Use of rich media considerably increases resveratrol. production with recombinant industrial yeast strains

Transcription

1 AEM Accepts, published online ahead of print on 26 March 2010 Appl. Environ. Microbiol. doi: /aem Copyright 2010, American Society for Microbiology and/or the Listed Authors/Institutions. All Rights Reserved. 1 2 Use of rich media considerably increases resveratrol production with recombinant industrial yeast strains 3 4 Running title: Resveratrol production in yeast Tobias Sydor 1, Steffen Schaffer 2, Eckhard Boles 1,# 1 Institute of Molecular Biosciences, Goethe-University Frankfurt, Max-von-Laue-Str. 9, D Frankfurt am Main, Germany 2 Evonik Degussa GmbH, Creavis Technologies and Innovation, Paul-Baumann-Str. 1, D Marl, Germany # Corresponding author Prof. Dr. Eckhard Boles Institute of Molecular Biosciences Goethe-University Max-von-Laue-Str. 9 D Frankfurt am Main Germany tel.: +49 (0) fax.: +49 (0) e.boles@bio.uni-frankfurt.de Journal section for manuscript publication: Physiology and Biotechnology 1

2 Abstract: Resveratrol synthesis from p-coumarate was analyzed in different Saccharomyces cerevisiae strains expressing the 4-coumaroyl-coenzyme A-ligase (4CL1) from Arabidopsis thaliana and the stilbene synthase (STS) from Vitis vinifera, and compared between yeast cultures growing in rich or synthetic medium. Use of rich medium considerably improved resveratrol production, and resveratrol yields of up to 391 mg/l could be achieved with an industrial Brasilian sugar cane fermenting yeast Resveratrol (3,5,4 -trihydroxy-trans-stilbene) is a polyphenolic compound produced by some plants in response to infections or environmental stresses. As an ingredient of grape juice resveratrol might be responsible for the cardioprotective effect of red wine. Furthermore, resveratrol can prevent or delay the progression of cancer and it extends the lifespans of various organisms by the activation of sirtuin deacetylases (reviewed by Baur and Sinclair, 2006). Because of its beneficial properties the biotechnological production of resveratrol in microorganisms has attracted increasing industrial interest. Resveratrol is synthezised in the phenylpropanoid-pathway from the precursor molecule p-coumarate which is converted to p-coumaroyl-coa by the enzyme 4- coumaroyl-coa ligase (4Cl1) (Fig. 1). In the following steps the stilbene synthase (Sts), a type III polyketide synthase, adds three units of acetate derived from malonyl-coa to the molecule resulting in resveratrol. In earlier studies the production of resveratrol in Escherichia coli and Saccharomyces cerevisiae by heterologous expression of STS and 4CL and feeding of p-coumarate was described (reviewed by Halls and Yu, 2008; Donnez et al., 2009). Amounts of 1.5 mg/l up to 6 mg/l for S. 2

3 cerevisiae (Becker et al., 2003; Beekwilder et al., 2006) and up to 171 mg/l for E. coli (Watts et al., 2006; Katsuyama et al., 2007) were reported. In our study we could increase the resveratrol yield up to 391 mg/l with an industrial Brasilian S. cerevisiae strain expressing 4-coumaroyl-coenzyme A-ligase from Arabidopsis thaliana and stilbene synthase from Vitis vinifera The 4CL1 gene (GenBank accession no. NM ) from A. thaliana was amplified by PCR from cdna using oligonucleotides 5 - AACACAAAAACAAAAAGTTTTTTTAATTTTAATCAAAAAATGGCGCCACAAGAACA AGC and 5 - GAATGTAAGCGTGACATAACTAATTACATGACTCGAGTCACAATCCATTTGCTAG TT (4CL1-gene sequence is underlined). The STS gene (GenBank accession no. DQ ) from V. vinifera was amplified by PCR from cdna using oligonucleotides 5 - AACACAAAAACAAAAAGTTTTTTTAATTTTAATCAAAAAATGGCTTCAGTCGAGGA AAT and 5 - GAATGTAAGCGTGACATAACTAATTACATGACTCGAGTTAATTTGTAACCATAGG AA (STS-gene sequence is underlined). The DNA-fragments were cloned into 2µbased multicopy plasmids with the auxotrophic marker genes URA3 and LEU2, respectively, by homologous recombination (Wieczorke et al., 1999) placing STS and 4CL under control of a strong and constitutive HXT7 promoter fragment and the CYC1 terminator. The plasmids were transformed into S. cerevisiae CEN.PK2-1 cells (Kötter and Entian, 2008) by lithium acetate-transformation (Gietz and Woods, 2002) and positive transformants were selected on SD-agar plates (6.7 g/l yeast nitrogen base, with amino acids, 20 g/l glucose, 20 g/l agar) lacking uracil and leucine. 3

4 A flask culture fermentation with the recombinant yeast strain was performed in SDmedium supplemented with 5 mm p-coumarate (Sigma). Every 24 h 1 ml of the culture was taken, mixed with 1 ml acetone, spinned down for 15 min at rpm, and the supernatants were analyzed in a HPLC device (Dionex, PDA-100 photodiode array detector, RF 2000 fluorescence detector, column: Agilent SB-C8 3.5 µm.6 x 150 mm, mobile phase 40 % methanol/0.1 % TFA). Quantification of p-coumarate and resveratrol was achieved by comparing the sample data with data of calibration curves got by parallel HPLC-analysis of dilution series of resveratrol and p- coumarate. Both substances were identified by their characteristic absorption spectra (resveratrol: 308 nm and p-coumarate: 312 nm; Kolouchova-Hanzlikova, 2004). A resveratrol concentration of 6 mg/l was detected after 144 h of incubation. Longer incubation resulted in a decrease of the resveratrol concentration although there was still p-coumarate left in the culture. To increase the resveratrol productivity a fermentation in rich YEPD-medium (10 g/l yeast extract, 20 g/l bacterial peptone, 20 g/l glucose) was tested. Therefore the genes STS and 4Cl1 were re-cloned into the 2µ-based multicopy drug resistance marker plasmids prs42k (G418 R ; Taxis and Knop, 2006) and p426irad (hygromycin R ; Wiedemann and Boles, unpublished) still under control of the same HXT7-promoter fragment and CYC1-terminator. The plasmids were transformed into CEN.PK2-1 cells and positive transformants were selected on YEPD-agar supplemented with G418 and hygromycin (200 mg/l each). A shaking flask fermentation was performed with this strain in YEPD-medium with G418 and hygromycin supplemented with 10 mm p-coumarate; an additional amount of 5 mm p-coumarate was added after 120 h for optimal precursor supply. Under these conditions the CEN.PK2-1 strain produced 262 mg/l resveratrol within 144 h. This 4

5 result shows that a fermentation in rich medium yields much higher resveratrol levels compared to a fermentation in synthetic medium In a next step the plasmids were transformed in four S. cerevisiae strains from industrial sources to test their efficiency in resveratrol production. Three strains produced resveratrol in various concentrations and interestingly one strain metabolized p-coumarate without resveratrol-synthesis. The highest resveratrol yield of 391 mg/l was produced by a S. cerevisiae strain isolated from a Brasilian sugar cane plantation (Barra Grande). The higher resveratrol productivity of this strain in comparison to CEN.PK2-1 may due to its different genetic background. To make sure that the greatly increased resveratrol productivity was indeed an effect of the rich medium and not an effect of the drug resistance marker plasmids fermentations with the strains in SD-medium with G418 and hygromycin selection were performed. As expected this resulted in much lower resveratrol yields comparable to those obtained with the auxotophic selection marker plasmids (not shown). Like in SD-medium longer incubation than 144 h did not increase the resveratrol concentration. One possible reason could be feedback inhibition effects of resveratrol because of its intracellular accumulation (in fact % of the total resveratrol amount was detected in the cell pellet fraction of a centrifugated flask culture sample after 144 h of incubation). Therefore fermentations were performed after addition of 500 mg/l resveratrol to the medium. In these experiments resveratrol levels still increased by 370 mg/l up to 870 mg/l which shows that the high resveratrol concentration does not have an inhibitory effect. Furthermore different fermentation 5

6 conditions, i. e. high glucose concentrations, anaerobic conditions and different carbon sources, were tested. All of these approaches resulted in lower resveratrol yields (not shown) In this study we showed that the resveratrol productivity of recombinant S. cerevisiae strains starting from p-coumarate can be increased by fermentation in YEPD- instead of SD-medium. Furthermore the higher resveratrol concentrations achieved with a Brasilian wildtype strain (391 mg/l) in comparison to the laboratory CEN.PK2-1 strain (262 mg/l) show that unknown strain-specific features seem to be important for the resveratrol productivity. Moreover, it might also be that the source of the 4CL gene from A. thaliana might have contributed to the high resveratrol productivity as in previous studies the 4CL gene had been selected from a hybrid poplar (Becker et al., 2003) or from Nicotiana tabacum (Beekwilder et al. 2006). In general this study shows that S. cerevisiae is a well suited host for industrial resveratrol production. By further optimization of the fermentation conditions and metabolic engineering strategies the productivity might be further enhanced. Acknowledgements The authors thank Volker Müller for the kind provision of the HPLC-equipment and Stefan Saum for his expert technical support. We thank Claudia Stamme and Beate Wiedemann for the kind provision of the vectors prs42k and p426irad. This work was funded by Evonik Industries, financially supported by the State of North-Rhine Westfalia and cofinanced by the European Union. 6

7 155 Figure legend: Fig. 1: Synthesis of resveratrol from p-coumarate by the enzymes 4-coumaroyl-CoAligase (4Cl) and stilbene synthase (Sts). 4Cl attaches p-coumarate to Coenzyme A (CoA) to produce 4-coumaroyl-CoA which is then converted to resveratrol by condensation of 3 malonyl-coa molecules by Sts. Fig. 2: Production of resveratrol in a shaking flask culture in p-coumarate-containing YEPD-medium of a Brasilian Saccharomyces cerevisiae strain expressing stilbene synthase and 4-coumaroyl-coA ligase. Samples were taken at the indicated time points and the concentration of p-coumarate and resveratrol was quantified by HPLC-analysis. The dashed curve shows the optical density of the culture at 600 nm (OD 600 ). A maximal amount of 391 mg/l resveratrol could be achieved after 144 h of incubation. The asterisk indicates the time point at which an additional amount of 5 mm p-coumarate was added to the culture. Data are the means of four independent determinations with standard deviations. 7

8 173 References Baur, J. A., and D. A. Sinclair Therapeutic potential of resveratrol: the in vivo evidence. Nat. Rew. Drug Discov 5: Becker, J.V., G.O. Armstrong, M.J. van der Merwe, M.G. Lambrechts, M.A. Vivier, and I.S. Pretorius Metabolic engineering of Saccharomyces cerevisiae for the synthesis of the wine-related antioxidant resveratrol. FEMS Yeast Res. 4: Beekwilder, J., R. Wolswinkel, H. Jonker, R. Hall, C. H. Ric de Vos, and Arnaud Bovy Production of resveratrol in recombinant microorganisms. Appl. Environ. Microbiol. 72: Donnez, D., P. Jeandet, C. Clément, and E. Courot Bioproduction of resveratrol and stilbene derivatives by plant cells and microorganisms. Trends Biotechnol. 27: Gietz, R. D., and R. A.Woods Transformation of yeast by lithium acetate/single stranded carrier DNA/polyethylene glycol method. Methods Enzymol. 350: Halls, C., and O. Yu Potential for metabolic engineering of resveratrol biosynthesis. Trends Biotechnol. 26:

9 Katsuyama, Y., N. Funa, I. Miyahisa, and S. Horinouchi Synthesis of unnatural flavonoids and stilbenes by exploiting the plant biosynthetic pathway in Escherichia coli. Chem Biol. 14: Kolouchova-Hanzlikova, I., K. Melzoch, V. Filip, and J. Smidrkal Rapid method for resveratrol determination by HPLC with electrochemical and UV detections in wines. Food Chemistry 87: Taxis, C, and M. Knop System of centromeric, episomal, and integrative vectors based on drug resistance markers for Saccharomyces cerevisiae. Biotechniques 40: Watts, K. T., P. C. Lee, and C. Schmidt-Dannert Biosynthesis of plantspecific stilbene polyketides in metabolically engineered Escherichia coli. BMC Biotechnol. 6:22. 9

10

11