P OLYMORPHIC CHLOROPLAST MICROSATELLITE LOCI IN N ELUMBO (NELUMBONACEAE) 1

Transcription

1 American Journal of Botany: e240 e AJB PRIMER NOTES & PROTOCOLS IN THE PLANT SCIENCES P OLYMORPHIC CHLOROPLAST MICROSATELLITE LOCI IN N ELUMBO (NELUMBONACEAE) 1 J IANHUA X UE 2,3, S HUO W ANG 2,4, AND S HI-LIANG Z HOU 2,5 2 State Key Laboratory of Systematic and Evolutionary Botany, Institute of Botany, Chinese Academy of Sciences, Beijing , People s Republic of China; 3 State Key Laboratory of Vegetation and Environmental Change, Institute of Botany, Chinese Academy of Sciences, Beijing , People s Republic of China; and 4 College of Landscape Architecture, Northeast Forestry University, Harbin , People s Republic of China Premise of the study: To study population genetics, phylogeography, and hybridization of Nelumbo (Nelumbonaceae), chloroplast microsatellite markers were developed. Methods and Results: Seventeen microsatellite loci were identified from the chloroplast genomes of N. nucifera and N. lutea. Polymorphisms were assessed in three populations of N. nucifera and one population of N. lutea. Nine loci were found to be polymorphic in N. nucifera, and all 17 loci were found to be polymorphic in N. lutea. In N. nucifera, the number of alleles per locus ranged from two to six, and the unbiased haploid diversity per locus ranged from to In N. lutea, the number of alleles ranged from two to four, and the unbiased haploid diversity per locus ranged from to Conclusions: The identified chloroplast simple sequence repeat markers will be useful for the study of genetic diversity, phylogeography, and identification of Nelumbo cultivars. Key words: chloroplast microsatellite; cpssr; Nelumbo ; Nelumbonaceae. Nelumbo Adans., a genus of two species, N. nucifera Gaertn. and N. lutea Willd., is the only genus of the Nelumbonaceae and has an Asian and North American disjunct distribution pattern. Nelumbo nucifera (sacred lotus), distributed in Asia and northern Australia, is best known for its economic and ornamental properties. Its rhizomes and seeds are also used as food and in Chinese traditional medicine. It is widely cultivated in Asia because of its economic value and religious associations ( Hayes et al., 2000 ). At present, there are more than 600 cultivars in China ( Wang and Zhang, 2005 ). By contrast, N. lutea (American lotus), which is native to North America, is less frequently cultivated ( Turner et al., 2010 ). Although the two species are morphologically distinct, hybrids between them are fertile and cultivars were bred by interspecific hybridization. Although nuclear simple sequence repeat (SSR) markers for N. nucifera ( Tian et al., 2008 ; Kubo et al., 2009 ; Pan et al., 2010 ) are powerful in parentage analyses, maternally inherited chloroplast markers are more straightforward in identification of maternal parents of cultivars. Here, we report a set of polymorphic chloroplast microsatellite markers for both N. nucifera and N. lutea. They are expected to be useful complements 1 Manuscript received 16 November 2011; revision accepted 20 January The authors thank Grant Mitchell, Hongli Tian, and Xiucheng Sun for collecting samples, and Wenpan Dong for preparing the chloroplast genome data. This study was supported by grants from the National Natural Science Foundation of China (NSFC; and ), the Knowledge Innovation Program of the Chinese Academy of Sciences (KSCX2-EW-Z-5), and the Natural Science Foundation of Heilongjiang Province (C ). 5 Author for correspondence: slzhou@ibcas.ac.cn doi: /ajb to nuclear microsatellite markers for studies on population genetics, phylogeography, and cultivar identification. METHODS AND RESULTS Four complete chloroplast genomes, two of N. lutea (JQ and NC_015605) and two of N. nucifera (JQ and NC_015610), were downloaded from GenBank and manually aligned with Se-Al version 2.0 (available at: Polymorphic mononucleotide repeats longer than six nucleotides were spotted directly from the alignments; di-, tri-, tetra-, and pentanucleotide motifs with a minimum of five repeats were identified from the four genomes using SSR Hunter version 1.3 (Qiang Li, Nanjing Agricultural University, Nanjing, China). A total of 38 chloroplast simple sequence repeat loci (cpssrs) were detected, including 20 polymorphic mononucleotide repeats, 14 dinucleotide repeats, two trinucleotide repeats, and two pentanucleotide repeats. The flanking regions of eight cpssrs were unsuitable for primer design due to very low GC content. Primers for the other 30 cpssrs were designed by Primer Premier version 5.0 ( com), using the following criteria: (1) GC content 40 60%; (2) melting temperature ( T m ) C; (3) primer size bp in length; and (4) amplicon size bp in length. Primer pairs were initially screened for amplification success using two individuals each of N. nucifera and N. lutea. Genomic DNA was extracted from fresh leaves using the cetyltrimethylammonium bromide (CTAB) method ( Doyle and Doyle, 1987 ). PCR was carried out in a 10 μl reaction volume containing 5 15 ng template DNA, 0.2 mm dntps, 2.0 mm MgCl 2, 0.25 μm each primer, 10 PCR buffer (Tiangen Biotech Ltd., Beijing, China), and 0.5 U Taq DNA polymerase (Tiangen Biotech Ltd.). The PCR program was 94 C for 4 min; 25 cycles of 94 C for 30 s, 30 s at annealing temperature ( Table 1 ), and 1 min at 72 C; and a final extension of 72 C for 10 min. Twenty-four of the 30 primer pairs produced amplicons matching the expected sizes. Polymorphisms of these 24 cpssrs were assessed using 33 samples from Tra Bek Lake, Phnom Penh, Cambodia (collected by Xiucheng Sun); Yueya Lake, Heilongjiang Province, China (collected by Jianhua Xue); Behtagokul Town, Uttar Pradesh Province, India (collected by Grant Mitchell); and Waccamaw Lake, Columbus County, North Carolina, USA (collected by Hongli Tian). Fifty-eight accessions of N. nucifera collected worldwide and three accessions of N. lutea collected American Journal of Botany: e240 e244, 2012; Botanical Society of America e240

2 June 2012] AJB PRIMER NOTES & PROTOCOLS NELUMBO MICROSATELLITES e241 T ABLE 1. Primers for amplifying 17 chloroplast microsatellite loci in Nelumbo. Locus Repeat motif Primer name Primer sequences (5 3 ) L T a ( C) GenBank accession no. ndhf-rpl32 (T) 8...(T) 10...(A) 5 (T) 8 Lotus01F F: TTACTAGTCTTGTTCGATTTTA JN Lotus01R R: ATTACTTGTCGTTGATAAGAAA petn-psbm (G) 14 Lotus02F F: TGATCGGAATCAATACAAATA JN Lotus02R R: AATATGAACCTTTCTACCACA psaj-rpl33 (T) 11 Lotus03F F: TGGATTTCGAGTTACCAACGT JN Lotus03R R: TGCTTGAAACAATAGGGACAG psbc-trns (T) 10...(T) 8 Lotus04F F: ACCTGTTCTTTCCATGACCCC JN Lotus04R R: GCTATCCCACCTAGCCGAGCC psbe-petl (T) 10 Lotus05F F: ATAAGATAAGGTCGTTGTTCG JN Lotus05R R: CAATTCTTGAGTAAAGTAATA psbi-trns (T) 11 Lotus06F F: ACTCTTCGTTTACACGGTAGT JN Lotus06R R: GAGCCTCTTTTATCTTTTATC rbcl-accd (A) 9 Lotus07F F: TCCTTTTCGTTTCGTGTTGTA JN Lotus07R R: AGGTTTCTCCCATGTCGTGTA rp120-rps12 (A) 10 Lotus080F F: TGTTCTACGTCTCCGAGCTATA JN Lotus080R R: ACATTGATTAAATGAGGGAAGG rpl32-trnl (A) 6 Lotus09F F: TAGACCCCTACTTTACGACCC JN Lotus09R R: CTCGGAATAGAACAGTTGGAA rpob-trnc (AT) 5 Lotus10F F: CATTATTGGCTCATTCTTCATC JN Lotus10R R: CTCTTTATTCTTCCGTTCATAC rps2-rpoc2 (T) 5 (A) 15 Lotus11F F: GTGCCATTCTAGGATTCCATT JN Lotus11R R: CATCAGAACAATCATTTACGG trnh-psba (A) 9...(AAATA) 12 Lotus12F F: GCCTTGATCCACTTGGCTACAT JN Lotus12R R: CGTAATGCTCACAACTTCCCTC trni intron (T) 12 Lotus13F F: GAGATCACCCCTTTCATTCTG JN Lotus13R R: CTTTGTGAAATAACTCCGATG trnp-psaj (A) 6 Lotus148F F: ACATCGTTATTTCCTCCATTG JN Lotus148R R: ACGTGGAATCCCTAACTAAAA trns-psbd (A) 8 Lotus15F F: TTAGCAATCCGCCGCTTTAGT JN Lotus15R R: TGACCAGGCCGGGGAAGTAAA trnt-psbd (A) 21 Lotus16F F: GAGTTGGAGGACGACTATGTTA JN Lotus16R R: CTCTGTGGAGGAACGGAATAAC trnt-trnl (AATAT) 5 Lotus17F F: CTAAGCGGGCTTACATAACAG JN Lotus17R R: CCTTCCAAACAAAATGAAATT Note : L = length (in bp) according to the genome sequences; T a = optimal annealing temperature. in Florida, USA, were also assayed (Appendix 1). We repeated the experiments to verify the repeatability of the alleles. The forward primer of each of the 24 primer pairs was labeled with a fluorescent dye (6-FAM or HEX), and microsatellite loci were amplified using the PCR conditions described above. The PCR products mixed with GeneScan LIZ 500 size standards (Applied Biosystems, Foster City, California, USA) were resolved on an ABI 3730XL DNA analyzer (Applied Biosystems). Alleles were identified using GeneMapper version 4.0 software (Applied Biosystems) and confirmed by manual check. The resulting genotype data were analyzed using GenAlEx version 6.41 ( Peakall and Smouse, 2006 ) to calculate the number of alleles per locus and the unbiased haploid diversity. Seventeen out of the 24 cpssr markers were polymorphic in Nelumbo (Table 1 ). They amplified consistently over four populations and in 56 other samples (Appendix 1). In N. nucifera, nine cpssr markers were polymorphic ( Table 2 ). At population level, the number of alleles per locus ranged from two to six, and the unbiased haploid diversity per locus ranged from to ( Table 2 ). The highest diversity was found in the Indian population, and the lowest in the Chinese population. By contrast, in N. lutea all 17 SSR markers were polymorphic, the number of alleles per locus ranged from two to four with an average value of 2.8, and the unbiased haploid diversity per locus ranged from to with an average of ( Table 2 ). A similar level of polymorphism was observed in the other 56 samples ( Table 3 ). Lower genetic diversity in N. nucifera than in N. lutea is probably the result of the recent increased distribution of the former species through cultivation. CONCLUSIONS The alleles of the 17 polymorphic chloroplast loci have been verified to be reliable. This set of novel polymorphic cpssr markers is suitable for studies on Nelumbo requiring chloroplast markers, e.g., studies on the phylogeographical relationship among lineages of lotus and the maternal parents of cultivars. LITERATURE CITED D OYLE, J. J., AND J. L. DOYLE A rapid DNA isolation procedure for small quantities of fresh leaf tissue. Phytochemical Bulletin 19 : HAYES, V., E. L. SCHNEIDER, AND S. CARLQUIST Floral development of Nelumbo nucifera (Nelumbonaceae). International Journal of Plant Sciences 161 : S183 S191. K UBO, N., M. H IRAI, A. K ANEKO, D. T ANAKA, AND K. K ASUMI Development and characterization of simple sequence repeat (SSR) markers in the water lotus ( Nelumbo nucifera ). Aquatic Botany 90 : P AN, L., Q. J. XIA, Z. W. QUAN, H. G. LIU, W. D. KE, AND Y. DING Development of novel EST SSRs from sacred lotus ( Nelumbo nucifera Gaertn.) and their utilization for the genetic diversity analysis of N. nucifera. Journal of Heredity 101 : P EAKALL, R., AND P. E. S MOUSE GenAlEx 6: Genetic analysis in Excel. Population genetic software for teaching and research. Molecular Ecology Notes 6 : T IAN, H. L., X. Q. C HEN, J. X. W ANG, J. H. X UE, J. W EN, G. M ITCHELL, AND S. L. ZHOU Development and characterization of microsatellite loci for lotus ( Nelumbo nucifera ). Conservation Genetics 9 : T URNER, A. M., E. J. CHOLAK, AND M. G RONER Expanding American lotus and dissolved oxygen concentrations of a shallow lake. American Midland Naturalist 164 : 1 8. W ANG, Q. C., AND X. Y. ZHANG Lotus flower cultivars in China. China Forestry Publishing House, Beijing, China.

3 e242 AMERICAN JOURNAL OF BOTANY [Vol. 0 T ABLE 2. Characteristics of 17 polymorphic chloroplast microsatellite loci in four populations of Nelumbo.a Locus China ( N = 8) India ( N = 9) Cambodia ( N = 8) United States ( N = 8) A H d A H d A H d A H d ndhf-rpl petn-psbm psaj-rpl psbc-trns psbe-petl psbi-trns rbcl-accd rp120-rps rpl32-trnl rpob-trnc rps2-rpoc trnh-psba trni intron trnp-psaj trns-psbd trnt-psbd trnt-trnl Mean Note : = not available; A = number of alleles; H d = unbiased haploid diversity; N = sample size. a Geographical coordinates for the populations are: China ( N, E), India ( N, E), Cambodia ( N, E), and United States ( N, E ). T ABLE 3. Characteristics of 17 polymorphic chloroplast microsatellite loci in Nelumbo nucifera and N. lutea. Locus N. nucifera (N = 58) N. lutea (N = 3) A s (bp)a H d A s (bp)a H d ndhf-rpl32 242, petn-psbm 166, 167, psaj-rpl33 286, psbc-trns psbe-petl 184, , psbi-trns 215, rbcl-accd 133, rp120-rps12 372, rpl32-trnl 279, rpob-trnc 153, rps2-rpoc2 358, trnh-psba 362, 366, 371, 376, 377, 380, 380, , , 385, 386, 390, 391, 399, 400, 404, 405, 410, 414, 419, 430, 438 trni intron 221, trnp-psaj trns-psbd 282, trnt-psbd 396, trnt-trnl Mean Note : A = number of alleles; A s = allele size; H d = unbiased haploid diversity; N = number of samples.

4 June 2012] AJB PRIMER NOTES & PROTOCOLS NELUMBO MICROSATELLITES e243 A PPENDIX 1. Population localities of the samples of Nelumbo used in this study. Taxon Population locality Collector Voucher* N. lutea Willd. Beijing Botanical Garden, CAS, Beijing, China Jianhua Xue BOP N. lutea Willd. Beijing Botanical Garden, CAS, Beijing, China Ikegami Shoji BOP N. lutea Willd. Florida, USA Jun Wen BOP N. lutea Willd. Florida, USA Jun Wen BOP N. lutea Willd. Florida, USA Jun Wen BOP N. lutea Willd. New York Botanical Garden, New York, USA Jun Wen BOP N. lutea Willd. North Carolina, USA Hongli Tian BOP N. lutea Willd. North Carolina, USA Hongli Tian BOP N. lutea Willd. North Carolina, USA Hongli Tian BOP N. lutea Willd. North Carolina, USA Hongli Tian BOP N. lutea Willd. Waccamaw Lake, Columbus County, North Carolina, USA Hongli Tian BOP N. nucifera Gaertn. 100 km northwest of Bangkok, Thailand Grant Mitchell BOP N. nucifera Gaertn. Anzali, Iran Grant Mitchell BOP N. nucifera Gaertn. Australia Hidemoto Chishima BOP N. nucifera Gaertn. Behtagokul town, Uttar Pradesh Province, India Grant Mitchell BOP N. nucifera Gaertn. Behtagokul town, Uttar Pradesh Province, India Grant Mitchell BOP N. nucifera Gaertn. Behtagokul town, Uttar Pradesh Province, India Grant Mitchell BOP N. nucifera Gaertn. Behtagokul town, Uttar Pradesh Province, India Grant Mitchell BOP N. nucifera Gaertn. Behtagokul town, Uttar Pradesh Province, India Grant Mitchell BOP N. nucifera Gaertn. Behtagokul town, Uttar Pradesh Province, India Grant Mitchell BOP N. nucifera Gaertn. Yellow Dancing Girl Beijing Botanical Garden, CAS, Beijing, China Jianhua Xue BOP N. nucifera Gaertn. Wakasa Matagora Lotus Kuchinata, Obama City, Fukui Prefecture, Japan Yamamoto Kazuki BOP N. nucifera Gaertn. Zhong Shan Hong Tai Beijing Botanical Garden, CAS, Beijing, China Jianhua Xue BOP N. nucifera Gaertn. Bobai, Guangxi Province, China Shiliang Zhou BOP N. nucifera Gaertn. Caspian region, Russia Jianhua Xue BOP N. nucifera Gaertn. Caspian Sea, Russia Jianhua Xue BOP N. nucifera Gaertn. Dongxiang, Jiangxi Province, China Shiliang Zhou BOP N. nucifera Gaertn. Hapur, Uttar Pradesh, India Grant Mitchell BOP N. nucifera Gaertn. India Grant Mitchell BOP N. nucifera Gaertn. Boddhgaya, India Grant Mitchell BOP N. nucifera Gaertn. Indonesia Grant Mitchell BOP N. nucifera Gaertn. Inle Lake, Myanmar Grant Mitchell BOP N. nucifera Gaertn. Jabalpur, Madhya Pradesh, India Grant Mitchell BOP N. nucifera Gaertn. Jabalpur, Madhya Pradesh, India Grant Mitchell BOP N. nucifera Gaertn. Jinan, Shandong Shaoyuan Xue BOP N. nucifera Gaertn. Jinfoshan, Nanchuan County, Chongqing, China Shiliang Zhou BOP N. nucifera Gaertn. Jinshan village, Jiamusi City, Heilongjiang Province, China Jianhua Xue BOP N. nucifera Gaertn. Kakadu, Australia Grant Mitchell BOP N. nucifera Gaertn. Kuala Lumpur, Malaysia Grant Mitchell BOP N. nucifera Gaertn. Liaohe River, Liaoning Province, China Yumin Guo BOP N. nucifera Gaertn. Qianling White Lotus Garden, Baiyangdian Lake, Hebei Province, China Shiliang Zhou BOP N. nucifera Gaertn. Shokkohren Lotus Pool Garden, Beijing, China Hongli Tian BOP N. nucifera Gaertn. Ohga-basu Lotus Research Center, Wuhan City, Hubei Province, China Hongli Tian BOP N. nucifera Gaertn. Xiamen Wanlian Lotus Research Center, Wuhan City, Hubei Province, China Hongli Tian BOP N. nucifera Gaertn. Malaysia Grant Mitchell BOP N. nucifera Gaertn. Mandalay, Myanmar Grant Mitchell BOP N. nucifera Gaertn. New Zealand Grant Mitchell BOP N. nucifera Gaertn. Osaka, Japan Yamamoto Kazuki BOP N. nucifera Gaertn. Habibkot, Pakistan Grant Mitchell BOP N. nucifera Gaertn. Phnom Penh, Cambodia Xiucheng Sun BOP N. nucifera Gaertn. Phnom Penh, Cambodia Xiucheng Sun BOP N. nucifera Gaertn. Phnom Penh, Cambodia Xiucheng Sun BOP N. nucifera Gaertn. Phnom Penh, Cambodia Xiucheng Sun BOP N. nucifera Gaertn. Phnom Penh, Cambodia Xiucheng Sun BOP N. nucifera Gaertn. Phnom Penh, Cambodia Xiucheng Sun BOP N. nucifera Gaertn. Phnom Penh, Cambodia Xiucheng Sun BOP N. nucifera Gaertn. Phnom Penh, Cambodia Xiucheng Sun BOP N. nucifera Gaertn. Phnom Penh, Cambodia Xiaoqing Cao BOP N. nucifera Gaertn. Pulandian, Liaoning Province, China Jianhua Xue BOP N. nucifera Gaertn. Puzhehei, Qiubei County, Yunnan Province, China Shiliang Zhou BOP N. nucifera Gaertn. Xihu Honglian Qiaotou, Dongguang County, Guangdong Province, China Jianhua Xue BOP N. nucifera Gaertn. Qujianwan, Honghu City, Hubei Province, China Hongli Tian BOP N. nucifera Gaertn. Royal Palace, Seoul, Korea Yamamoto Kazuki BOP N. nucifera Gaertn. Birobidzhan City, Russia Jianhua Xue BOP N. nucifera Gaertn. Seoni District, Madhya Pradesh State, India Grant Mitchell BOP N. nucifera Gaertn. Singapore Grant Mitchell BOP N. nucifera Gaertn. Sitapur, Uttar Pradesh, India Grant Mitchell BOP N. nucifera Gaertn. Sutan, Hanshan County, Anhui Province, China Hongli Tian BOP N. nucifera Gaertn. Tai Lake, Jiangsu Province, China Jianhua Xue BOP007399

5 e244 AMERICAN JOURNAL OF BOTANY APPENDIX 1. Continued. Taxon Population locality Collector Voucher* N. nucifera Gaertn. Taiwan, China Grant Mitchell BOP N. nucifera Gaertn. Tashkent, Uzbekistan Grant Mitchell BOP N. nucifera Gaertn. Thailand Grant Mitchell BOP N. nucifera Gaertn. Thailand Grant Mitchell BOP N. nucifera Gaertn. Thuan Hoa Lake, Ho Chi Minh City, Vietnam Grant Mitchell BOP N. nucifera Gaertn. Tumenjiang River, Jilin Province, China Yumin Guo BOP N. nucifera Gaertn. Vietnam Jianhua Xue BOP N. nucifera Gaertn. Volga Delta, Russia Maria Victorovna Kryukova BOP N. nucifera Gaertn. Weishan Lake, Jining City, Shandong Province, China Hongli Tian BOP N. nucifera Gaertn. Wuchenhe, Xinxian County, Henan Province, China Hongli Tian BOP N. nucifera Gaertn. Wuyishan City, Fujian Province, China Shiliang Zhou BOP N. nucifera Gaertn. Xinjin County, Liaoning Province, China Jianhua Xue BOP N. nucifera Gaertn. Xuanwu Lake, Nanjing, Jiangsu Province, China Shiliang Zhou BOP N. nucifera Gaertn. Yangon-Dalla-Mumatui, Myanmar Grant Mitchell BOP N. nucifera Gaertn. Yangon-Dalla-Nyung Gone, Myanmar Grant Mitchell BOP N. nucifera Gaertn. Yiliang, Yunnan Province, China Shiliang Zhou BOP N. nucifera Gaertn. Yongsheng County, Yunnan Province, China Shiliang Zhou BOP N. nucifera Gaertn. Yueya Lake, Hulin City, Heilongjiang Province, China Jianhua Xue BOP N. nucifera Gaertn. Yueya Lake, Hulin City, Heilongjiang Province, China Jianhua Xue BOP N. nucifera Gaertn. Yueya Lake, Hulin City, Heilongjiang Province, China Jianhua Xue BOP N. nucifera Gaertn. Yueya Lake, Hulin City, Heilongjiang Province, China Jianhua Xue BOP N. nucifera Gaertn. Yueya Lake, Hulin City, Heilongjiang Province, China Jianhua Xue BOP N. nucifera Gaertn. Yueya Lake, Hulin City, Heilongjiang Province, China Jianhua Xue BOP N. nucifera Gaertn. Yueya Lake, Hulin City, Heilongjiang Province, China Jianhua Xue BOP N. nucifera Gaertn. Yueya Lake, Hulin City, Heilongjiang Province, China Jianhua Xue BOP Note : CAS = Chinese Academy of Sciences. * Stored in the Herbarium of the Institute of Botany (PE), Chinese Academy of Sciences.