea leprosula Shorea macroptera Shorea mecistopteryx Shorea ovalis Shorea palembanica Shorea parvifolia Shorea platyclados Shorea xanthophylla Shorea balangeran Shorea selanica Shorea splendida Shorea macrophylla Shorea pinanga Shorea stenoptera Shorea acuminatissima Shorea dasyphylla Shorea faguetiana Shorea multiflora Shorea fallax Shorea materialis Shorea virescens < < < < Monotes kerstingii Cotylelobium lanceolatum Upuna borneensis Anisoptera costata Anisoptera marginata Anisoptera reticulata Vatica bantamensis Vatica bella Vatica granulata Vatica pauciflora Vatica rassak Vatica venulosa Dipterocarpus grandiflorus Dipterocarpus oblongifolius Dipterocarpus retusus Dipterocarpus rigidus Dipterocarpus tempehes Dryobalanops aromatica Dryobalanops lanceolata Hopea bancana Hopea celebica Hopea odorata Hopea sangal Hopea dryobalanoides Hopea nigra Hopea griffithii Hopea mengarawan Parashorea lucida Parashorea globosa Shorea blumutensis Shorea guiso Shorea montigena Shorea scaberrima Shorea seminis Shorea acuminata Shorea andulensis Shorea javanica Shorea johorensis Shorea leprosula Shorea macroptera Shorea mecistopteryx Shorea ovalis Shorea palembanica Shorea parvifolia Shorea platyclados Shorea xanthophylla Shorea balangeran Shorea selanica Shorea splendida Shorea macrophylla Shorea pinanga Shorea stenoptera Shorea acuminatissima Shorea dasyphylla Shorea faguetiana Shorea multiflora Shorea fallax Shorea materialis Shorea virescens
16 Phylogeny of Dipterocarpaceae Diagnostic characters of endemic species < <50 < < Monotes kerstingii Cotylelobium lanceolatum Upuna borneensis Anisoptera costata Anisoptera marginata Anisoptera reticulata Vatica bantamensis Vatica bella Vatica granulata Vatica pauciflora Vatica rassak Vatica venulosa Dipterocarpus grandiflorus Dipterocarpus oblongifolius Dipterocarpus retusus Dipterocarpus rigidus Dipterocarpus tempehes Dryobalanops aromatica Dryobalanops lanceolata Hopea bancana Hopea celebica Hopea odorata Hopea sangal Hopea dryobalanoides Hopea nigra Hopea griffithii Hopea mengarawan Parashorea lucida Parashorea globosa Shorea blumutensis Shorea guiso Shorea montigena Shorea scaberrima Shorea seminis Shorea acuminata Shorea andulensis Shorea javanica Shorea johorensis Shorea leprosula Shorea macroptera Shorea mecistopteryx Shorea ovalis Shorea palembanica Shorea parvifolia Shorea platyclados Shorea xanthophylla Shorea balangeran Shorea selanica Shorea splendida Shorea macrophylla Shorea pinanga Shorea stenoptera Shorea acuminatissima Shorea dasyphylla Shorea faguetiana Shorea multiflora Shorea fallax Shorea materialis Shorea virescens Upuna borneensis Anisoptera reticulata Shorea fallax
17 Phylogeny of Dipterocarpaceae Phylogeny of tribe Dipterocarpae l Based on sequence variation of two cpdna regions trnl Intron trnl-f intergenic spacer 17 (Nga, 2009)
18 Phylogeny of Dipterocarpaceae Molecular phylogeny based on AFLPs 18 1 Dipterocarpus retusus Dipterocarpus oblongifolius Dipterocarpus rigidus Dipterocarpus tempehes Dipterocarpus glandiflorus 1 Dipterocarpus glandiflorus 2 Anisoptera reticulata Anisoptera marginata Anisoptera costata 1 Anisoptera costata 2 Cotylelobium lanceolatum Upuna borneensis Vatica bantamensis 1 Vatica bantamensis 2 Vatica venulosa Vatica bella Vatica granulata Vatica rassak Vatica pauciflora 1 Vatica pauciflora 2 Hopea celebica Hopea bancana 1 Hopea bancana 2 Hopea sangal 1 Hopea sangal 2 Hopea griffithii Hopea nigra Hopea dryobalanoides 1 Hopea dryobalanoides 2 Hopea mengarawan 1 Hopea mengarawan 2 Parashorea lucida Parashorea globosa Hopea odorata 1 Hopea odorata 2 Shorea seminis Shorea macroptera Shorea montigena Shorea andulensis Shorea balangeran Shorea selanica 1 Shorea selanica 2 Shorea xanthophylla 1 Shorea xanthophylla 2 Shorea materialis Shorea macrophylla 1 Shorea macrophylla 2 Shorea splendida 1 Shorea splendida 2 Shorea mecistopteryx 1 Shorea mecistopteryx 2 Shorea mecistopteryx 3 Shorea scaberrima Shorea palembanica 1 Shorea palembanica 2 Shorea leprosula 1 Shorea leprosula 2 Shorea parvifolia 1 Shorea parvifolia 2 Shorea guiso 1 Shorea guiso 2 Shorea platyclados 1 Shorea platyclados 2 Shorea ovalis 1 Shorea ovalis 2 Shorea faguetiana Shorea acuminatissima Shorea javanica Shorea johorensis 1 Shorea johorensis 2 Shorea blumutensis 1 Shorea blumutensis 2 Shorea acuminata 3 Shorea acuminata 1 Shorea acuminata 2 Dryobalanops aromatica Dryobalanops lanceolata 1 Dryobalanops lanceolata 2 Shorea virescens 1 Shorea virescens 2 The phylogeny based on morphology and cpdna variation is also reflected at AFLPs, indicating genome-wide differentiation pattern congruent with variation at cpdna (from CAO et al., 2006a)
19 Intraspecific diversity in Indonesian Shorea spp. Sampling locations Indonesia Sumatra Borneo SLB (7, 8, 9, 10, 11) NS (1, 2, 3, 4, 5, 6) Java 19
20 Diversity within Shorea species Genetic diversity within populations of nine Shorea species in Indonesia at AFLP loci Pop. ID Distribution Sample size Polymorphic loci PPL n a n e H e I 1. Spar_NS common % Sacu_NS common % Sdas_NS scattered % Sblu_NS rare % Slep_NS common % Smac_NS common % Mean % Spar_SLB common % Slep_SLB common % Spal_SLB common % Splat_SLB common % Sjoh_SLB common % Mean % Notes: Information of species distribution on islands was obtained from Newman et al. (1996a; 1996b). PPL, percentage of phenotypically polymorphic loci; n a, observed number of alleles per locus; n e, effective number of alleles per locus; H e, Nei s (1973) gene diversity; I, Shannon's information index [Lewontin (1972)]. (from Cao et al., 2009)
21 Intraspecific variation Intraspecific diversity common, widespread species Shorea leprosula and S. parvifolia BB IB TJS TS NS PS AS KB SB SmB BaB TB BkB MtB WkB HJ, DJ 21 CJ
22 Intraspecific variation Variation within species Species N PPL (%) H e H t H s G st S. parvifolia S. leprosula ,1973 0,3062 0,1973 0,1362 0, ,64 0,2404 0,3788 0,2404 0,1814 0, N: sample size PPL. Percentage of polymorphic loci H e : Nei's (1973) gene diversity Shannon's Information index H t : Total variation H S : Variation within populations G ST : Differentiation among populations (Cao et al, 2006b)
23 Intraspecific variation Genetic differentiation among populations G st for AFLP markes in Shorea leprosula 0,8 0,6 0,4 0, G st for AFLP markers in Shorea parvifolia ,8 0,6 0,4 0,
24 Intraspecific variation Conversion of AFLP bands to SCAR markers SUMATRA 427 GATACAGGGCAGCAATCACATGGATAGACTCAGCAGCTAATGGATAATTTTAGGCTTAAAGGGGGCTATCACATACCAAAAGTTCAGCAAGTAAGGCCGG BORNEO 421 GATACAGGGCAGCAATCACATGGATAGACTCAGCAGCTAATGGATAATTTTAGGCTTAAAGGGGGCTATCACATACCAAAAGTTCAGCAAGTAAGGCCGG BORNEO 418 GATACAGGGCAGCAATCACATGGATAGACTCAGCAGCTAATGGATAATTTTAGGCTTAAAGGGGGCTATCACATACCAAAAGTTCAGCAAGTAAGGCCGG BORNEO 409 GATACAGGGCAGCAATCACATGGATAGACTCAGCAGCTAATGGATAATTTTAGGCTTAAAGGGGGCTATCACATACCAAAAGTTCAGCAAGTAAGGCCGG SUMATRA 427 AGCTGGCAGGTTTGGGGGAGAGCCGGCGGGAAGTGCTGGGAAATTTAGGGGAATCTACCGAAAATTGGGWGGAACCAAGAGAAATTAGAGTAAACCCAAG BORNEO 421 AGCTGGCAGGTTTGGGGGAGAGCCGGCGGGAAGTGCTGGGAAATTTAGGGGAATCTACCGAAAATTGGGAGGAACCAAGAGAAATTAGAGTAAACCCAAG BORNEO 418 AGCTGGCAGGTTTGGGGGAGAGCCGGCGGGAAGTGCTGGGAAATTTAGGGGAATCTACCGAAAATTGGGAGGAACCAAGAGAAATTAGAGTAAACCCAAG BORNEO 409 AGCTGGCAGGTTTGGGGGAGAGCCGGCGGGAAGTGCTGGGAAATTTAGGGGAATCTACCGAAAATTGGGAGGAACCAAGAGA AAACCCAAG SUMATRA 427 CTAATTCAAGGAAGAACAAAGGAATTAGTGGCTGTTTCTTACCCAAAAATTTGAAGAATTCACACCCACACAATGAAGAGCAGTRGATAGAAATAGAAGT BORNEO 421 CTAATTCAAGGAAGAACAAAGGAATTAGTGGCTGTTTCTTACCCAAAAATTTGAAGAATTCACACCCACACAATGAAGAGCAGTAGATAGAA------GT BORNEO 418 CTAATTCAAGGAAGAACAAAGGAATTAGTGGCTGTTTCTTACCCAAAAAT---AAGAATTCACACCCACACAATGAAGAGCAGTAGATAGAA------GT BORNEO 409 CTAATTCAAGGAAGAACAAAGGAATTAGTGGCTGTTTCTTACCCAAAAAT---AAGAATTCACACCCACACAATGAAGAGCAGTAGATAGAA------GT EcoRI SUMATRA 427 AACAGAGCAGAGCAGATCCTGAATTTCTCTGCAGGGGGGAGGTTTCAAGGCTCCAAATCTTGTTCTTGAACAAGAAAAGAAAGGAAAAATCAAGCTCTCT BORNEO 421 AACAGAGCAGAGCAGATCCTGAATTTCTCTGCAGGGGGGAGGTTTCAAGGCTCCAAATCTTGTTCTTGAACAAGAAAAGAAAGGAAAAATCAAGCTCTCT BORNEO 418 AACAGAGCAGAGCAGATCCTGAATTTCTCTGCAGGGGGGAGGTTTCAAGGCTCCAAATCTTGTTCTTGAACAAGAAAAGAAAGGAAAAATCAAGCTCTCT BORNEO 409 AACAGAGCAGAGCAGATCCTGAATTTCTCTGCAGGGGGGAGGTTTCAAGGCTCCAAATCTTGTTCTTGAACAAGAAAAGAAAGGAAAAATCAAGCTCTCT SUMATRA 427 TACCGTTTCTTGAGGGTGGGTGCTGTGTCGA BORNEO 421 TACCGTTTCTTAAGGGTGGGTGCTGTGTCGA BORNEO 418 TACCGTTTCTTAAGGGTGGGTGCTGTGTCGA BORNEO TACCGTTTCTTAAGGGTGGGTGCTGTGTCGA MseI (Nuroniah et al in prep.)
25 Intraspecific variation Shorea leprosula: Allele frequency at a co-dominant SCAR marker BORNEO BB IB TjS NS TS PS AS KB SB MtB SmB TB WkB BkB / / / / / 418 (Nuroniah et al., 2010; Finkeldey et al., 2010) JAVA
26 Application: Timber identification Genetic fingerprints to trace the origin of tropical timber 26 l Wood from tropical forests is (and will continue to be) traded on international markets origin l illegal logging l sustainably managed forests certified forests l How to trace the origin of wood and wood products? Confirm or reject the origin from particular enterprises, regions, countries,... Only the best is good enough!
27 Application: Timber identification The chain of custody Transport Processing Harvest 27 End user Further processing Export & Import
28 Application: Timber identification Material for DNA extraction from wood: Dipterocarps l N = from countries of origin l Indonesia l Thailand l Philippines l Vietnam 151 processed wood l Germany l Indonesia 28
29 Application: Timber identification DNA Extraction method l Based on DNeasy plant mini kit (Qiagen) with modifications mg of wood shavings Addition of PVP l RACHMAYANTI et al. (2006, 2009) 27-a. first eluat 27-a. second eluat 29
30 Results: Extraction Success of DNA extraction and amplification l Main impact Species Age and processing of wood Inhibitory substances Location on stem disk (outer inner) Size and genomic origin of PCR fragment 30
31 Results: Extraction Impact of fragment size and position on disk PCR success a m i Ccmp2 (150 bp) trnl (0.6 kbp) trnlf (1.1 kbp) fragment length (kb) 1 first eluat of a. second eluat of a. first eluat of m. second eluat of m. first eluat of i. second eluat of i. 31 (Rachmayanti et al., unpublished)
32 Results: Extraction Inhibitory tests: PVP and position on disk High-quality DNA (from leaves) and diluted or undiluted wood extracts as PCR template Wood extract dilution (x10 time) inhibitory rate first eluat DNA extraction : 1. without PVP addition 2. with 2.6% PVP 3. with 5.0% PVP wood extract ( x10 times dilution) inner heartwood (i) rings transition wood (m) outer sapwood (a) 32 (Rachmayanti et al., unpublished)
33 Results: Extraction Summary: Success of extraction and amplification 1 PCR analysis of dipterocarp wood DNA short fragment (ccmp2, 150 bp; PS, bp; G3, bp) middle length fragment (trnl, ca. 600 bp) long fragment (trnlf, ca. 1.1 kb) Amplification success Vietnam (40) Indonesia (38) Thailand (53) Philippine (50) Enterprises Tectona Eusideroxylon Prunus StrombosiaTriplochiton (151) grandis (12) zwageri (2) arborea (1) ceylanica (1) scleroxylon (7) Populus sp. Costa Rica (25) wood (3) Taxus baccata (2) Salix spp. Pinus Picea abies (1) sylvestris (12) L (8) Dipterocarp wood Non-dipterocarp tropic wood non-tropic wood 33 (Rachmayanti et al., unpublished)
34 Conclusion and outlook Conclusions and outlook I 34 l Molecular genetic tools are in principle suitable to infer the origin of tropical wood DNA extraction from wood is feasible l but: limitations (age, inhibitors, processing,...) Development of informative markers is demanding l Problems are taxa specific l Different marker types often necessary Development of sufficient information (data bases) is costly, time consuming 27-a. first eluat Monotes kerstingii Cotylelobium lanceolatum Upuna borneensis Anisoptera costata Anisoptera marginata Anisoptera reticulata Vatica bantamensis Vatica bella Vatica granulata 99 Vatica pauciflora Vatica rassak Vatica venulosa Dipterocarpus grandiflorus Dipterocarpus oblongifolius 71 Dipterocarpus retusus 100 Dipterocarpus rigidus Dipterocarpus tempehes Dryobalanops aromatica 99 Dryobalanops lanceolata Hopea bancana Hopea celebica Hopea odorata 85 Hopea sangal <50 Hopea dryobalanoides Hopea nigra <50 Hopea griffithii 66 Hopea mengarawan 100 Parashorea lucida Parashorea globosa Shorea blumutensis Shorea guiso Shorea montigena Shorea scaberrima Shorea seminis Shorea acuminata Shorea andulensis Shorea javanica 67 Shorea johorensis Shorea leprosula Shorea macroptera Shorea mecistopteryx 63 Shorea ovalis Shorea palembanica Shorea parvifolia Shorea platyclados <50 Shorea xanthophylla Shorea balangeran 59 Shorea selanica Shorea splendida Shorea macrophylla 55 Shorea pinanga <50 Shorea stenoptera Shorea acuminatissima Shorea dasyphylla 77 Shorea faguetiana Shorea multiflora Shorea fallax Shorea materialis Shorea virescens 27-a. second eluat trnl region
35 Conclusion and outlook Conclusions and outlook II l The dipterocarps are a suitable model group to further develop and to apply molecular methods to infer the origin of wood Ecologically relevant keystone species Conservation need (endangered species) Important timber species (national, international) Some knowledge on molecular genetic variation 35
36 See also: Selected relevant literature from the group 36 Tsumura, Y., Kado, T., Yoshida, K., Abe, H., Ohtani, M., Taguchi, M., Fukue, Y., Tani, N., Ueno, S., Yoshimura, K., Kamiya, K., Harada, K., Takeuchi, Y., Diway, B., Finkeldey, R., Na iem, M., Indrioko, S., Ng, K.K.S., Muhammad, N., Lee, S.L. (2011). Molecular database for classifying Shorea species (Dipterocarpaceae) and techniques for checking the legitimacy of timber and wood products. Journal of Plant Research 124: Nuroniah, H.S., Gailing, O, Finkeldey, R. (2010). Development of SCAR markers for species identification in the genus Shorea (Dipterocarpaceae). Silvae Genetica 59: Finkeldey, R., Leinemann, L., Gailing, O. (2010). Molecular genetic tools to infer the origin of forest plants and wood. Applied Microbiology and Biotechnology 85: Open Access review: Cao, C.P., Gailing, O., Siregar, I.Z., Siregar, U., Finkeldey, R. (2009) Genetic variation in nine Shorea species revealed by AFLPs. Tree Genetics and Genomes 5: Rachmayanti, Y., Leinemann, L., Gailing, O., Finkeldey, R. (2009) DNA from processed and unprocessed wood: factors influencing the isolation success. Forensic Science International, Genetics 3: Cao, C.P., Finkeldey, R., Siregar, I.Z., Siregar U.J., Gailing, O. (2006). Genetic diversity within and among populations of Shorea leprosula Miq. and Shorea parvifolia Dyer (Dipterocarpaceae) in Indonesia detected by AFLPs. Tree Genetics and Genomes 2: Cao, C.P., Gailing, O., Siregar, I., Indrioko, S., Finkeldey, R. (2006). Genetic variation at AFLPs for the Dipterocarpaceae and its relation to molecular phylogenies and taxonomic subdivisions. Journal of Plant Research 119: Indrioko, S., Gailing, O., Finkeldey, R. (2006). Molecular phylogeny of Dipterocarpaceae in Indonesia based on chloroplast DNA. Plant Systematics and Evolution 261: Rachmayanti, Y., Leinemann, L., Gailing, O., Finkeldey R. (2006). Extraction, amplification and characterization of wood DNA from Dipterocarpaceae. Plant Molecular Biology Reporter 24: 45-55
37 Acknowledgements l The main sponsors l The main partners Dr. Paciencia Milan, Dr. Tony Quimio, Leyte State University, Philippines Prof. Le-Cong Kiet, Vietnam Natl. University Dr, Suchitra Changtragoon, RFD Thailand Dr. Nyan Htun, UoF, Burma Thank You for Your attention! 37
38 Results: Marker development Intraspecific Variation at cpdna (cpssrs and PCR-RFLPs) 38 Haplotype distribution in Shorea parvifolia (Indrioko, 2005)
39 Results: Marker development Poor geographic structure at cpdna markers Why? Sea level in SE-Asia approx years ago 39 (SATHIAMURTY and VORIS, 2006)
Citation Tropical Forests in Sarawak" (2016)
Title Molecular phylogeny and evol trees Author(s) Kamiya, Koichi; Harada, Ko; Nanami, Diway, Bibian M.; Chong, Lucy Proceedings of the symposium "Front Citation research: progress in joint project
More informationThe Diversity of Shorea spp. (Meranti) at Some Habitats in Indonesia
IOP Conference Series: Earth and Environmental Science PAPER OPEN ACCESS The Diversity of Shorea spp. (Meranti) at Some Habitats in Indonesia To cite this article: Purwaningsih and E Kintamani 2018 IOP
More informationConstruction of a gene-data bank of tropical rainforest tree species in Sarawak, Malaysia
TROPICS Vol. () Issued December, 00 Proceeding Construction of a gene-data bank of tropical rainforest tree species in Sarawak, Malaysia Tomotaka KONISHI,7), Ko HARADA ), Lucy CHONG ), Joseph Jawa KENDAWANG
More informationGenetic Variation of Populations Scutellaria slametensis sp. nov. (Lamiaceae) on Mt. Slamet, Central Java, Indonesia
Genetic Variation of Populations Scutellaria slametensis sp. nov. (Lamiaceae) on Mt. Slamet, Central Java, Indonesia Scutellaria sp. pop. Baturraden Scutellaria sp. pop. Kaligua Scutellaria sp. pop. Kaliwadas
More informationGenetic diversity of wild Coffee (Coffea arabica) and its implication for conservation
Genetic diversity of wild Coffee (Coffea arabica) and its implication for conservation Kassahun Tesfaye, Feyera Senbeta, Tamiru Oljira, Solomon Balemi, Govers, K., Endashaw Bekele, Borsch, T. Biodiversity
More informationSHORT TERM SCIENTIFIC MISSIONS (STSMs)
SHORT TERM SCIENTIFIC MISSIONS (STSMs) Reference: Short Term Scientific Mission, COST Action FA1003 Beneficiary: Bocharova Valeriia, National Scientific Center Institute of viticulture and winemaking named
More informationIdentification and Classification of Pink Menoreh Durian (Durio Zibetinus Murr.) Based on Morphology and Molecular Markers
RESEARCH Identification and Classification of Pink Durian (Durio Zibetinus Murr.) Based on Morphology and Molecular Markers Nandariyah a,b * adepartment of Agronomy, Faculty of Agriculture, Sebelas Maret
More informationReasons for the study
Systematic study Wittall J.B. et al. (2010): Finding a (pine) needle in a haystack: chloroplast genome sequence divergence in rare and widespread pines. Molecular Ecology 19, 100-114. Reasons for the study
More informationWP Board 1054/08 Rev. 1
WP Board 1054/08 Rev. 1 9 September 2009 Original: English E Executive Board/ International Coffee Council 22 25 September 2009 London, England Sequencing the genome for enhanced characterization, utilization,
More informationMolecular identification of bacteria on grapes and in must from Small Carpathian wine-producing region (Slovakia)
Molecular identification of bacteria on grapes and in must from Small Carpathian wine-producing region (Slovakia) T. Kuchta1, D. Pangallo2, Z. Godálová1, A. Puškárová2, M. Bučková2, K. Ženišová1, L. Kraková2
More informationUnravelling the taxonomy of the Colletotrichum species causing anthracnose in chili in Australia and SE Asia
Unravelling the taxonomy of the Colletotrichum species causing anthracnose in chili in Australia and SE Asia Dilani de Silva Prof. Paul Taylor, Prof. Pedro Crous, Prof. Peter Ades Faculty of Veterinary
More informationIdentification of haplotypes controlling seedless by genome resequencing of grape
Identification of haplotypes controlling seedless by genome resequencing of grape Soon-Chun Jeong scjeong@kribb.re.kr Korea Research Institute of Bioscience and Biotechnology Why seedless grape research
More informationGenetic Diversity of Pinus species in New York: a baseline study for fungal endophytes assemblage analysis
Genetic Diversity of Pinus species in New York: a baseline study for fungal endophytes assemblage analysis Abstract Ravishankar Narayana Department of Biological Sciences, Fordham University Understanding
More informationGenetic diversity of native Pinus sylvestris L. of Gerês accessed by SSR markers (MICROSAT PSYLV)
Genetic diversity of native Pinus sylvestris L. of Gerês accessed by SSR markers (MICROSAT PSYLV) UTAD, Vila Real Portugal BFW, Austria This work was partially funded by: FEDER funds through the Programa
More informationTitle: Genetic Variation of Crabapples ( Malus spp.) found on Governors Island and NYC Area
Title: Genetic Variation of Crabapples ( Malus spp.) found on Governors Island and NYC Area Team Members: Jianri Chen, Zinan Ma, Iulius Sergiu Moldovan and Xuanzhi Zhao Sponsoring Teacher: Alfred Lwin
More informationHopea macrocarpa (Dipterocarpaceae), a new species from Peninsular Thailand
THAI FOREST BULL., BOT. 45(2): 94 98. 2017. DOI: 10.20531/TFB.2017.45.2.02 Hopea macrocarpa (Dipterocarpaceae), a new species from Peninsular Thailand MANOP POOPATH 1, DUANGCHAI SOOKCHALOEM 2, *, SUTEE
More informationMolecular Systematics & Ethnobotany Case Study: Breadfruit
Molecular Systematics & Ethnobotany Case Study: Breadfruit Thanks to Tim Motley & Nyree Zerega for pictures and information. Hawaii, California, Bering Straight Bounty-hunting Pandora s Box Breadfruit
More informationEVALUATION OF THE CHLROPLAST DNA AMONG VICIA FABA L. GERMPLASM USING RESTRICTION- SITE ANALYSIS *
Iranian Journal of Science & Technology, Transaction A, Vol. 28, No. A1 Printed in Islamic Republic of Iran, 2004 Shiraz University EVALUATION OF THE CHLROPLAST DNA AMONG VICIA FABA L. GERMPLASM USING
More informationMolecular Systematics & Ethnobotany Case Study: Breadfruit
Molecular Systematics & Ethnobotany Case Study: Breadfruit Thanks to Tim Motley & Nyree Zerega for pictures and information. Hawaii, California, Bering Straight Bounty-hunting Pandora s Box Breadfruit
More informationCalvin Lietzow and James Nienhuis Department of Horticulture, University of Wisconsin, 1575 Linden Dr., Madison, WI 53706
Precocious Yellow Rind Color in Cucurbita moschata Calvin Lietzow and James Nienhuis Department of Horticulture, University of Wisconsin, 1575 Linden Dr., Madison, WI 53706 Amber DeLong and Linda Wessel-Beaver
More informationPhoto: cookwoods.com
SNPs based timber tracking tools for African mahogany (Khaya sp.) Marius Ekué, PhD OECD workshop Application of high throughput genotyping technologies for forest tree species identification and timber
More informationICC September 2018 Original: English. Emerging coffee markets: South and East Asia
ICC 122-6 7 September 2018 Original: English E International Coffee Council 122 st Session 17 21 September 2018 London, UK Emerging coffee markets: South and East Asia Background 1. In accordance with
More informationOrigin and Evolution of Artichoke Thistle in California
Origin and Evolution of Artichoke Thistle in California Janet Leak-Garcia Department of Botany and Plant Sciences University of California, Riverside Outline: The problem in California Questions addressed
More informationWhere in the Genome is the Flax b1 Locus?
Where in the Genome is the Flax b1 Locus? Kayla Lindenback 1 and Helen Booker 2 1,2 Plant Sciences Department, University of Saskatchewan, Saskatoon, SK S7N 5A8 2 Crop Development Center, University of
More informationThe human colonisation of the Pacific: Process and Impact
The human colonisation of the Pacific: Process and Impact Elizabeth Matisoo-Smith Dept of Anthropology and Allan Wilson Centre of Molecular Ecology and Evolution, University of Auckland Commensal models
More informationCatalogue of published works on. Maize Lethal Necrosis (MLN) Disease
Catalogue of published works on Maize Lethal Necrosis (MLN) Disease Mentions of Maize Lethal Necrosis (MLN) Disease - Reports and Journals Current and future potential distribution of maize chlorotic mottle
More informationR. K. Arora Department of Horticulture, Haryana Agricultural University, Hisar , India
Proceedings of the Global Citrus Germplasm Network Appendix 7 In Situ Conservation of Biological Diversities in Citrus R. K. Arora Department of Horticulture, Haryana Agricultural University, Hisar-125004,
More informationChapter V SUMMARY AND CONCLUSION
Chapter V SUMMARY AND CONCLUSION Coffea is economically the most important genus of the family Rubiaceae, producing the coffee of commerce. Coffee of commerce is obtained mainly from Coffea arabica and
More informationMolecular Systematics & Ethnobotany Case Study: Breadfruit
Molecular Systematics & Ethnobotany Case Study: Breadfruit Thanks to Tim Motley & Nyree Zerega for pictures and information. Hawaii, California, Bering Straight Bounty-hunting Pandora s Box Breadfruit
More informationRESOLUTION OIV-OENO 576A-2017
RESOLUTION OIV-OENO 576A-2017 MONOGRAPH OF SACCHAROMYCES YEASTS THE GENERAL ASSEMBLY, In view of article 2, paragraph 2 iv of the Agreement of 3 April 2001 establishing the International Organisation of
More informationAVOCADO GENETICS AND BREEDING PRESENT AND FUTURE
AVOCADO GENETICS AND BREEDING PRESENT AND FUTURE U. Lavi, D. Sa'ada,, I. Regev and E. Lahav ARO- Volcani Center P. O. B. 6, Bet - Dagan 50250, Israel Presented at World Avocado Congress V Malaga, Spain
More informationShazia Mannan COMSATS Institute of Information Technology Sahiwal Campus, Pakistan
Shazia Mannan COMSATS Institute of Information Technology Sahiwal Campus, Pakistan Citrus is one of the major export commodities of Pakistan and is grown in an area of 160,000 ha. Annual production of
More informationNatural history of Trichinella britovi in the neighboring Mediterranean islands of Corsica and Sardinia
Workshop of National Reference Laboratories for Parasites Istituto Superiore di Sanità, Rome, Italy, 24-25 May, 2018 Natural history of Trichinella britovi in the neighboring Mediterranean islands of Corsica
More informationLUISA MAYENS VÁSQUEZ RAMÍREZ. Adress: Cl 37 # 28-15, Manizales, Caldas, Colombia. Cell Phone Number:
LUISA MAYENS VÁSQUEZ RAMÍREZ Adress: Cl 37 # 28-15, Manizales, Caldas, Colombia. Cell Phone Number: 3013978734 E-mail: luisamayens@gmail.com PROFILE Agronomical engineer, Universidad de Caldas, Colombia.
More informationGenetic Diversity, Structure and Differentiation in Cultivated Walnut (Juglans regia L.)
Genetic Diversity, Structure and Differentiation in Cultivated Walnut (Juglans regia L.) M. Aradhya 1, K. Woeste 2 and D. Velasco 1 1 National Clonal Germplasm Repository, USDA-ARS, University of California,
More informationLevel 3 Biology, 2016
91605 916050 3SUPERVISOR S Level 3 Biology, 2016 91605 Demonstrate understanding of evolutionary processes leading to speciation 2.00 p.m. Thursday 10 November 2016 Credits: Four Achievement Achievement
More informationPhylogenetic Analysis of Chloroplast DNA Variation in Coffea L.
_" MOLECULAR PHYLOGENETICS AND EVOLUTION Vol 9, No 1, February, pp 109-117,1998 ARTICLE NO FY970453 Phylogenetic Analysis of Chloroplast DNA Variation in Coffea L J Cros,* M C Combes,* P Trouslot,* F Anthony,+
More informationTitle: Development of Simple Sequence Repeat DNA markers for Muscadine Grape Cultivar Identification.
Title: Development of Simple Sequence Repeat DNA markers for Muscadine Grape Cultivar Identification. Progress Report Grant Code: SRSFC Project # 2018 R-06 Research Proposal Name, Mailing and Email Address
More informationIntroduction to the use of molecular genotyping techniques
Introduction to the use of molecular genotyping techniques Gregorio López-Ortega, Almudena Bayo-Canha, Emma Skipper and Felicidad Fernández Budapest 3 rd -5 th of March STSM (Spain to UK) Pomological characterization
More informationRESOLUTION OIV-OENO MOLECULAR TOOLS FOR IDENTIFICATION OF SACCHAROMYCES CEREVISIAE WINE YEAST AND OTHER YEAST SPECIES RELATED TO WINEMAKING
RESOLUTION OIV-OENO 408-2011 MOLECULAR TOOLS FOR IDENTIFICATION OF SACCHAROMYCES CEREVISIAE WINE YEAST AND OTHER YEAST SPECIES RELATED TO WINEMAKING THE GENERAL ASSEMBLY In view of Article 2, paragraph
More informationProject Justification: Objectives: Accomplishments:
Spruce decline in Michigan: Disease Incidence, causal organism and epidemiology MDRD Hort Fund (791N6) Final report Team leader ndrew M Jarosz Team members: Dennis Fulbright, ert Cregg, and Jill O Donnell
More informationINDIAN COUNCIL OF AGRICULTURAL RESEARCH DIRECTORATE OF RAPESEED-MUSTARD RESEARCH, BHARATPUR, INDIA
INDIAN COUNCIL OF AGRICULTURAL RESEARCH DIRECTORATE OF RAPESEED-MUSTARD RESEARCH, BHARATPUR, INDIA Pathogenic variability of Sclerotinia sclerotiorum isolates on Brassica differentials Pankaj Sharma ICAR-Directorate
More informationTree diversity effect on dominant height in temperate forest
Tree diversity effect on dominant height in temperate forest Patrick Vallet, Thomas Pérot Irstea Nogent-sur-Vernisson CAQSIS, 28 29 March 2017, Bordeaux 2 Overyielding in mixed forest Context For many
More informationIntroduction. Introduction. Introduction. Cistus. Cistus Pyrophytic ecology. Cistus 07/03/2014
Predictive empirical models for mushroom production in ladanifer stands. Guzman y Vargas (Molecular Phylogenetics and Evolution Volume 37, Issue 3 644-6 Fig. Distribution map and number of species. Pie
More informationBusiness opportunities and challenges of mainstreaming biodiversity into the agricultural sector
Business opportunities and challenges of mainstreaming biodiversity into the agricultural sector Mainstreaming biodiversity into the agricultural sector what does this mean? Cultural service Regulating
More informationOutlook for the. ASEAN INTERNATIONAL SEMINAR ON COFFEE June 2012 Kuta, Bali, Indonesia
Outlook for the World Coffee Market ASEAN INTERNATIONAL SEMINAR ON COFFEE 12 13 June 212 Kuta, Bali, Indonesia José Sette Head of Operations ICO Composite Indicator Price (in current terms) Monthly averages:
More informationFINAL REPORT TO AUSTRALIAN GRAPE AND WINE AUTHORITY. Project Number: AGT1524. Principal Investigator: Ana Hranilovic
Collaboration with Bordeaux researchers to explore genotypic and phenotypic diversity of Lachancea thermotolerans - a promising non- Saccharomyces for winemaking FINAL REPORT TO AUSTRALIAN GRAPE AND WINE
More informationConfectionary sunflower A new breeding program. Sun Yue (Jenny)
Confectionary sunflower A new breeding program Sun Yue (Jenny) Sunflower in Australia Oilseed: vegetable oil, margarine Canola, cotton seeds account for >90% of oilseed production Sunflower less competitive
More informationMuseum Victoria CRC National Plant Biosecurity
1. PaDIL Species Factsheet Scientific Name: Ralstonia solanacearum (Smith 1896) Yabuuchi et al. 1996 race 2 (Bacteria: Proteobacteria: Burkholderiales: Burkholderiaceae) Common Name Moko disease of banana
More informationStatistics & Agric.Economics Deptt., Tocklai Experimental Station, Tea Research Association, Jorhat , Assam. ABSTRACT
Two and a Bud 59(2):152-156, 2012 RESEARCH PAPER Global tea production and export trend with special reference to India Prasanna Kumar Bordoloi Statistics & Agric.Economics Deptt., Tocklai Experimental
More informationInterloper s legacy: invasive, hybrid-derived California wild radish (Raphanus sativus) evolves to outperform its immigrant parents
Interloper s legacy: invasive, hybrid-derived California wild radish (Raphanus sativus) evolves to outperform its immigrant parents Caroline E. Ridley 1 and Norman C. Ellstrand 1,2 1 Department of Botany
More informationJoin the Conversation on Twitter: #FreshConnections PRODUCE MARKETING ASSOCIATION
Join the Conversation on Twitter: #FreshConnections Fresh Connections: Southern Africa Business Opportunities in South East Asia 17-19 August 2016 Content of presentation 1. Overview of the South African
More informationUse of RAPD and SCAR markers for identification of strawberry genotypes carrying red stele (Phytophtora fragariae) resistance gene Rpf1
Agronomy Research 4(Special issue), 335 339, 2006 Use of RAPD and SCAR markers for identification of strawberry genotypes carrying red stele (Phytophtora fragariae) resistance gene Rpf1 R. Rugienius*,
More informationVarietal Classification of New Coconut (Cocos nucifera L.) Forms Identified from Southern Sri Lanka
COCOS, 2010, 19: 41-50 Printed in Sri Lanka RESEARCH ARTICLE 41 Varietal Classification of New Coconut (Cocos nucifera L.) Forms Identified from Southern Sri Lanka G K Ekanayake 1,3, S A C N Perera 1,
More informationEukaryotic Comparative Genomics
Eukaryotic Comparative Genomics Detecting Conserved Sequences Charles Darwin Motoo Kimura Evolution of Neutral DNA A A T C TA AT T G CT G T GA T T C A GA G T A G CA G T GA AT A GT C T T T GA T GT T G T
More informationTreebreedex Seminar On IMPROVEMENT AND BREEDING OF NOBLE HARDWWOODS. Prof. Naldo Anselmi
Treebreedex Seminar On IMPROVEMENT AND BREEDING OF NOBLE HARDWWOODS PATHOLOGY ASPECTS TO BE CONSIDERED IN NOBLE HARDWOODS Results after the PROJECT RISELVITALIA Evaluation of resistance to anthracnose,
More informationSTUDIES ON THE COMMON SMUT DISEASE OF CORN
-68- Summary of STUDIES ON THE COMMON SMUT DISEASE OF CORN A Thesis Presented to the Graduate School, Faculty of Agriculture, Damanhour University In Partial Fullfilment of the Requirements For the Degree
More informationConstruction of a Wine Yeast Genome Deletion Library (WYGDL)
Construction of a Wine Yeast Genome Deletion Library (WYGDL) Tina Tran, Angus Forgan, Eveline Bartowsky and Anthony Borneman Australian Wine Industry AWRI Established 26 th April 1955 Location Adelaide,
More informationGenomics: cracking the mysteries of walnuts
Review Article Genomics: cracking the mysteries of walnuts Fei Chen 1*#, Junhao Chen 2*, Zhengjia Wang 2, Jiawei Zhang 1, Meigui Lin 1, Liangsheng Zhang 1# 1 State Key Laboratory of Ecological Pest Control
More informationFruit and berry breeding and breedingrelated. research at SLU Hilde Nybom
Fruit and berry breeding and breedingrelated research at SLU 2014-11-11 Hilde Nybom Plant breeding: cultivar development Relevant breeding-related research Fruit and berry breeding at Balsgård Apple (Malus
More informationNEPAL FISH BIODIVERSITY PROJECT. Update Report
NEPAL FISH BIODIVERSITY PROJECT Update Report May 29, 2016 1 Table of contents Sections Page No. 1. Overview 4 2. Site Characterization 5 3. Fish Sampling Training and Workshop 5 4. Sample Collection Technique
More informationMorphological Characterization of Jackfruit (Artocarpus heterophyllus L.) Accessions
I J T A Serials Publications Morphological Characterization of Jackfruit (Artocarpus heterophyllus L.) Accessions A. Aswini*, K. Lila Mathew**, T. Radha***, A.K. Babylatha****, P.S. Abida*****, S. Krishnan******
More informationNordic Journal of Botany
Nordic Journal of Botany NJB-01778 Tendal, K., Larsen, B., Ørgaard, M. and Pedersen, C. 2018. Recurrent hybridization events between Primula vulgaris, and P. elatior (Primulaceae, Ericales) challenge the
More information(Definition modified from APSnet)
Development of a New Clubroot Differential Set S.E. Strelkov, T. Cao, V.P. Manolii and S.F. Hwang Clubroot Summit Edmonton, March 7, 2012 Background Multiple strains of P. brassicae are known to exist
More informationMiscellany. Nine new yellow flowering Camellia (Theaceae) species from Viet Nam
Miscellany 149 Nine new yellow flowering Camellia (Theaceae) species from Viet Nam George Orel & Anthony S. Curry Royal Botanic Gardens, Mrs Macquaries Road, Sydney, NSW 2000, Australia e-mail george.orel@rbgsyd.nsw.gov.au
More informationUTZ Cocoa Statistics Report 2017
UTZ Cocoa Statistics Report 2017 UTZ is the largest program in the world for sustainable cocoa There are more than 760,000 cocoa farmers in the UTZ program UTZ certified cocoa is produced in 21 countries
More informationDevelopment and characterization of chloroplast. microsatellite markers for Pinus massioniana and their
ONLINE RESOURCES Development and characterization of chloroplast microsatellite markers for Pinus massioniana and their application in Pinus (Pinaceae) species ZhouXian Ni, PengYan Zhou, Meng Xu, Li-An
More informationBOTANICAL STUDY OF THE FAMILY ZINGIBERACEAE IN INDOCHINA (CAMBODIA, LAOS AND VIETNAM)
BOTANICAL STUDY OF THE FAMILY ZINGIBERACEAE IN INDOCHINA (CAMBODIA, LAOS AND VIETNAM) 2009 Activity: Collect specimens in Tay Nguyen, Viet Nam Reported by Trần Hữu Đăng Acknowledgments Reporter would like
More informationECONOMICS OF COCONUT PRODUCTS AN ANALYTICAL STUDY. Coconut is an important tree crop with diverse end-uses, grown in many states of India.
ECONOMICS OF COCONUT PRODUCTS AN ANALYTICAL STUDY Introduction Coconut is an important tree crop with diverse end-uses, grown in many states of India. Coconut palm is the benevolent provider of the basic
More informationBiological impacts caused by the release of the imported manila clam, Ruditapes philippinarum, in Japan
Tidal flat in Japan Biological impacts caused by the release of the imported manila clam, Ruditapes philippinarum, in Japan Naoaki TEZUKA and Masami HAMAGUCHI(FEIS) P-1 Sea grass bed in Japan 1955 1957
More informationGeneral Forestation Across Europe. Finnish Wood Species
General Forestation Across Europe Finnish Wood Species 1 = 4500 Trees per person in Finland Source: Mapping tree density at a global scale in Nature (September 10, 2015) 1 = 420 Trees per person globally
More informationGENETICS AND EVOLUTION OF CORN. This activity previews basic concepts of inheritance and how species change over time.
GENETICS AND EVOLUTION OF CORN This activity previews basic concepts of inheritance and how species change over time. Objectives for Exam #1: 1. Describe and complete a monohybrid ( one trait ) cross of
More informationINFESTATION PATTERN OF Scirtothrips dorsalis Hood (THYSANOPTERA : THRIPIDAE) IN DEVELOPING SHOOT AND FLOWER OF MANGO ARUMANIS 143
INFESTATION PATTERN OF Scirtothrips dorsalis Hood (THYSANOPTERA : THRIPIDAE) IN DEVELOPING SHOOT AND FLOWER OF MANGO ARUMANIS 143 Affandi* 1), C. dr. Medina 2), L. R. I. Velasco 2), P. A. Javier 2) and
More informationHSC Geography. Year 2016 Mark Pages 30 Published Feb 7, Geography Notes. By Annabelle (97.35 ATAR)
HSC Geography Year 2016 Mark 93.00 Pages 30 Published Feb 7, 2017 Geography Notes By Annabelle (97.35 ATAR) Powered by TCPDF (www.tcpdf.org) Your notes author, Annabelle. Annabelle achieved an ATAR of
More informationSupplemental Data. Jeong et al. (2012). Plant Cell /tpc
Suppmemental Figure 1. Alignment of amino acid sequences of Glycine max JAG1 and its homeolog JAG2, At-JAG and NUBBIN from Arabidopsis thaliana, LYRATE from Solanum lycopersicum, and Zm- JAG from Zea mays.
More informationTea Statistics Report 2015
Tea Statistics Report 215 Introduction This report presents the scope and scale of the UTZ tea program in 215. Throughout this report tea also includes rooibos unless otherwise specified. The statistics
More informationNew Cultivars. Pinguicula Riva. Submitted: 22 February 2018
New Cultivars Keywords: Pinguicula Riva, Drosera binata Ghost, Nepenthes ampullaria Black Widow, Nepenthes ampullaria Caramel Candy Stripe, Nepenthes ampullaria Lime Delight, Nepenthes ampullaria Chocolate
More informationJuice Microbiology and How it Impacts the Fermentation Process
Juice Microbiology and How it Impacts the Fermentation Process Southern Oregon Wine Institute Harvest Seminar Series July 20, 2011 Dr. Richard DeScenzo ETS Laboratories Monitoring Juice Microbiology: Who
More informationMapping and Detection of Downy Mildew and Botrytis bunch rot Resistance Loci in Norton-based Population
Mapping and Detection of Downy Mildew and Botrytis bunch rot Resistance Loci in Norton-based Population Chin-Feng Hwang, Ph.D. State Fruit Experiment Station Darr College of Agriculture Vitis aestivalis-derived
More informationSouth Sudan Arabica Coffee Land Race Survey in Boma Germplasm Assessment and Conservation Project Report Dr. Sarada Krishnan Dr. Aaron P.
South Sudan Arabica Coffee Land Race Survey in Boma Germplasm Assessment and Conservation Project Report Dr. Sarada Krishnan Dr. Aaron P. Davis 1. Introduction and Background: Coffee is an extremely important
More informationZAIKA I.V. 1, SOZINOV A.A. 2, 3, KARELOV A.V. 2, KOZUB N.A. 2, FILENKO A.L. 4, SOZINOV I.A. 2 1
11. McNeil M.D., Kota R., Paux E., Dunn D., McLean R., Feuillet C., Li D., Kong X., Lagudah E., Zhang J.C., Jia J.Z., Spielmeyer W., Bellgard M., Apples R. BAC-derived markers for assaying the stem rust
More informationInstructor: Stephen L. Love Aberdeen R & E Center 1693 S 2700 W Aberdeen, ID Phone: Fax:
Vegetable Crops PLSC 451/551 Lesson 3,,. Instructor: Stephen L. Love Aberdeen R & E Center 1693 S 2700 W Aberdeen, ID 83210 Phone: 397-4181 Fax: 397-4311 Email: slove@uidaho.edu Origin, Evolution Nikolai
More informationWhite Patch on the Fore-Flipper of Common Minke Whale, as a Potential Morphological Index to Identify Stocks
Open Journal of Animal Sciences, 2016, 6, 116-122 Published Online April 2016 in SciRes. http://www.scirp.org/journal/ojas http://dx.doi.org/10.4236/ojas.2016.62014 White Patch on the Fore-Flipper of Common
More informationEvaluation Forms. Please Complete An Evaluation Form After This Lecture. Coordinator: Room Host
Evaluation Forms Please Complete An Evaluation Form After This Lecture Coordinator: Room Host Please Download To Access Handouts + Further Information Coffee Botany 101: Genetics, Varieties, and Physiology
More informationYeast nuclei isolation kit. For fast and easy purification of nuclei from yeast cells.
ab206997 Yeast nuclei isolation kit Instructions for use: For fast and easy purification of nuclei from yeast cells. This product is for research use only and is not intended for diagnostic use. Version
More informationLathyrus Lathyrism Newsletter 1 (2000)
Recent Publications This section is intended to provide details of recent proceedings and other larger publications, and details of how to obtain copies of the publications. Lathyrus sativus and Lathyrism
More informationACEF, June 2016
ACEF, 06-10 June 2016 SYSTEMS THINKING FOR IMPROVED COOKSTOVE DISSEMINATION Dr Muhammad Tayyab Safdar Affiliated Lecturer, Centre of Development Studies, University of Cambridge and Post- Doctoral Researcher,
More informationDr. Bert Popping
ALLERGENS The Analytical Challenge to Meet Legislative Requirements and Consumer Demands Dr. Bert Popping bertpopping@eurofins.com PART I INTRODUCTION TO FP6 PROGRAM MoniQA Towards the harmonisation of
More informationReinw. ex Blume Verbenaceae. Vitex cofassus. vitex, leban
LOCAL NAMES English (New Guinea teak); Indonesian (sassuwar,gupasa,gofasa); Malay (gofasa,boepasa); Thai (teen-nok); Trade name (vitex,leban) BOTANIC DESCRIPTION Vitex cofassus is a medium to large tree
More informationDeciphering the microbiota of Greek table olives - A metagenomics approach
1 st International Olive Conference Table Olives: Pursuing Innovation - Exploring Trends Thessaloniki, Greece, 24-26 May 2018 Deciphering the microbiota of Greek table olives - A metagenomics approach
More informationTreated Articles and their regulation under the European Biocidal Products Regulation
Treated Articles and their regulation under the European Biocidal Products Regulation Dr. Samantha Champ Team Leader Regulatory Affairs Biocides Home Care, I&I and Industrial Solutions Europe June 2017
More informationThorne s Buckwheat (Eriogonum thornei)
Thorne s Buckwheat (Eriogonum thornei) Legal Status Taxonomy State: Endangered; S1.1 1 California Rare Plant Rank: 1B.2 2 Federal: Bureau of Land Photo courtesy of Hartmut Wisch. Management Sensitive Critical
More informationGLOSSARY Last Updated: 10/17/ KL. Terms and Definitions
GLOSSARY Last Updated: 10/17/2017 - KL Terms and Definitions Spacing 4ETa Zone(s) Background Drill Elevation Climate Soil Ecoregion 4 Recommended base spacing between containerized, cutting, plug or sprig
More informationGROWTH RATES OF RIPE ROT FUNGI AT DIFFERENT TEMPERATURES
: 77-84 GROWTH RATES OF RIPE ROT FUNGI AT DIFFERENT TEMPERATURES T.A. Elmsly and J. Dixon Avocado Industry Council Ltd., P.O. Box 13267, Tauranga 3110 Corresponding author: tonielmsly@nzavaocado.co.nz
More informationNational Institute of Fruit Tree Science, Japan, National Agriculture and Food Research Organization, 2-1 Fujimoto, Tsukuba, Ibaraki, JAPAN
85 J. Jpn. Bot. 84: 85 91 (2009) Discrimination of Xingren from Seeds of Prunus Sect. Armeniaca Species (Rosaceae) by Partial rpl16 Intron Sequences of cpdna, and the Botanical Origin of Xingrens in Markets
More informationTuna Trade. Fatima Ferdouse
Tuna Trade Fatima Ferdouse HIGHLIGHTS East Asia is the world s largest processing and exporting region for canned tuna. Producing countries in the region also depend on imported raw materials The fluctuating
More informationGenetic variation in cultivated coffee (Coffea arabica L.) accessions in northern New South Wales, Australia
Southern Cross University epublications@scu Theses 2005 Genetic variation in cultivated coffee (Coffea arabica L.) accessions in northern New South Wales, Australia Thi Minh Hue Tran Southern Cross University
More informationEVALUATION OF WILD JUGLANS SPECIES FOR CROWN GALL RESISTANCE
EVALUATION OF WILD JUGLANS SPECIES FOR CROWN GALL RESISTANCE Daniel Kluepfel, Malli Aradhya, Malendia Maccree, Jeff Moersfelder, Ali McClean, and Wes Hackett INTRODUCTION Paradox is the most widely used
More informationSNP discovery from amphidiploid species and transferability across the Brassicaceae
SNP discovery from amphidiploid species and transferability across the Brassicaceae Jacqueline Batley University of Queensland, Australia j.batley@uq.edu.au 1 Outline Objectives Brassicas Genome Sequencing
More informationYIELD POTENTIAL OF NOVEL SEMI-DWARF GRAIN AMARANTHS TESTED FOR TENNESSEE GROWING CONDITIONS
YIELD POTENTIAL OF NOVEL SEMI-DWARF GRAIN AMARANTHS TESTED FOR TENNESSEE GROWING CONDITIONS Damba Yahaya, Genetics and genomics laboratory Advisor: Dr Matthew Blair Introduction Grain amaranth (Amaranthus
More information