Identification of IGF-1-enhanced cytokine expressions targeted by mir-181d in. glioblastomas via an integrative mirna/mrna regulatory network analysis

Transcription

1 Identification of IGF-1-enhanced cytokine expressions targeted by mir-181d in glioblastomas via an integrative mirna/mrna regulatory network analysis Kuo-Hao Ho 1*, Peng-Hsu Chen 2*, Edward Hsi 3, Chwen-Ming Shih 2,6, Wei-Chiao Chang 4,5, Chia-Hsiung Cheng 2,6, Cheng-Wei Lin 2,6, Ku-Chung Chen 2,6# 1. Department of Clinical Pharmacy, School of Pharmacy, Taipei Medical University, Taipei, Taiwan 2. Graduate Institute of Medical Sciences, College of Medicine, Taipei Medical University, Taipei, Taiwan 3. Graduate Institute of Biomedical Sciences, China Medical University, Taichung, Taiwan 4. Department of Clinical Pharmacy, Master Program for Clinical Pharmacogenomics and Pharmacoproteomics, School of Pharmacy, Taipei Medical University, Taipei, Taiwan 5. Department of Pharmacy, Taipei Medical University-Wanfang Hospital, Taipei, Taiwan 6. Department of Biochemistry and Molecular Cell Biology, School of Medicine, College of Medicine, Taipei Medical University, Taipei, Taiwan *These authors contributed equally to the work. # Corresponding authors: Dr. Ku-Chung Chen

2 Supplementary Figure legends Supplementary Figure S1. GSEAs with insulin-like growth factor (IGF)-1- associated differentially expressed genes (DEGs). GSEA diagrams showing that the gene set related to cytokine-cytokine receptor interactions was enriched in IGF-1- upregulated patients from TCGA microarray (A) and RNA Seq (B) data. The 48 and 32 core enrichment genes in (A) and (B) were identified in the leading edge subset. Supplementary Figure S2. Endogenous levels of mir-181d in mir-181doverexpressing cells. After cells were transfected with the indicated doses of mir- 181d-expressing plasmids or empty pcdh vectors for 24 h, relative levels of mir-181d were measured with a real-time PCR. The mir-191-5p level was used as an internal control. Data are the mean ± SD of three experiments. Supplementary Figure S3. The effects of IGF-1-miR181d-cytokines axis on glioma cell growth and invasion. (A) The effect of IGF-1 on U87-MG cell growth. After cells were treated with 100 ng/ml IGF-1 for 24 h, the cell growth was measured by MTT assays. (B and C) The effects of IGF-1, IL1b, CCR1, and mir-181d on U87-MG and M059K cell invasion. After cells were respectively treated with 100 ng/ml IGF-1, 10ng/ml IL1b, or transfecting with CCR1 and mir-181d overexpressing plasmids, the cell invasion changes were measured by matrigel invasion assays. (D) Overexpression of CCR1 genes. After cells were transfected with 1 g pcdna3-ccr1 plasmids, the CCR1 protein levels were measured by immunoblotting assays.

3 Supplementary Table S1. Gene set enrichment analysis of IGF-1-associated DEGs in microarray Enrichment gene set Number of genes NES p. value FDR Cytokine-cytokine receptor interaction Tuberculosis Chemokine signaling pathway Phagosome Osteoclast differentiation Herpes simplex infection Influenza A Toll-like receptor signaling pathway TNF signaling pathway Toxoplasmosis Lysosome Cell adhesion molecules (CAMs) Platelet activation Systemic lupus erythematosus NF-kappa B signaling pathway Fc gamma R-mediated phagocytosis Leukocyte transendothelial migration Leishmaniasis Amoebiasis Rheumatoid arthritis Complement and coagulation cascades Antigen processing and presentation Pertussis Inflammatory bowel disease (IBD) Hematopoietic cell lineage Viral myocarditis Legionellosis Staphylococcus aureus infection Protein digestion and absorption Type I diabetes mellitus Malaria Autoimmune thyroid disease Allograft rejection Graft-versus-host disease Intestinal immune network for IgA production

4 Asthma Primary immunodeficiency Proteoglycans in cancer Measles Natural killer cell mediated cytotoxicity Salmonella infection Arachidonic acid metabolism Chagas disease (American trypanosomiasis) NOD-like receptor signaling pathway RNA polymerase AGE-RAGE signaling pathway in diabetic complications Basal transcription factors African trypanosomiasis Phototransduction Mismatch repair Pathogenic Escherichia coli infection Prion diseases Chemical carcinogenesis Epstein-Barr virus infection Ribosome biogenesis in eukaryotes Homologous recombination Glycine, serine and threonine metabolism Nucleotide excision repair

5 Supplementary Table S2. Gene set enrichment analysis of IGF-1-associated DEGs in RNA seq Enrichment gene set Number of genes NES p. value FDR Cytokine-cytokine receptor interaction Chemokine signaling pathway Osteoclast differentiation HTLV-I infection Cell adhesion molecules (CAMs) Tuberculosis Neuroactive ligand-receptor interaction Influenza A Phagosome Jak-STAT signaling pathway Herpes simplex infection Natural killer cell mediated cytotoxicity Leishmaniasis TNF signaling pathway Chagas disease (American trypanosomiasis) Toxoplasmosis Measles Rheumatoid arthritis T cell receptor signaling pathway Staphylococcus aureus infection NF-kappa B signaling pathway Toll-like receptor signaling pathway Hematopoietic cell lineage Pertussis Complement and coagulation cascades Platelet activation Intestinal immune network for IgA production Fc gamma R-mediated phagocytosis Systemic lupus erythematosus Inflammatory bowel disease (IBD) Salmonella infection Amoebiasis NOD-like receptor signaling pathway Malaria Allograft rejection

6 Graft-versus-host disease Antigen processing and presentation Type I diabetes mellitus Autoimmune thyroid disease Primary immunodeficiency Asthma Legionellosis Prion diseases Viral myocarditis Inflammatory mediator regulation of TRP channels Leukocyte transendothelial migration PI3K-Akt signaling pathway Homologous recombination African trypanosomiasis AGE-RAGE signaling pathway in diabetic complications Ribosome B cell receptor signaling pathway DNA replication Sulfur relay system Arachidonic acid metabolism Transcriptional misregulation in cancer Calcium signaling pathway Fanconi anemia pathway Terpenoid backbone biosynthesis Aminoacyl-tRNA biosynthesis Notch signaling pathway Apoptosis RNA degradation Epstein-Barr virus infection Cytosolic DNA-sensing pathway Rap1 signaling pathway Base excision repair

7 Supplementary Table S3. Differentially expressed mirnas in TCGA database mirna log2fc p. value FDR hsa-mir E E-07 hsa-mir-9* E E-07 hsa-mir hsa-mir-181d E E-08 hsa-mir-130b E E-05 hsa-mir hsa-mir E hsa-mir-181c E hsa-mir-20a E hsa-mir-17-5p E hsa-mir E E-05 hsa-mir-19b E hsa-mir hsa-mir-106a hsa-mir-106b E hsa-mir-19a hsa-mir-551b E hsa-mir E hsa-mir E hsa-mir hsa-mir-15b hsa-let-7i hsa-mir hsa-mir-20b hsa-mir-125b hsa-mir-454-3p E hsa-mir-181a hsa-mir hsa-mir-17-3p hsa-mir E hsa-mir-181a* hsa-mir-130a hsa-mir hsa-mir-181b hsa-mir-30b

8 hsa-mir-30d hsa-mir hsa-mir E hsa-mir hsa-mir-542-3p hsa-mir hsa-mir hsa-mir hsa-mir hsa-mir-18b hsa-mir-182* hsa-mir hsa-mir E hsa-mir E hsa-mir E hsa-mir-302a* kshv-mir-k ebv-mir-bart3-3p hsa-mir hsa-mir hsa-mir hsa-mir hsa-mir hcmv-mir-us25-2-3p hsa-mir-33b hsa-mir hcmv-mir-ul22a* hsa-mir hsa-mir hsa-mir hsa-mir hsa-mir hsa-mir hsa-mir hsa-mir kshv-mir-k ebv-mir-bhrf

9 hsa-mir-515-5p hsa-mir hsa-mir hsa-mir hsa-mir ebv-mir-bart8-5p hsa-mir hsa-mir hsa-mir-380-5p ebv-mir-bart11-5p

10 Supplementary Table S4. Differentially expressed mirnas in IGF-1-treated U87-MG cells microrna log2fc p. value FDR hsa-mir hsa-mir-21-5p hsa-mir hsa-mir-125b-5p E hsa-mir-1260a hsa-let-7f-5p hsa-mir-29a-3p E hsa-mir hsa-let-7a-5p hsa-let-7b-5p E hsa-mir-125a-5p hsa-let-7c hsa-mir-16-5p hsa-mir-100-5p hsa-let-7d-5p hsa-mir-363-5p hsa-mir-99a-5p hsa-mir hsa-mir-221-3p hsa-mir-1260b hsa-mir-27a-3p hsa-let-7e-5p E hsa-mir-23a-3p hsa-mir-222-3p hsa-mir hsa-mir-3135b hsa-mir-23b-3p hsa-mir-29c-3p hsa-mir-29b-3p hsa-mir-26a-5p hsa-mir-9-5p E hsa-mir hsa-mir-98-5p E hsa-mir-92b-3p hsa-mir-27b-3p hsa-mir-181a-5p

11 hsa-mir-22-3p hsa-mir hsa-let-7g-5p hsa-mir-92a-3p hsa-mir-10a-5p hsa-mir-19b-3p hsa-mir-15a-5p E hsa-mir p hsa-mir p hsa-mir-17-5p E hsa-mir-34a-5p hsa-mir-20a-5p hsa-mir-99b-5p hsa-mir-138-5p E hsa-mir p hsa-mir-20b-5p hsa-mir-195-5p hsa-mir-24-3p hsa-mir-541-3p hsa-mir hsa-mir-19a-3p hsa-mir-26b-5p E hsa-mir-106a-5p hsa-mir p hsa-mir-15b-5p hsa-mir p E hsa-mir-30d-5p E hsa-mir p hsa-mir p hsa-mir-193b-3p hsa-mir-30a-5p hsa-mir hsa-mir-766-3p hsa-mir-181b-5p hsa-mir-34b-5p hsa-mir-130a-3p E hsa-mir-197-3p hsa-let-7i-5p

12 hsa-mir-30e-5p hsa-mir-145-5p hsa-mir p hsa-mir hsa-mir p hsa-mir-30b-5p hsa-mir hsa-mir p hsa-mir p hsa-mir hsa-mir hsa-mir-10b-5p hsa-mir-106b-5p E hsa-mir-6511b-5p hsa-mir hsa-mir-181c-5p E hsa-mir p hsa-mir p hsa-mir-423-3p hsa-mir hsa-mir p hsa-mir p hsa-mir p hsa-mir hsa-mir hsa-mir-191-5p hsa-mir p hsa-mir-151a-5p, hsa-mir-151b E hsa-mir-30c-5p hsa-mir-21-3p hsa-mir p hsa-mir-455-3p hsa-mir-93-5p hsa-mir hsa-mir-449b-3p hsa-mir-28-5p hsa-mir-25-3p hsa-mir-3622a-3p

13 hsa-mir p hsa-mir hsa-mir hsa-mir E hsa-mir p hsa-mir-103a-3p hsa-mir hsa-mir hsa-mir-6511a-5p, hsa-mir-6511b-5p hsa-mir-9-3p E hsa-mir p hsa-mir hsa-mir-181d hsa-mir hsa-mir p hsa-mir-6511a-3p hsa-mir hsa-mir-130b-3p hsa-mir hsa-mir hsa-mir hsa-mir p hsa-mir-374a-5p hsa-mir-361-5p hsa-mir p hsa-mir-143-3p hsa-mir hsa-mir p hsa-mir hsa-mir p hsa-mir p hsa-mir p hsa-mir p hsa-mir-424-5p hsa-mir-125b-1-3p hsa-mir-320d hsa-mir p hsa-mir

14 hsa-mir p hsa-mir p hsa-mir hsa-mir p hsa-mir p hsa-mir hsa-mir hsa-mir p hsa-mir-22-5p hsa-mir p hsa-mir-574-3p hsa-mir hsa-mir p hsa-mir p hsa-mir-708-5p hsa-mir p hsa-mir-18a-5p hsa-mir p hsa-mir hsa-mir hsa-mir hsa-mir hsa-mir hsa-mir p hsa-mir-378a-3p hsa-mir-664a-3p hsa-mir p hsa-mir p hsa-mir-422a hsa-mir hsa-mir hsa-mir hsa-mir p hsa-mir-378g hsa-mir-3622b-5p hsa-mir-486-5p hsa-mir-186-5p hsa-mir p

15 hsa-mir-374b-5p hsa-mir-151a-3p hsa-mir p hsa-mir-335-5p hsa-mir p hsa-mir hsa-mir-532-3p hsa-mir-365a-3p, hsa-mir-365b-3p hsa-mir p hsa-mir-885-3p hsa-mir p hsa-mir hsa-mir-4436b-5p hsa-mir hsa-mir-378i hsa-mir p hsa-mir hsa-mir-146b-5p hsa-mir-320e hsa-mir-29b-1-5p hsa-mir hsa-mir-140-3p hsa-mir-18b-5p hsa-mir-320a hsa-mir hsa-mir p hsa-mir hsa-mir-6511b-3p hsa-mir-625-5p hsa-mir-339-5p hsa-mir-142-3p hsa-mir-664b-3p hsa-mir-378c hsa-mir-125b-2-3p hsa-mir-221-5p hsa-mir-491-3p hsa-mir p hsa-mir-101-3p

16 hsa-mir hsa-mir p hsa-mir-23c hsa-mir p hsa-mir p hsa-mir-378f hsa-mir-378e hsa-mir p hsa-mir p hsa-mir-877-3p hsa-let-7a-3p hsa-mir-7-5p hsa-mir-132-3p hsa-mir p hsa-mir p hsa-mir-378d hsa-mir-345-5p hsa-mir hsa-mir-302c-5p hsa-mir p hsa-mir-185-5p hsa-mir-129-5p hsa-mir-148b-3p hsa-mir p hsa-mir-503-5p hsa-mir hsa-mir

17 Supplementary Table S5. The correlation analysis between mirnas and genes of cytokine and cytokine receptor interaction Gene Correlation p value mir-9-5p-trageted genes IL1R < E-16 TGFBR E-15 CCR E-15 CXCL E-06 GHR mir-9-3p-trageted genes IL10RA <E-16 TGFBR E-14 CSF2RB E-10 GHR mir-130b-trageted genes TGFBR E-15

18 Supplementary Table S6. Statistical calculations for high IGF-1/low mirna status Covariate Hazard Ratio 95% 95% Conf-U Conf-L stderr p. value High IGF-1/Low mir-9-5p status High IGF-1/ Low mir-9-5p G-CIMP Age > Karnofsky score <0.001 Gender (male) High IGF-1/Low mir-9-3p status High IGF-1/ Low mir-9-3p G-CIMP Age > Karnofsky score <0.001 Gender (male) High IGF-1/Low mir-130b status High IGF-1/ Low mir-130b G-CIMP <0.001 Age > <0.001 Karnofsky score Gender (male)

19 Supplementary Table S7. Survival analysis of mir-181d- or mir-9-3p-targeted genes Gene Target mirna Hazard SD of log Ratio intensities p value IL10RA mir-181d, mir-9-3p CSF2RB mir-181d, mir-9-3p IL7R mir-181d TGFBR2 mir-181d, mir-9-3p IL1R1 mir-181d CXCL9 mir-181d IL2RB mir-181d GHR mir-181d, mir-9-3p CXCL12 mir-181d SD of log intensities : standard deviation of the log 2 of the gene expression level

20 Supplementary Table S8. Primer list Primer name Sequence For mir-181d gene cloning mir-181d-clon-f ACAGAATTCAACATTCAACCTGTCGGTGAG mir-181d-clon-r ACAGGATCCCCAACCCTCTAATATTTAGTC For 3 UTR cloning CCR1-3UTR-F TATCTCGAGGACCATAGGAGGCCAACCCA CCR1-3UTR-R ATCTCTAGAATTCCAAGAGCCCAAATCCT IL1B -3UTR-F TATCTCGAGTGTGCTGAATGTGGACTCAATCCCTAGGGCTG IL1B -3UTR-R ATCTCTAGACTTCAGTGAAGTTTATTTCAGAACCA For 3 UTR Mutagenesis CCR1-3UMUT-F ACTTGGGATAGAGAGGGCCGACAATGGTGGCCTGGGGCTT CCR1-3UMUT-R AAGCCCCAGGCCACCATTGTCGGCCCTCTCTATCCCAAGT IL1B -3UMUT-F TATCTCGAGTGTGCTGCCGACGGACTCAATCCCTAGGGCTG For real-time PCR IL1B -sybr-f ATGATGGCTTATTACAGTGGCAA IL1B -sybr-r GTCGGAGATTCGTAGCTGGA CCR1-sybr-F GACTATGACACGACCACAGAGT CCR1-sybr-R CCAACCAGGCCAATGACAAATA GAPDH-sybr-F GTG AAG GTC GGA GTC AAC GAPDH-sybr-R GTT GAG GTC AAT GAA GGG

21 Supplementary Figure S1 A IGF1 upregulated patients IGF-1 downregulated patients leading edge subset B IGF1 upregulated patients IGF1 downregulated patients leading edge subset

22 Supplementary Figure S2 Relative mir-181d levels (Fold of control) pcdh-mir-181d ( g) * *

23 Supplementary Figure S3 A B Control U87-MG IL1b mir-181d OE Cell proliferation (% of control) IGF-1 CCR1 OE 20 C Treatment time (hours) M059K Control IL1b mir-181d OE D IGF-1 CCR1 OE CCR1 b-actin U87-MG M059K