Detection of cow milk paneer in mixed/buffalo milk paneer through conventional species specific Polymerase Chain Reaction

Transcription

1 Indian J. Anim. Res., 51 (5) 2017 : Print ISSN: / Online ISSN: AGRICULTURAL RESEARCH COMMUNICATION CENTRE Detection of cow milk paneer in mixed/buffalo milk paneer through conventional species specific Polymerase Chain Reaction Tanmay Hazra*, Vivek Sharma, Rekha Sharma 1, S.De 2, Sumit Arora and Darshan Lal ICAR-National Dairy Research Institute, Karnal , India. Received: Accepted: DOI: /ijar.9491 ABSTRACT Due to higher market demand of buffalo milk paneer, lower price cow milk is often adulterated with higher cost buffalo milk for preparation of paneer. Till date no rapid technique is available in market to ensure that paneer is made from buffalo milk. Currently a PCR based method has been developed to authenticate the buffalo milk paneer. DNA was isolated from paneer by DNeasy Mericon food kit. A set of bovine specific primers (P1) targeting D-loop (displacement loop) of mt- DNA was selected and standardized to amplify cow DNA resulted 126bp amplicon. Using this PCR based approach even upto 1% level of cow milk adulteration in buffalo milk paneer could be detected. Key words: Food kit, Mitochondrial gene, Paneer, PCR, Species Specific primer, Universal primer. INTRODUCTION Paneer is a kind of soft variety of cheese obtained from heat acid coagulation of milk. It is believed that paneer was first developed by Nomads (Khan and Pal, 2011) of south west Asia and later it was spread all over the Asia. Good quality paneer, is characterized by a marble white colour, sweetish, mildly acidic taste, nutty flavour, spongy body and smooth texture, thus it is very much popular in South Asia for preparation of many types of snacks and culinary dishes. Buffalo milk is considered most suitable over cow milk for making paneer (Masud et al. 1992) due to fat globules and casein micelles of bigger size and higher concentration of fat in buffalo milk compared to cow milk. Different researchers have used different modifications to make cow milk suitable for paneer making (Singh and Kanawjia, 1988) but cow milk paneer was reported to be of inferior quality than buffalo milk paneer (Khan and Pal, 2011). In India it is estimated that 5% of total milk produced is converted into paneer which accounts for 4496 MT of paneer costing around 1050 crore (Reeta et al. 2012). In Indian dairy market a major amount of paneer is produced by un-organized sector and it is a common practice to sell mix milk paneer (cow milk is being mixed with buffalo milk) with the label of pure buffalo milk paneer. Till date no method has been develop to detect the presence of cow milk paneer in buffalo milk paneer. Recently DNA based methods are top choice for quality control personnel, as DNA is more thermo-stable than many proteins, and disruption of DNA is less for processed food (Lockley and Bardsley, 2000).There are numerous DNA based approaches being used to know the origin of food products from animal sources (Bottero and Dalmasso, 2010),but till date no report has been found to check the adulteration of cow milk in buffalo milk paneer using PCR based techniques. Hence, considering all facts that are cited above, the present study was planned to develop a PCR based approach to detect presence of cow milk in buffalo milk paneer. MATERIALS AND METHODS Collection of milk sample: Milk samples of cow, buffalo and goat were collected from Live Stock Research Centre of NDRI, Karnal, India. Preparation of Paneer Mixed milk: Cow milk was admixed with buffalo 3%, 5%, 10% and 20% to get mixed milk. Pure cow milk, buffalo milk and mix milk Paneer samples were made by procedure described by De. (2005). Pucrhase of DNA isolation kit: DNeasy Mericon food kit was purchased from (Quiagen, USA). Other chemicals: Taq DNA polymerase, corresponding PCR buffer and Agarose were purchased from Sigma Aldrich. 100bp ladder was purchased from Genetix. Other chemicals were purchased from Himedia. Oligonucleotide primers were got synthesized from Sigma (USA). Isolation of DNA from paneer: DNA was isolated from paneer samples (pure cow milk paneer, buffalo milk paneer and mixed milk paneer) using DNeasy Mericon food kit (Quiagen, USA), following manufacturer s instructions with a few modifications. 200 mg grounded paneer sample was taken in the tube, followed by the addition of 1ml food lysis buffer and 2.5µl Proteinase-K. Content of the tube were incubated in a thermo- mixer for 30 minute at 60 C with *Corresponding author s tanmayhazra08@gmail.com; 1 National Bureau of Animal Genetics and Resources(NBAGR), Karnal (India). 2 Animal Biotechnology Centre, National Dairy Research Institute Karnal (India).

2 constant shaking followed by centrifugation (2500 x g, 5 minutes). Clear supernatant (700µl) was transferred into another chloroform (500µl) containing micro centrifuge tube. This tube was vigorously vortexed for 15seconds followed by centrifugation at 13,000 x g for 15 minute. The upper layer (350µl) was transferred into another 2ml centrifuge tube containing 350µl buffer PB. All the contents of the tube were transferred to QIAquick spin column provided with the kit, placed in a 2 ml collection tube and centrifuged at 13,000 x g for 1 minute. Subsequently 500µl buffer AW2 was added to the column and centrifugation was done at 13,000 x g for 1 minute. Centrifugation step without adding buffer AW2 was repeated again so as to dry the membrane. Column was transferred to a fresh 2 ml micro-centrifuge tube and 50µl buffer EB (pre warmed at 70ºC) was added onto the column and after one minute incubation, centrifuged at 13,000 x g for 1 minute. DNA containing elute was collected and stored at -20ºC till further analysis. Isolation of DNA from milk: The total genomic DNA was extracted from milk samples by the protocol previously described by De et al. (2000). DNA from blood: Blood is considered as an ideal medium for isolation of DNA. Therefore, DNA isolated by phenol chloroform method (Sambrook and Russell 1989) from cow, buffalo and goat was procured from Core Lab of NBAGR, Karnal. Checking purity and concentration of DNA isolated from paneer sample: The concentration of isolated DNA was determined by measuring the absorbance at 260 nm and the purity of the extracted DNA was determined by the ratio of the absorbance at 260 nm and 280 nm. PCR amplification using Universal primer: For checking amplification behaviour of isolated DNA from paneer sample a set of reported Universal primer (Table 1) for mt cyt b gene was used from literature (Kocher et al. 1989). Polymerase Chain Reaction was carried out in 25 µl reaction volumes with about 25 ng genomic DNA using i-cycler (BioRAD, USA). The reaction mixture consisted of 200 µm each of datp, dctp, dgtp, dttp, 2.5 mm MgCl 2, 50 pmol primer (P-1), 1(U) Taq polymerase (Sigma- Aldrich ) and corresponding Taq buffer. Amplification conditions were as follows: initial denaturation for 2 min at 94 C; followed by 35 cycles of denaturation at 94 C for 5 Table 1: PCR oligonucleotide primers Volume 51 Issue 5 (October 2017) 963 seconds, annealing at 55 C for 30 seconds, extension at 72 C for 40 seconds; and finally extension at 72 C for 2 min. Selection and standardization of primers specific for cow: A pair of primer targeting D-loop region of mitochondrial DNA (mt-dna) was selected from the literature (Table 1). Primer-1 (P-1) which is expected to amplify a 126 bp DNA fragment of bovine species (De et al. 2011). DNA isolated from the blood and milk of closely related species (like buffalo and goat) was also checked for the specificity and cross amplification behaviour. For cattle specific amplification using primer (P1), Polymerase Chain Reaction was carried out in 25 µl reaction volumes about ng (genomic DNA), 200 µm each of datp, dctp, dgtp, dttp, 50 pmol of each forward and reverse primer (P-2), 1(U) Taq polymerase (Sigma-Aldrich) and corresponding Taq buffer following a touch-down PCR. Amplification conditions were initial denaturation at 94 ºC for 40 s and initial annealing temperature of 65 ºC for 30 seconds. In subsequent cycles, the annealing temperature was gradually reduced by 1 ºC until it reached 55 ºC. At 55 ºC, 25 cycles were performed. In each cycle, annealing was followed by an extension step at 72 ºC for 30 s. The final extension was performed at 72 ºC for 10 min. Buffalo specific PCR for identification of the presence of buffalo DNA in mix milk paneer: For checking the presence of buffalo DNA in mix milk paneer another set of primer (P-2) (Table 1) described by De et al. (2011) was used and PCR condition was employed same as described for primer (P-1). A negative control was used in every PCR reaction to check the environment contamination. PCR product analysis: The PCR products were separated by electrophoresis on 2% agarose gels (with ethidium bromide staining) in parallel with a 100 bp DNA ladder (Fermentas, USA), at 90volts for 30 minutes. RESULTS AND DISCUSSION Purity and concentration of isolated DNA from paneer samples: DNA concentration and purity were estimated by measuring the absorbance at 260 nm (A260) and the A260/ A280 absorbance ratio, respectively. Here we observed from the spectrophotometric data that using DNeasy Mericon food kit concentration of DNA isolated from paneer varies from ng/µl (table not given) and purity varies from were little bit less from the optimum ratio 1.8, that was Primer name Primer Sequence (5' to 3') PCR product size References Universal P-1(cow specific) P-2(buffalo specific) F: CCATCCAACATCTCAGCATGATGAAA R: GCC CCT CAG AAT GAT ATT TGT CCT CA F:CGCCCATACACAGACCACAG R: ATG CCT GGT AAA ATT CAT TAA ATA GCG F: CGCCCATACACAGACCACAG R:GTTATGTGTGAGCATGGGCTGATTGGA 360bp Kocher et al (1989) 126bp De et al. (2011) 226bp De et al. (2011)

3 964 INDIAN JOURNAL OF ANIMAL RESEARCH indicating that degradation of DNA during processing of paneer. Our results were in agreement with the earlier observations of Pirondini et al. (2010) who were able to isolate 13-17ng/µl DNA from cheese using food kit. PCR amplification of universal primer using the DNA extracted from paneer: For checking the quality of DNA extracted from paneer samples using DNeasy Mericon food kit, DNA was subjected to PCR amplification using universal primers of mitochondrial cyt-b gene (Kocher et al.1989) resulting into a product of about 360 bp amplicon size (fig-1). It was clear in agarose gel picture (fig 1) that heat and acid treatment of milk during preparation of paneer has no effect on the amplification quality of extracted DNA. Earlier Wong et al. (2010), used this Universal primer to identify the origin of processed meat and were successfully able to amplify 360bp amplicon from various processed meat species. Results of the present study suggested that DNeasy Mericon food kit was able to remove various PCR inhibitors present in paneer matrix and able to extract sufficient amount of DNA for PCR amplification reaction. Finding of the present study are in accordance with the result of Maudet and Taberlet (2001) who reported that silica column based extraction protocol of DNA from food matrix was able to isolate sufficient quantity of DNA for downstream application, without the purification step of DNA. Our results also suggested that DNeasy Mericon food kit can be used for extraction of DNA from paneer and it was also indicated that this food kit based DNA isolation method was rapid as well as sensitive and avoids the use of corrosive chemical like phenol, so easy to handle during isolation of DNA from paneer. Identification of cow DNA in paneer by species specific PCR: In figure 2 it is clearly observed that sharp band of 126bp were only visible in cow DNA isolated from cow blood, cow milk and cow milk paneer but no band was observed in the DNA isolated from buffalo and goat milk as well as blood and buffalo milk paneer. Hence, the results of the present study are in agreement with the finding of De et al. 2011, who reported that selected set of primer had no cross contamination with closely related species like goat or buffalo. Our results further reinforce the observations of Cheng et al. (2006), that the ubiquitous DNA, from all cell types of an individual species, contains identical genetic information regardless of the origin of the sample. Level of detection of cow milk in buffalo milk paneer: The oligonucleotide primer (P-1) was able to amplify the cow DNA even in the DNA isolated from the pure cow milk paneer and mixed milk paneer samples. It can be clearly observed that there was no amplification in the pure buffalo milk paneer sample DNA (Fig 3) but a sharp, 126bp product was amplified with the DNA of buffalo milk paneer adulterated with the cow milk. It was also observed that primer P-1 can amplify the cow DNA even from the DNA isolated from mixed milk paneer prepared, using 99 parts of buffalo milk and 1 part of cow milk (1%) (Fig 3). Thus by combining DNeasy Mericon food kit based method of DNA extraction from paneer followed by species specific PCR protocol developed under the study, Cow milk in buffalo milk paneer could be detected rapidly. The limit of detection of developed method was to the tune of 1% that could be considered as sufficient for quality control analysis lab. Buffalo specific PCR for identification of the presence of buffalo DNA in mix milk paneer: In order to confirm the presence of buffalo DNA in mixed milk paneer, DNA isolated from paneer of pure buffalo milk, cow milk as well as the mixed milk were amplified with the buffalo specific primer (P-2). No amplification was observed (Fig 4) in the DNA isolated from cow milk paneer. However, a 226bp PCR Fig 1: PCR amplification of universal primer using the DNA extracted from paneer and milk Fig 2: Specificity of bovine specific primer (P1)

4 Volume 51 Issue 5 (October 2017) 965 Fig 3: Level of detection of Cow milk in buffalo milk paneer product was obtained with the DNA of pure buffalo milk paneer as well as with paneer that of buffalo milk adulterated with the cow milk. Hence, amplification with primer P-2, could straight forwardly establish the presence of buffalo DNA in mix milk paneer. CONCLUSION The study established that the extraction of DNA from paneer by DNeasy Mericon food kit was fast as well as simple and did not involve the use of corrosive chemical for DNA isolation unlike the conventional approach. Species specific polymerase chain reaction by using the species specific primers targeting mitochondrial D loop gene, which Fig 4: Buffalo specific PCR for to confirm the presence of buffalo DNA in mix milk paneer yield 126 bp amplicon in cow DNA, enabled authentication of cow milk paneer. The limit of detection of developed method was to the tune of 1%. The developed protocol was reproducible, reliable and robust, which can be used to establish the type of milk used for paneer preparation. This will also help the testing laboratories to confirm the labelling of the type of paneer being sold in the market. ACKNOWLEDGEMENT Authors are very much thankful to the Director, ICAR- NDRI, Karnal and NBAGR, Karnal for providing facilities to carry out this research. REFERENCES Bottero, M.T. and Dalmasso, A. (2010). Animal species identification in food products: Evolution of biomolecular methods. The Vet. J., 190 : Cheng,Y., Chen, S. and Weng, C. (2006). Investigation of Goats Milk Adulteration with Cows Milk by PCR. Asian-Aust. J. Anim Sci., 19 : De, S., Brahma, B., Polley, S., Mukherjee, A., Banerjee,D. and Gohaina, M. (2011). Simplex and duplex PCR assays for species specific identification of cattle and buffalo milk and cheese. Food Cont., 22: De, S. (2005). Outlines of Dairy Technology. Oxford University Press, New Delhi. De, S., Singh, R. K., Gupta, P. K., Palia, S. and Butchaiah, G. (2000) Genotyping of dairy animals using DNA from milk somatic cells. Ind Jour of Ani Sci. 70 : Khan, S. U. and Pal. M. A. (2011). Paneer production: A review. J.Food.Sci.Tech., 48 : Kocher,T.D., Thomas, W.K., Meyer, A., Edwards, S.V., Pabo, S., Villablanca, F.X. and Wilson, A.C. (1989). Dynamics of mitochondrial DNA evolution in mammals: amplification & sequencing with conserved primers. Proc. Natl. Acad. Sci., 86: Lockley, A. K. and Bardsley, R. G. (2000). DNA-based methods for food authentication. Trends in Food Sci & Tech., 11: Maudet, C. and Taberlet, P. (2001). Detection of cows milk in goats cheeses inferred from mitochon drial DNA polymorphism. J. of Dairy Res., 68 :

5 966 INDIAN JOURNAL OF ANIMAL RESEARCH Masud,T., Athar, I. H. and Shah, M. A. (1992) Comparative study of paneer making from buffalo and cow milk. Asian Australian J. Of Ani. Sci., 5: Reeta., Kumar, A. and Kumbhar, B.K. (2012). Study of Sensory and Textural Properties of Paneer Using Edible Coating. Open Acc. Scien Reports., 1: Sambrook,J.and Russell, D.W. (1989). Prepparation and analysis of eukaryotic DNA. In molecular cloning:a laboratory manual.3 rd edition.cold spring Harbor Press, New Yark: Singh, S. and Kanawjia,S.K. (1988). Development of manufacturing technique for paneer from cow milk. Indian J. of Dairy Sci., 41: Wong, C. M. V. L., Lim, A. C. and Chua, H. K. (2010). Detection of meat contaminants in processed meats using polymerase chain reaction-restriction fragment length polymorphismanalysis. Borneo. Sci., 2 :15-18